help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0689
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/1/24    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brar, B. K.
Right arrow Articles by Vale, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brar, B. K.
Right arrow Articles by Vale, W.
Endocrinology Vol. 145, No. 1 24-35
Copyright © 2004 by The Endocrine Society

Urocortin-II and Urocortin-III Are Cardioprotective against Ischemia Reperfusion Injury: An Essential Endogenous Cardioprotective Role for Corticotropin Releasing Factor Receptor Type 2 in the Murine Heart

Bhawanjit K. Brar, Anne K. Jonassen, Elena M. Egorina, Alon Chen, Alejandra Negro, Marilyn H. Perrin, Ole D. Mjøs, David S. Latchman, Kuo-Fen Lee and Wylie Vale

Clayton Foundation Laboratories for Peptide Biology (B.K.B., A.C., A.N., M.H.P., K.-F.L., W.V.), The Salk Institute, La Jolla, California 92037; Department of Medical Physiology (A.K.J., E.M.E., O.D.M.), Institute of Medical Biology, Faculty of Medicine, University of Tromsø, 9037 Tromsø, Norway; and Institute of Child Health (D.S.L.), University College London, London, United Kingdom WC1N 1EH

Address all correspondence and requests for reprints to: Wylie Vale, The Clayton Foundation Laboratories for Peptide Biology, The Salk Institute, La Jolla, California 92037. E-mail: vale{at}salk.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Corticotropin-releasing factor (CRF) receptor type 2ß (CRFR2ß) is expressed in the heart. Urocortin (Ucn)-I activation of CRFR2ß is cardioprotective against ischemic reperfusion (I/R) injury by stimulation of the ERKs1/2 p42, 44. However, by binding CRF receptor type 1, Ucn-I can also activate the hypothalamic stress axis. Ucn-II/stresscopin related peptide and Ucn-III/stresscopin are two new members of the CRF/Ucn-I gene family and are selective for CRFR2ß. We propose that CRFR2ß selective Ucn-II or Ucn-III will protect cardiomyocytes and the ex vivo Langendorff perfused rat heart from I/R injury by activation of ERK1/2-p42, 44. Ucn-II is expressed in mouse cardiomyocytes, and Ucn-II or Ucn-III can bind to CRFR2ß, resulting in ERK1/2-p42, p-44 phosphorylation and cAMP stimulation. Phosphorylation of ERK1/2-p42, p-44 is regulated by the Ras/Raf-1 kinase pathway, independent of adenylate cyclase and, therefore, cAMP activation. Ucn-II and Ucn-III protect cardiomyocytes from I/R injury and reduce the percentage of infarct size:risk ratio in Langendorff perfused rat hearts exposed to regional I/R (P < 0.001). The CRFR2 selective antagonist astressin2-B and an ERK1/2-p42, 44 inhibitor abolish the cardioprotective actions of Ucn-II and Ucn-III in reperfusion. Cardiomyocytes isolated from CRFR2-null mice are less resistant to I/R injury, compared with wild-type cardiomyocytes. We propose the use of CRFR2 selective agonists, Ucn-II and Ucn-III, to treat ischemic heart disease because of their potent cardioprotective effects in the murine heart and their minimal impact on the hypothalamic stress axis. We emphasize an important endogenous cardioprotective role for CRFR2ß in the murine heart.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NECROSIS AND APOPTOSIS occur during ischemia and subsequent reperfusion after ischemia reperfusion (I/R) (1, 2). Apoptosis is a contributor to human myocardial infarction (3) and occurs within 24 h after ischemia, inducing massive losses of myocytes and increasing the susceptibility to cardiac dysfunction (3). Hence, attention has turned to adjunctive pharmacological treatments to enhance myocardial tolerance to I/R-induced stress. Ideally, because this cytoprotective therapy would be administered after the onset of ischemia, candidate agents would need to be effective in the context of administration during reperfusion.

The neuropeptide corticotropin-releasing factor (CRF) is distributed throughout the brain in which it plays an important role in the behavioral and autonomic responses to stress (4, 5). Interest has emerged over the past few years in the use of the CRF-related peptide urocortin (Ucn)-I as a cardioprotective agent against ischemia (2). Ucn-I is found in rat (6) and human heart (7) and is cardioprotective when added to the intact rat heart at reperfusion after regional ischemia (2). Exogenously administered Ucn-I causes vasodilation, increases heart rate, cardiac output, and coronary blood flow and has a positive inotropic effect (8, 9). Recently Ucn-I has been shown to promote hemodynamic and bioenergetic recovery of isolated rat hearts exposed to regional ischemia (10).

Identification of the intracellular signaling pathways that control apoptosis in cardiomyocytes exposed to I/R and the process by which Ucn-I prevents apoptosis could potentially lay the foundation for novel therapeutic strategies. One mechanism by which Ucn-I is cardioprotective is by activation of the MAPK kinase (MEK1). MEK1 in turn activates MAPKs ERK1/2-p42, 44 and an increase in protein synthesis (2, 11, 12, 13).

Recently two other mammalian homologs of Ucn-I have been discovered, Ucn-II/stresscopin-related peptide (14, 15) and Ucn-III/stresscopin (15, 16). RT-PCR showed that a small amount of Ucn-III/stresscopin and a greater level of Ucn-II/stresscopin-related peptide are found in human heart (15). The actions of CRF and the urocortins are mediated through several class B seven-transmembrane domain G protein-coupled receptors. CRF receptors are all coupled to adenylate cyclase (AC) by G{alpha}s. Thus, activated receptors increase intracellular levels of cAMP. CRF receptor (CRFR) type 1 is expressed at very high levels within the brain and pituitary (17), whereas CRFR2 is the only type of CRFR found in the heart: the {alpha}-form in man (17) and the ß-form in rat/mouse (17). Compared with CRF, Ucn-I binds with 10-fold greater affinity to CRFR2ß (18) and binds to CRFR2 and CRFR1 with equal affinity (19).

A potential complication of using Ucn-I to treat I/R is that it can also activate CRFR1 and thus the hypothalamic pituitary axis (HPA). In our laboratory we have previously shown that Ucn-I administered to rats in vivo activates the HPA by increasing plasma ACTH levels (20). Elevated plasma ACTH levels can then give rise to elevated cortisol levels, which have been shown to have detrimental effects on the hearts of humans (21, 22). There are other untoward effects of HPA activation on other systems that would limit the application of Ucn-I (23). In addition, there are many studies correlating stress with coronary heart disease in humans (24). Also, since the introduction of ACTH and adrenocortical steroids into clinical practice, they have been found to raise blood pressure (25). Because Ucn-I has not been administered to patients, we do not know the long-term or short-term effects that activation of the HPA will have on recovery from myocardial infarction. However, we speculate that activation of the HPA may complicate the use of Ucn-I as a therapy against ischemic heart disease. Therefore, CRFR2 selective ligands Ucn-II or Ucn-III may be preferred over Ucn-I for the treatment of cardiac I/R.

In this study, we used neonatal and adult mouse ventricular cardiomyocytes as a model to investigate the cardioprotective effects of the CRFR2 selective peptides, Ucn-II and Ucn-III, at reperfusion. The in vitro protection studies have been extended to the ex vivo Langendorff-perfused rat heart for infarct size measurement after regional ischemia. We investigated the cell signaling pathways that mediate Ucn-II and Ucn-III cardioprotective effect, with emphasis on the ERK1/2-p42, 44 and cAMP signaling pathways. In addition, we studied the role of CRFR2 in mediating cardioprotection against I/R injury using CRFR2-null mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell reagents and antibodies
Recombinant mouse Ucn-II and Ucn-III peptides were synthesized (Jean Rivier, The Salk Institute) and used at a concentration of 10 nM unless otherwise stated. Astressin-2B (Ast-2B) is a CRFR2 selective antagonist (26) and was used at a concentration of 100 nM. The MEK1/2 inhibitor PD98059 (PD) (Cell Signaling Technology, Beverly, MA) (2, 27) was used at 5 µM. AC was inhibited by 100 µM SQ-22, 536 (SQ) (28) (Sigma, St. Louis, MO) and added to cells 30 min before peptide treatment. The specificity of SQ has been fully characterized and tested by our laboratory for its ability to inhibit Ucn-II-mediated activation of cAMP in neonatal mouse cardiomyocytes. Manumycin A (Man), a Ras inhibitor (Calbiochem, La Jolla, CA), was used at a concentration of 10 µM. A Raf-1 kinase inhibitor (R1-K1) (Calbiochem), was used 10 µM. R1-K1 and Man were added to the cells 30 min before ligand treatment. Five percent CO2, 0% O2, and balance gas N2 was obtained from Airgas West (Los Angeles, CA).

Preparation of neonatal mouse cardiomyocyte cultures
Cardiomyocytes were isolated from hearts of C57BL/6 mice as before (2) using sequential digestion in collagenase type II (Worthington Biochem Inc., Lakewood, NJ). The cardiomyocyte cell suspension was transferred to 24-well, (1-cm diameter) 2% (wt/vol) gelatin-coated plates at a density of 105 cells/well for protein extraction experiments. Cells were plated on 8-well glass chamber slides (Nalge Nunc International, Naperville, IL) for experiments involving assessment of cell death. After 24 h, cell medium was replaced with DMEM supplemented with 1% (vol/vol) fetal bovine serum for an additional 24 h before treatment. Within 2 d, a confluent monolayer of spontaneously beating myocytes was formed. cAMP assays were performed on 48-well (0.5 cm2) gelatin-coated plates with 104 cells/well. Cardiomyocytes were additionally prepared from mice that do not express a functional CRFR2 (CRFR2-/-). The CRFR2-/- mice were of a mixed C57BL/6 and 129 genetic background and were generated as previously described (9). Homozygous breeding of both male and female R2-/- mutant mice resulted in homozygous R2-/- mouse pups. Wild-type littermate controls were used to prepare the wild-type cardiomyocytes for these experiments.

Preparation of adult mouse cardiomyocyte cultures
Adult mouse ventricular cardiomyocytes were prepared as before (29) with the following changes. Three-month-old wild-type mice or CRFR2-/- mice were anticoagulated with heparin (250 U/mouse ip 5 min before anesthesia with 0.25% (wt/vol) Avertin. A 37 C heated glass perfusion system with an built-in bubble trap was constructed and connected to a pump. Hearts were excised from the mice and placed in ice-cold DMEM containing 4% (vol/vol) fetal bovine serum (FBS). The aorta was located and a plastic cannula inserted into the aorta. The aorta was tied to the cannula and hung vertically to the perfusion apparatus. Hearts were perfused at a rate of 3.5 ml/min for 1 min with prewarmed 37 C Ca2+-free Joklik’s medium. The Ca2+-free Joklik’s medium was supplemented with 10 mM HEPES, 30 mM taurine, 2 mM DL-carnitine, and 2 mM creatine (pH 7.36–7.4) (Sigma). The hearts were then perfused and digested with 0.75 mg/ml collagenase type 2 in 0.1% (wt/vol) BSA for 9–15 min (20 µM CaCl2) in supplemented Joklik’s media. The hearts were excised and digested for a further 3–6 min in the collagenase solution and washed thoroughly in 70 µm2 nylon mesh with supplemented Joklik’s medium containing 10% (w/v) BSA and 20 µM CaCl2 (wash solution). CaCl2 was added gradually until a concentration of 2 mM was reached. The cardiomyocytes were then plated in DMEM medium (Gibco BRL, Grand Island, NY) containing 4% (vol/vol) FBS at a density of 1 x 103 cells/well on 10 µg/ml prelaminated (Sigma) coated plates for 1 h (6 cm2). The media were replaced with DMEM (serum free) before experimentation.

RT-PCR conditions for detection of CRFRs and Ucn-I, Ucn-II, and Ucn-III
Total RNA was extracted from mouse neonatal cardiomyocytes (Trizol RNA isolation reagent, Molecular Research Center, Cincinnati, OH) and treated with DNase for 30 min at 37 C using the RQ1 ribonuclease L-free DNase (Promega Corp., Madison, WI). Poly A+ RNA was purified from the total RNA using the Nucleo Trap nucleic acid purification kit (Clontech, Palo Alto, CA) based on Oligo (dT)-latex beads. RT-PCR was used to amplify the levels of endogenous mRNA. Total RNA from mouse brain served as a positive control. The expression of the ribosomal S-16 (30) served as an internal control. For all the PCR reactions, cDNA equivalent to 20 ng Poly A+RNA was amplified by PCR for 35 cycles and the annealing temperatures were 67 and 60 C. The PCR reactions were conducted in 3 mM MgCl2 and 2.5 U Taq DNA polymerase (BIO-X-ACT DNA polymerase, Bioline UK Ltd., London, UK). Specific S-16 (30), Ucn-I (31), CRFR1 (32), CRFR2 (33), and oligonucleotide primers were used in the PCR reactions. For Ucn-II, the following primers were used: 5' GGCCGCCGCTGAGACTGAA 3' and 5' GGCCTGTGGACCTTAGATGGACTT 3' and a predicted size of 402 bp. For Ucn-III, the following primers were used: 5' CTGCTGCCACTTCTGCTGCTCCTA 3' and 5' CAAAAGCGACCGGGGCACC 3' and a predicted size of 342 bp.

Detection of phosphorylated ERK1/2-p42, 44 and immunoblot analysis
Cardiomyocytes were cultured in serum-free medium for 2 h at 37 C in a normoxic environment and treated with Ucn-II or Ucn-III for various time periods and concentrations. ERK1/2-p42, 44 activation was compared with the no treatment vehicle control, which was treated with vehicle for 5 min. At all time points tested (1 min or 20 min, vehicle control had no affect on ERK1/2-p42, 44 activation data not shown). Cell lysates were subjected to immunoblot analysis as before (2) and probed with phosphorylated ERK1/2-p42, 44 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and subsequently with horseradish peroxidase-conjugated mIgG (Denmark House, Cambridge, UK). Total ERK2-p44 was determined by probing the membranes with antibody directed to total ERK2-p44 protein (Santa Cruz Biotechnology). Cell signaling inhibitors were used to investigate upstream signaling of ERK1/2-p42, 44 phosphorylation by the CRFR2 ligands. Neonatal cardiomyocytes were also incubated with 10 nM Ucn-II or Ucn-III for 5 min after 6 h of simulated ischemia. To determine whether Ucn-II could activate ERK1/2-p42, 44 in normoxic adult cardiomyocytes, adult mouse cardiomyocytes were treated with Ucn-II for 1 or 5 min and the cell lysates subjected to immunoblot analysis.

Measurement of intracellular cAMP
Neonatal cardiomyocytes were isolated from both wild-type mice and CRFR2-/- mice and cultured in 48-well tissue culture dishes (Costar, Cambridge, MA) at a density of 104 cells/well. Cell medium was changed from DMEM/1% FBS to DMEM/0.1% FBS at least 2 h before treatment. The cells were preincubated for 90 min in the presence of 0.1 mM 3-isobutyl-1-methylxanthine and then exposed to doses of Ucn-II and Ucn-III ranging from 0.01 to 1 µM for 20 min at 37 C. Intracellular cAMP was extracted and measured from triplicate wells using a RIA kit (Biomedical Technologies, Stoughton, MA) as before (14). Forskolin (1 µM) was added to the cells to test their viability/ability to stimulate cAMP. Values for pmol/well cAMP were determined using Prism 3.0 software (GraphPad Inc., San Diego, CA) from three independent experiments.

Exposure of cardiomyocytes to lethal simulated hypoxia/ischemia
For lethal simulated hypoxia/ischemia, cells were incubated in the hypoxic/ischemic chamber at 37 C for 6 h in a humidified atmosphere of 5% CO2, 0% O2, balance gas N2 at a pressure of 4 lb/in.3 using Esumi ischemic buffer as before (2). Esumi ischemic buffer contains 137 mM NaCl, 12 mM KCL, 0.49 mM MgCl2, 0.9 mM CaCl.2H20, 4 mM HEPES, 10 mM deoxyglucose, and 20 mM sodium lactate (pH 6.2). Untreated cells were cultured in a normoxic environment in Esumi control buffer and is different from the ischemic buffer because it contains 3.8 mM KCL, 10 mM glucose, and no sodium lactate (pH 7.4) (2). Ucn-II or Ucn-III was added to cells after ischemia at the point of reoxygenation with and without PD or SQ for 2 h and cell death was determined. Cell death was measured using trypan blue exclusion or terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end-labeling (TUNEL) (Roche Diagnostics GMbH, Mannheim, Germany) as before (2) (Fig. 1Go). For trypan blue exclusion, the cells were harvested as described previously (2). After the addition of an equal volume of 0.4% trypan blue (Sigma) in PBS, the percentage of blue cells (dead cells)/total cells was counted by scoring 250 cells, a minimum of three times per well, using a hemocytometer. Apoptotic nuclei were assessed by the end labeling of DNA 3'-OH ends with fluorescein isothiocyanate-deoxyuridine 5-triphosphate using a modification of the TUNEL method as described previously (2). TUNEL-positive cells were then imaged by fluorescent microscopy. The percentage of apoptotic nuclei is expressed as a percentage of total nuclei from scoring 250 cells a minimum of three times per well.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 1. A, The experimental protocol for in vitro simulated I/R treatments. Cardiomyocytes were exposed to 6 h of simulated ischemia and reoxygenated with and without Ucn-II, Ucn-III, PD, SQ, PD + Ucn-II, PD + Ucn-III, SQ + Ucn-II, and SQ + Ucn-III for 2 h. B, Experimental protocol for the isolated rat heart. Stab, Stabilization; thin line, buffer perfusion; solid lines, Ucn IIrep or Ucn-IIIrep infusion during reperfusion; the inhibitor PD was administered for 30 min at reperfusion ± either Ucn IIrep or Ucn-IIIrep. The CRFR2 antagonist Ast-2B was administered for 30 min at reperfusion ± either Ucn IIrep or Ucn-IIIrep.

 
For neonatal cardiomyocytes, 6 h of simulated ischemia was used because this results in approximately 50–60% cell death. To determine whether absence of functional CRFR2 increases the susceptibility of cardiomyocytes to I/R injury, neonatal cardiomyocytes isolated from CRFR2-/- mice were exposed to 5 h simulated ischemia and reperfused for 24 h, and cell death was analyzed. Simulated ischemia for 5 h in the CRFR2-null cardiomyocytes was sufficient to cause 60–75% cell death. Six hours of simulated ischemia would result in 80–90% cell death in the CRFR2-null cells after 24 h of reoxygenation.

CRFR2-null or wild-type adult mice cardiomyocytes were exposed to 30 min of ischemia (1 h of ischemia is too lethal for CRFR2-/- cells as >90% die) and were reoxygenated for 2 h. The cells were fixed in their medium with 0.25% (vol/vol) gluteraldehyde to count all cells (floating and nonfloating) and cell survival was calculated as the percentage of cones (dead round cells) over rods (live elongated cells). To look at survival of the adult myocytes, morphology was used rather than trypan blue in the neonates because it is more accurate. Also, it is very difficult to analyze cell survival by morphology in neonatal myocytes because of their smaller size.

Modulation of CRFR2 mRNA levels after I/R
To determine whether CRFR2 mRNA levels are modulated after I/R, neonatal cardiomyocytes were exposed to no ischemia in Esumi control buffer (no treatment control) or for 2 or 4 h of ischemia followed by 24 h reoxygenation. Total RNA was subjected to RT-PCR for CRFR2 and S16 as before. For these PCR reactions, CRFR2 was amplified by PCR for 30 cycles and S16 was amplified for 32 cycles. CRFR2 and S16 levels were quantified using ImageQuant 1.2 and the amount of CRFR2 was normalized to the levels of S16.

Isolated rat heart preparation (Langendorff perfusion): Langendorff perfusion procedure
The Langendorff perfusion model was used to investigate the cardioprotective actions of Ucn-II and Ucn-III on infarct size only (2, 34). The investigation conforms to the guidelines formulated by the European Convention for the protection of vertebrate animals used for experimental purposes. Male Wistar rats (250–300 g, n = 61) were heparinized (200 IU) and anesthetized with sodium pentobarbital (50 mg/kg) ip. The hearts were studied using a Langendorff perfusion system and exposed to regional ischemia system as previously described (34), and Ucn-II (10 nM) and Ucn-III (10 nM) were given at the onset of reperfusion (Fig. 1Go). Furthermore, to explore whether ERK1/2-p42, 44 was involved in the cardioprotective effect of Ucn-II or Ucn-III, the MEK1 inhibitor PD was administered for 30 min at reperfusion with Ucn-II or Ucn-III (Ucn-IIrep ± PD or Ucn-IIIrep ± PD). To determine whether the inhibitor PD would have any effects on the ex vivo hearts, PD was administered alone (see Fig. 1BGo for experimental protocol). To examine whether the cardioprotective action of Ucn-II or Ucn-III at reperfusion was CRFR mediated, 100 nM of the CRFR2 antagonist Ast-2B was administered for 30 min at reperfusion with and without Ucn-II or Ucn-III (Ucn-IIrep ± Ast-2B or Ucn-IIIrep ± Ast-2B or Ast-2B alone). Infarct size and risk ratio were determined using Evans Blue dye and 1% (wt/vol) triphenyl-tetrazolium-chloride staining (Sigma) as described previously (34). The infarcted area (triphenyl-tetrazolium-chloride staining negative) and the risk zone (nonblue) were determined in a blinded fashion using a computerized planimetry program (Summa Sketch II, Summa Graphics, Seymour, CT).

Statistical analysis
Data for in vitro cell survival experiments are expressed as means ± SEM. Single-factor one-way ANOVA was performed for each group of treatments, and significance was assumed when P < 0.05. Differences among means were compared within the treatment groups using t test. The n value corresponds to the mean of three random fields/well of cells with a minimum of 250 cells scored per view. For infarct size data, values are presented as mean ± SEM. Infarct size results were tested for group differences by one-way ANOVA combined with Fisher’s post hoc test. Comparisons of coronary flow, heart rate, and left ventricular developed pressure between groups were performed with repeated-measures general linear model, and within-group differences were tested by the paired t test. P < 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The expression of Ucn-II and CRFR2 in mouse neonatal cardiomyocytes
To investigate the expression of Ucn-I, Ucn-II, and Ucn-III in the heart, RT-PCR was performed on total RNA isolated from mouse neonatal cardiomyocytes or brain. Using oligonucleotide primers specific to mouse Ucn-I, Ucn-II, and Ucn-III, we detected the expression of both Ucn-I and Ucn-II mRNA in these cells (Fig. 2Go) but no Ucn-III (Fig. 2Go). Ucn-III was not detected in whole mouse heart (Brar, B. K., and A. Chen, unpublished observations). CRFR2 mRNA was detected in cultures of neonatal mouse cardiomyocytes. No CRFR1 mRNA was detected (Fig. 2Go).



View larger version (68K):
[in this window]
[in a new window]
 
FIG. 2. Expression of Ucn-II, Ucn-I, and CRFR2 in cultures of neonatal mouse cardiomyocytes (CM). RT-PCR was performed on poly-(A) RNA isolated from cardiomyocytes, using oligonucleotide primers specific to mouse CRFR1 or CRFR2, Ucn-I, Ucn-II, and Ucn-III (see Materials and Methods). The RT-PCR was controlled using primers for the S16 ribosomal protein and total mouse brain RNA. The predicted sizes of the Ucn-I, CRFR1, and CRFR2 are 379, 279, and 378 bp, respectively. For S16 the predicted size is 309 bp. Ucn-I, Ucn-II, and CRFR2 mRNA were detected in mouse cardiomyocytes; however, no bands corresponding to CRFR1 or Ucn-III were observed in these cells.

 
Activation of ERK1/2-p42, 44 MAPKs by Ucn-II and Ucn-III
Treatment of neonatal cardiomyocytes with 10 nM Ucn-II or Ucn-III resulted in peak phosphorylation of ERK1/2-p42, 44 at 5 min (Fig. 3AGo). Activation of ERK1/2-p42, 44 was maximal when the cells were stimulated with 1 nM Ucn-II or Ucn-III (Fig. 3BGo). Total ERK2-p44 levels remained unchanged in these experiments.



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 3. ERK1/2-p42, 44 activation. A, Neonatal mouse cardiomyocytes were incubated with and without (NT) 10 nM Ucn-II or Ucn-III for 1, 5, and 20 min, and cell extracts were subjected to immunoblot analysis using an antibody that detects phosphorylated ERK1/2-p42, 44 and total ERK2-p44 (see Materials and Methods). B, Ucn-II and Ucn-III activate the ERK1/2-p42/44 signal cascade in cardiomyocytes. Various molar concentrations (0, 1, 10, and 100 nM) of Ucn-II or Ucn-III were incubated with cardiomyocytes for 5 min, and activity of ERK1/2-p42, 44 was analyzed by immunoblot analysis. A representative blot is shown. C, Neonatal cardiomyocytes were treated with Ucn-II and Ucn-III for 5 min at the point of reoxygenation, and cell lysates were subjected to immunoblot analysis for ERK1/2-p42, 44 phosphorylation. D, To determine whether levels of CRFR2 are modulated by I/R, neonatal cardiomyocytes were subjected to no ischemia (control, Con), 2 h ischemia/24 h deoxygenating (2 h), or 4 h ischemia/24 h reoxygenation (4 h). The levels of CRFR2 were normalized from the levels of S16 mRNA in each treatment, and the bars are representative of means of three treatments ± SEM (Fig. 3DGo). Figure 3DGo shows that the levels of CRFR2 mRNA do not significantly decrease after 2 h ischemia/24 h reoxygenation or 4 h ischemia/24 h reoxygenation. E, Adult cardiomyocytes were treated with Ucn-II for 1 and 5 min, and cell lysates were subjected to immunoblot analysis for ERK1/2-p42, 44 phosphorylation. F, Neonatal cardiomyocytes were pretreated with signaling inhibitors. PD (5 µM) was added to cells 10 min before ligand stimulation. SQ (100 µM) was added to the cells 30 min before Ucn-II or Ucn-III treatment. Man was used at a concentration of 10 µM and a Raf-1 kinase inhibitor (R1-K1) was used at a concentration of 10 µM. R1-K1 and Man were added to the cells 30 min before ligand treatment. PD, Man, and R1-K1 completely abolish Ucn-II and Ucn-III activation of ERK1/2-p42, 44. SQ had no effect on Ucn-II or Ucn-III phosphorylation of ERK1/2-p42, 44. Figures are representative of three independent experiments.

 
Neonatal cardiomyocytes were exposed to ischemia and treated with Ucn-II or Ucn-III at the point of reoxygenation for 5 min. Both peptides were able to stimulate ERK1/2-p42, 44 phosphorylation at the point of reoxygenation after ischemia. Because ERK1/2 are phosphorylated by Ucn-II or Ucn-III at the point of reoxygenation, this suggests that CRFR2 levels or activity are not modulated after ischemia (Fig. 3CGo).

To determine whether levels of CRFR2 are modulated by I/R, neonatal cardiomyocytes were subjected to no ischemia (control), 2 h of ischemia followed by 24 h reoxygenation, or 4 h of ischemia followed by 24 h of reoxygenation. The levels of CRFR2 were normalized from the levels of S16 mRNA in each treatment (Fig. 3DGo). Figure 3DGo shows that the levels of CRFR2 mRNA do not significantly decrease after 2 h of ischemia per 24 h of reoxygenation (control = 106.7 ± 9.5% vs. 2 h I/R = 97.1 ± 8.9%, P > 0.05) or 4 h of ischemia per 24 h of reoxygenation (control = 106.7 ± 9.5% vs. 88.8 ± 10.4%, P > 0.05). However, there does appear to be a trend toward a decrease in the levels of CRFR2 after I/R. Adult mouse cardiomyocytes were treated with Ucn-II and ERK1/2-p42, 44 phosphorylation was analyzed. Similar to the neonatal cells, ERK1/2-p42, 44 phosphorylation was greater at 5 min, compared with 1 min of peptide stimulation (Fig. 3EGo). In contrast to the neonatal cardiomyocytes, maximal ERK1/2-p42, 44 phosphorylation was seen at 100 nM peptide.

In mouse neonatal cardiomyocytes, Ucn-II and Ucn-III activation of ERK1/2-p42, 44 at 5 min was inhibited by PD but not by AC inhibition by SQ (Fig. 3FGo). PD by itself reduced basal levels of ERK1/2-p42, 44 in untreated cells. The Ras inhibitor, Man, and R1-K1 did abolish ERK1/2-p42, 44 phosphorylation by the peptides (Fig. 3FGo). The total levels of ERK2-p44 remained constant in these studies. Therefore, both peptides activate ERK1/2-p42, 44 by a Ras/Raf-1 kinase-dependent mechanism and elevate cAMP levels in cells expressing endogenous (Fig. 4Go) or transfected CRFR2 (14, 16). Hence, ERK1/2-p42, 44 phosphorylation is independent of cAMP stimulation in cardiomyocytes. We found no difference in the mechanism of ERK1/2-p42, 44 activation in neonatal mouse cardiomyocytes, compared with neonatal rat cardiomyocytes (our unpublished observations).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. cAMP stimulation by Ucn-II and Ucn-III in neonatal cardiomyocytes. Cardiomyocytes were exposed to doses of peptides ranging from 30 pM to 300 nM for 20 min at 37 C. Intracellular cAMP was extracted and measured from triplicate wells by RIA. The mean values and SEM were determined from three independent experiments.

 
None of the CRF/Ucn ligands activated ERK1/2-p42, 44 in cells prepared from CRFR2-/- mice, suggesting that CRFR2 is essential for ERK1/2-p42, 44 activation by these peptides (Fig. 5AGo). Additionally, cAMP levels were not increased in these cells after treatment with Ucn-II (doses ranging from 0.01 nM to 1 µM). In contrast to Ucn-II, 1 µM forskolin simulated levels of cAMP 3.2-fold levels greater than basal (P < 0.001). Consequently, CRFR2 is required for Ucn-II-mediated stimulation of cAMP and ERK1/2-p42, 44 signaling pathways in cardiomyocytes.



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 5. CRFR2-null cardiomyocytes are more susceptible to I/R-induced cell death. A, CRFR2-/- cardiomyocytes were treated with and without 10 nM CRF, Ucn-I, Ucn-II, or Ucn-III. Cell lysates were harvested and subjected to electrophoresis and immunoblot analysis (n = 2). B, Neonatal mouse cardiomyocytes prepared from wild-type (Wt) or CRFR2-null mice (R2-/-) were exposed to I/R or untreated (C). Cell survival was measured by trypan blue exclusion or TUNEL. I/R resulted in an increase in cell death from 25.6% to 82.5% in the CRFR2-/- cardiomyocytes, compared with Wt cells whereby cell death increased from 29.1% to 63.5%. Therefore, cardiomyocytes isolated from the CRFR2-/- are more susceptible to I/R, compared with Wt cells (P < 0.02). As measured by TUNEL, cardiomyocytes isolated from the CRFR2-/- were exposed to I/R, and cell death increased from 45.0% to 70.4% (P < 0.0001). An increase in I/R-induced cell death was seen in Wt cells because cell death increased from 35.5% to 47.9% (P < 0.03). Using TUNEL, the CRFR2-/- cells exhibited a significantly greater death when exposed to I/R, compared with the Wt cells (P < 0.0006). C, Adult cardiomyocytes from the CRFR2-null mice (R2-/-, n = 8) and Wt (n = 12) mice were exposed to 30 min of ischemia and reoxygenated for 2 h (I/R) or untreated (C) [Wt C (n = 12) or R2-/- C, n = 8)]. Cell death was assessed by counting the number of dead cells (cones) over live cells (rods) and expressed as a percentage. D, Illustration of cardiomyocyte morphology, rod shaped (live), cones (dead) using Pixelink-PLA544-STA kit using Axiovert 25 (Zeiss, Thornwood, NY) using three-dimensional differential interference contrast (x32 magnification). Photo is not a representation of counted area.

 
Cardiomyocytes prepared from neonatal or adult hearts from CRFR2-/- mice were exposed to I/R, and cell death was analyzed. Compared with wild-type cells, CRFR2-/- neonatal cardiomyocytes were more susceptible to I/R-induced cell death as measured by trypan blue exclusion (P < 0.02) and TUNEL (P < 0.0006) (Fig. 5BGo). Hence, disabling of CRFR2 in cardiomyocytes increased the susceptibility of these cells to I/R injury. Also, adult cardiomyocytes prepared from the CRFR2-null mice were more susceptible to I/R-induced cell death, compared with wild-type cells. The percentage of cell death in control adult wild-type cells was 27.5 ± 2.0 (n = 12) and after I/R cell death increased significantly to 37.8 ± 1.2 (n = 12) (P < 0.001) (30% increase in cell death after I/R) (Fig. 5CGo). The percentage of dead cells in the control CRFR2-null cells was 36.7 ± 3.1 (n = 8), which increased to 64.8 ± 3.1 (n = 8) after I/R (56% increase in cell death after I/R). Therefore, CRFR2-/- cells are more susceptible to I/R-induced cell death, compared with wild-type cells (P < 0.001). Figure 5DGo shows adult wild-type or CRFR2-null cardiomyocytes exposed to I/R.

In vitro cardioprotection of Ucn-II and Ucn-III
We investigated the cardioprotective actions of Ucn-II and Ucn-III to simulated I/R. No increase in the percentage of cell death was seen when the peptides were incubated with the cardiomyocytes in a normoxic environment (Table 1Go, group 1). Cells were exposed to I/R with and without Ucn-II or Ucn-III (group 2). In treatment group 3 (group 3), Ucn-II or Ucn-III was added at reperfusion with the MEK1 inhibitor PD. Ucn-II or Ucn-III was added at reperfusion with or without the AC inhibitor as shown in treatment group 4. Ucn-II and Ucn-III protected cardiomyocytes from I/R injury (group 2). For Ucn-II and Ucn-III, the cardioprotective effect at reperfusion was abolished by PD (group 3), suggesting that the cardioprotective mechanism of these peptides involves phosphorylation of ERK1/2-p42, 44. SQ failed to inhibit the cardioprotective effect of Ucn-II and Ucn-III in I/R (group 4). When the cardiomyocytes were treated with Ucn-II or Ucn-III for 15 min after ischemia, no protection of Ucn-II or Ucn-III against I/R was seen. Therefore, Ucn-II and Ucn-III protect cardiomyocytes from simulated hypoxia/ischemia and I/R injury via activation of the ERK1/2-p42, 44 signaling pathway when administered at the point of reperfusion.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Percentage of cell death in response to ischemia

 
Acute Ucn-II or Ucn-III administration at the moment of reperfusion reduces infarct size and ERK1/2-p42, 44 and CRFR2 mediate the cardioprotection in the ischemic rat heart
The in vitro studies of Ucn-II and Ucn-III were extended to the ex vivo rat model of regional I/R. In the Ucn-II- and Ucn-III-treated groups, the mean volume of myocardial tissue at risk during coronary artery occlusion ranged from 407 to 551 mm3, representing about 40–55% of total left ventricular tissue volume. There was no significant difference in the ischemic risk zone among the experimental groups. Furthermore, there was no difference in left ventricular size among groups. In this study infarct size is expressed as percentage of the area at risk. When Ucn-II or Ucn-III was given from the onset of reperfusion (Ucn-IIrep or Ucn-IIIrep), both Ucn-II and Ucn-III caused a significant reduction in infarct size, compared with vehicle-treated control hearts. The percentage of infarct size in the Ucn-IIrep hearts was 26.2 ± 5.0% (n = 6) vs. the percentage of infarct size in the control hearts, which was 44.3 ± 3.0% (n = 10), P < 0.001. When Ucn-III was administered in reperfusion, the percentage of infarct size in the Ucn-IIIrep hearts was 22.9 ± 5.2% (n = 5), and this infarct size was significantly less than the control hearts that were exposed to I/R alone (44.3 ± 3.0%, P < 0.001) (Fig. 6AGo). Furthermore, the cardioprotective effects of Ucn-II or Ucn-III was abolished by coadministration of PD [(Ucn-IIrep + PD, 47.5 ± 4.4% (n = 7), Ucn-IIIrep + PD, 40.4 ± 6.1% (n = 6)]. Administration of the PD alone at reperfusion alone had no effect on infarct size, compared with the control hearts that were exposed to I/R alone [PD 49.3 ± 1.7% (n = 6)].



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 6. The ex vivo cardioprotective effect of Ucn-II and Ucn-III is mediated by ERK1/2-p42,44 activation. A, Rat hearts were exposed to regional I/R using the Langendorff perfusion model and the infarct size is expressed as percentage of the region at risk of infarction (control). Rat hearts were treated with Ucn-II or Ucn-II at the point of reperfusion and the infarct:risk ratio (%) was calculated. To investigate the mechanism of Ucn-II and Ucn-III cardioprotection, Ucn-II or Ucn-III was coadministered with the ERK1/2-p42,44 blocker PD (5 µM) at reperfusion. Ucn-II and Ucn-III significantly reduced the infarct:risk ratio (%), compared with control (*, P < 0.05), and the cardioprotective effect of these ligands was abolished by PD. B, Cotreatment of the CRFR2 antagonist Ast-2B (100 nM) with Ucn-II or Ucn-III abrogated the reperfusion cardioprotective effect of Ucn-II and Ucn-III.

 
To determine whether the cardioprotective effects of Ucn-II or Ucn-III were mediated via CRFR2, the CRFR2 selective receptor antagonist Ast-2B (100 nM) was administered at the point of reperfusion, with and without Ucn-II or Ucn-III. Ast-2B completely abolished the cardioprotective effect of Ucn-II [Ucn-IIrep + Ast-2B, 44.0 ± 5.0% (n = 7)]. Also, Ast-2B completely abolished the cardioprotective effect of Ucn-III [Ucn-IIIrep + Ast-2B, 37.6 ± 5.0% (n = 5)]. Administration of Ast-2B alone at reperfusion had no effect on infarct size [Ast-2B, 45.0 ± 5.5% (n = 8)]. There were no significant differences in coronary flow or hemodynamic performance among any of the groups at baseline (data not shown), as expected for this heart model.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our data show that Ucn-II and Ucn-III are cardioprotective against I/R injury. Both Ucn-II and Ucn-III significantly reduce the infarct size of isolated rat hearts exposed to regional I/R. The mechanism of Ucn-II and Ucn-III cardioprotection is most likely via activation of the ERK1/2-p42, 44 signaling pathway and is CRFR2 mediated. We also show that CRFR2 is a key player in mediating cardioprotective actions in the heart. We suggest that Ucn-II and Ucn-III analogs may be used as preferential treatments over Ucn-I to treat I/R injury because of the selectivity of Ucn-II and Ucn-III toward CRFR2 in the heart.

The management of patients with acute myocardial infarction has improved dramatically with the restoration of arterial perfusion with thrombolytic and antiplatelet therapy. Attention has turned to adjunctive pharmacological treatments to enhance myocardial tolerance to I/R injury. This strategy is being pursued in an attempt to further reduce mortality in conjunction with reperfusion therapy (35). Because Ucn-II and Ucn-III protect the heart from reperfusion injury and are expressed in human heart (15, 36), they may be candidate pharmacological treatments to enhance myocardial tolerance to I/R in the clinical setting. A number of endogenous substances have been shown to protect hearts from I/R injury. These agents include adenosine (37, 38), IGF-1 (39), TGF-1 (40), and cardiotrophin-1 (CT-1) (41, 42, 43). As yet, only a few strategies to prevent myocardial I/R injury have been tested clinically. Whether Ucn-II or Ucn-III will be preferred therapy over these other agents is not known because extensive in vivo studies with Ucn-II and Ucn-III have yet to be completed, and clinical trials have not been initiated. However, Ucn-II or Ucn-III displays effects similar to those of adenosine (37), CT-1 (41), TGFß1 (40), and IGF-1 (39) in treating I/R injury because all of these compounds reduce infarct size ex vivo by approximately 50% in murine models of simulated I/R. Studies so far have shown that CT-1 (44), IGF-1 (45), TGFß1 (46), and adenosine (47) act on other cell types in addition to the heart and therefore exhibit potential side effects. In addition, CT-1 has been shown to induce cardiac hypertrophy both in vivo (44) and in vitro (48). The CT-1 mediated hypertrophy has since been shown to be consistent with that caused by volume overload and chronic volume overload hypertrophy can result in irreversible loss of cardiac function. CT-1 increases the heart weight:body weight ratio of mice (44), and the effects of CT-1 were not specific to the heart because it stimulated growth of the liver, kidney, and spleen and caused atrophy of the thymus. Whether Ucn-II or Ucn-III will have greater beneficial effects against I/R injury over these other peptides is not yet known. Also, whether these other compounds can be used in combination with Ucn-II or Ucn-III to provide further cardioprotective benefits needs to be investigated.

In this study we have shown that cardiomyocytes express Ucn-II mRNA. The expression of Ucn-I and CRFR2 has been reported previously in rat heart (6, 49, 50). The coexpression of Ucn-II and Ucn-I with CRFR2 in cardiomyocytes suggests that these ligands and receptors may have a physiological function in mouse heart and may act as a paracrine system against ischemic heart failure. We show by RT-PCR that CRFR1 is not detectable in neonatal mouse cardiomyocytes, consistent with previous findings in which CRFR1 mRNA was not found in the rat heart (50).

Ucn-I activates ERK1/2-p42, 44 in neonatal rat cardiomyocytes (2). We show Ucn-II and Ucn-III phosphorylate ERK1/2-p42, 44 in mouse neonatal cardiomyocytes in which phosphorylation was completely abolished by MEK1, Ras, and Raf-1 kinase inhibitors and not by inhibition of AC. It has been reported that activation of MAPK is independent of protein kinase A (PKA) and cAMP in Chinese hamster ovary cells expressing exogenous CRFR1{alpha} or CRFR2{alpha} (51), consistent with the activation of ERK1/2-p42, 44 by Ucn-II and Ucn-III in mouse cardiomyocytes. In contrast to cardiomyocytes, Ucn-I activation of ERK1/2-p42, 44 in primary cultures of rat hippocampal neurons is regulated by protein kinase C (PKC), PKA, and MEK1 (52), and all three enzymes appear to contribute to the cardioprotective action of Ucn-I in these cells. Inhibition of both PKC and PKA had no effect on the cardioprotective action of Ucn-I, Ucn-II, and Ucn-III in cardiomyocytes or the phosphorylation of ERK1/2-p42, 44 (Brar, B. K., unpublished observations). Therefore, the cytoprotective mechanisms of urocortins are cell type specific.

The lack of inhibition of ERK1/2-p42, 44 activation by AC inhibitors suggests that ERK1/2-p42, 44 activation by Ucn-II and Ucn-III is mediated by proteins other than G{alpha}s. The identity of the G proteins coupled to CRFR2ß in the heart is not known. It is possible that CRFR2-mediated ERK1/2-p42, 44 activation in cardiomyocytes is mediated by G{alpha}q. However, there are no cell-permeable inhibitors of G{alpha}q that can confirm this. A number of G protein-coupled receptors have been shown to interact with growth factor receptor signaling. For example, the epidermal growth factor receptor couples to the angiotensin receptor in the heart to activate MAPK and hypertrophic responses (53). Whether CRFR2ß is coupled to the epidermal growth factor receptor in heart is not known.

Our in vitro studies showed that the mechanism of Ucn-II and Ucn-III cardioprotection against reperfusion injury is via activation of ERK1/2-p42, 44, consistent with the ex vivo studies. The cardioprotective effect of Ucn-II or Ucn-III is abolished in reperfusion by the CRFR2 antagonist, Ast-2B, suggesting that the effects of Ucn-II and Ucn-III are CRFR2 mediated. Interestingly, neonatal and adult cardiomyocytes isolated from CRFR2-null mice were more susceptible to I/R-induced cell death, compared with wild-type cells. However, acute administration of Ast-2B produced no significant increase in reperfusion injury of the intact heart. The reason for this is not known. It is possible that complete loss of functional CRFR2 in the CRFR2-null mice may result in other long-term developmental/survival problems.

We do not know how MEK1 is involved in mediating the CRFR2 cardioprotective effect. However, MEK1 activation has been shown to increase the expression of cytoprotective heat shock protein-90 in cardiomyocytes within 10 min of Ucn-I administration (11). The expression of heat shock protein-90 by Ucn-II and Ucn-III in reperfusion injury is presently being investigated. Ucn-I has been shown to increase synthesis of other proteins in cardiomyocytes, in particular the mitochondrial KATP potassium channel Kir 6.1 (12). It is possible that MEK1 may increase the expression of Kir 6.1. A recent study has shown that in adult rat cardiomyocytes, the Ucn-I cardioprotective effect is mediated by PKC and ATP-sensitive potassium channels (54). Therefore, in addition to the MEK1/2 (2) and phosphatidylinositol-3 (PI-3) kinase/Akt pathway (13), PKC (54) and Kir 6.1(12) are involved in the Ucn-I-mediated cardioprotective effect. However, the pivotal role of the MEK1, ERK1/2-p42, 44 MAPK pathway has been established using in vitro (2), ex vivo (2), and in vivo models of ischemia (55). How these components interact in Ucn-I-mediated cardioprotective effect as well as their possible involvement with Ucn-II and Ucn-III cardioprotection needs to be established. We speculate that the PI-3 kinase pathway will be involved in Ucn-II- and Ucn-III-mediated cardioprotection as for Ucn-I. In mouse and rat neonatal cardiomyocytes, ERK1/2-p42, 44 activation by Ucn-I is directly regulated by PI-3 kinase (our unpublished observations). Therefore, CRFR2 activation by the Ucn ligands results in PI-3 kinase activation of the Ras, Raf-1 kinase pathway that leads to the activation of MEK and ERK1/2-p42, 44. ERK1/2-p42, 44 play the pivotal roles in the cardioprotective action of Ucn-II and III. ERK1/2-p42, 44 phosphorylation may result in activation of transcription factors and as of yet unknown cardioprotective pathways.

We cannot conclude whether Ucn-II or Ucn-III modulates the c-Jun N-terminal kinase/stress-activated protein kinase or p38 MAPK pathway in I/R. However, in normoxic conditions, ligand activation of CRFR2 does not activate p38 or c-Jun N-terminal kinase in cardiomyocytes (2) or Chinese hamster ovary cells expressing CRFR1 or CRFR2 (51). It has also been reported that inhibition of the p38 MAPK by SB203580 does not affect the ischemic cardioprotective action of Ucn-I (2). PD has also been shown to inhibit the activity of big MAPK1 pathway or ERK5 (56, 57, 58). However, we have previously demonstrated that the Ucn-I-mediated protective effect against I/R in vitro is inhibited by a genetic, dominant negative inhibitor of MEK1 (13, 41). The regulation of the ERK5 MAPK pathway is less well understood. MEK1 and MEK2 phosphorylate ERK1 and ERK2 but cannot phosphorylate and activate ERK5 directly (57). Recent biochemical studies have demonstrated a direct link between the activation of MEKK3 and subsequent activation of ERK5 via MEK5 (59, 60). Whether MEK1 is upstream of ERK5 has not been reported. Therefore, because Ucn-II and Ucn-III act on the same and only CRFR expressed in cardiomyocytes, we presume that Ucn-II and Ucn-III protect against I/R injury via activation of MEK1. However, using PD98059, we cannot rule out that the cardioprotective effects of Ucn-II and Ucn-III are through ERK5.

I/R has been shown to increase ERK1/2-p42, 44 phosphorylation in response to I/R injury (61). Although we did see an increase of ERK1/2-p42, 44 phosphorylation in I/R-treated cardiomyocytes, we show that Ucn-II and Ucn-III further increase ERK1/2-p42, 44 activation in I/R (Fig. 3Go). Also, inhibition of ERK1/2-p42, 44 activation has been shown to enhance I/R-induced apoptosis in cultured cardiomyocytes and exaggerates reperfusion injury in isolated perfused hearts (62). In that study, a dose of 50 µM PD was used, and that dose is 10 times greater than the 5 µM dose of PD used in this study. Here we show that PD had no effect on cell survival alone using both in vitro and ex vivo models of I/R. A similar nontoxic effect of PD administered in reperfusion has been demonstrated in a number of other studies (2, 39, 40).

The Langendorff perfusion model has its limitations because it is accurate at measuring infarct size only and not hemodynamics, such as the working heart model. Ucn-II and Ucn-II caused no significant hemodynamic changes, compared with control hearts exposed to regional ischemia. We are presently extending our studies to measure hemodynamic parameters in vivo. Studies in our laboratory have shown that Ucn-II and CRFR2 influence murine left ventricular function and cardiovascular hemodynamics in vivo (our unpublished observations). Like Ucn-I, it is highly likely that Ucn-II and Ucn-III will promote hemodynamic and bioenergetic recovery in isolated rat hearts exposed to I/R because all three Ucn ligands act on the same CRFR in the heart and appear to signal through the ERK1/2-p42, 44 signaling pathway (10).

In this study we show that absence of functional CRFR2 from cardiomyocytes renders these cells more susceptible to simulated I/R injury. This suggests that the CRFR2 is essential in mediating endogenous cardioprotective signals during I/R. At present, there is no reliable method of performing simulated ischemia reperfusion in vivo in mice. Once this technology has been developed, we hope to expose the CRFR2-/- mice to simulated ischemia and reperfusion for 24–36 h and analyze infarct size.

Because no adverse effects of activated HPA on I/R hearts are presented in this study, it would be interesting to activate the HPA of rats and then expose the hearts to I/R to determine whether the stress resulting from activation of the HPA axis increases the percentage of heart infarct size, compared with that in hearts of unstressed rats. We speculate that CRFR2 selective ligands, Ucn-II and Ucn-III, or future synthetic CRFR2 selective analogs may be useful in the therapy of conditions associated with I/R of heart such as myocardial infarction, heart transplantation, and cardiac by pass surgery because they do not activate CRFR1 and hence do not result in the stress response.


    Acknowledgments
 
We wish to thank Dr. Louise Bilezikjian for critical reading of the manuscript and Dave Dalton with help with figure presentation.


    Footnotes
 
B.K.B. and A.K.J. contributed equally to this work.

This work was supported by a British Heart Foundation International Fellowship (to B.B.), National Institutes of Health Grant DK 26741, The Robert J. and Helen C. Kleberg Foundation, and in part by the Foundation for Research. Work in addition was supported with grants from the Norwegian Research Council. W.V. is a senior Foundation for Research investigator.

Abbreviations: AC, Adenylate cyclase; Ast-2B, astressin-2B; CRF, corticotropin-releasing factor; CRFR, CRF receptor; CT-1, cardiotrophin-1; FBS, fetal bovine serum; HPA, hypothalamic pituitary axis; I/R, ischemic reperfusion; Man, Manumycin A; MEK 1, MAPK kinase; PD, PD98059; PI-3, phosphatidylinositol-3 (kinase); PKA, protein kinase A; PKC, protein kinase C; R1-K1, Raf-1 kinase inhibitor; SQ, SQ-22, 536; TUNEL, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end-labeling; Ucn, urocortin.

Received June 3, 2003.

Accepted for publication September 2, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gottlieb RA, Burleson KO, Kloner RA, Babior BM, Engler RL 1994 Reperfusion injury induces apoptosis in rabbit cardiomyocytes. J Clin Invest 94:1621–1628
  2. Brar BK, Jonassen AK, Railson J, Stephanou A, Santilli G, Knight RA, Yellon DM, Latchman DS 2000 Urocortin protects against ischemic and reperfusion injury via a MAP-kinase dependent pathway. J Biol Chem 275:8508–8514[Abstract/Free Full Text]
  3. Olivetti G, Abbi R, Quaini F, Kajstura J, Cheng W, Nitahara JA, Quaini E, Di Loreto C, Beltrami CA, Krajewski S, Reed JC, Anversa P 1997 Apoptosis in the failing human heart. N Engl J Med 336:1131–1141[Abstract/Free Full Text]
  4. Vale W, Spiess J, Rivier C, Rivier J 1981 Characterisation of a 41 residue ovine hypothalamic peptide that stimulates the secretion of corticotropin and ß-endorphin. Science 213:1394–1397[Free Full Text]
  5. Nemeroff CB, Owens MJ 1991 Physiology and pharmacology of corticotrophin releasing factor. Pharmacol Rev 43:425–473[Medline]
  6. Brar BK, Stephanou A, Okosi A, Lawrence KM, Knight RA, Marber MS, Latchman DS 1999 CRH-peptides protect cardiomyocytes from lethal ischaemic injury. Mol Cell Endocrinol 158:55–63[CrossRef][Medline]
  7. Nishikimi T, Miyata A, Horio T, Yoshihara F, Nagaya N, Takishita S, Yutani C, Matsuo H, Matsuoka H, Kangawa K 2000 Urocortin, a member of the corticotropin-releasing factor family, in normal and diseased heart. Am J Physiol Circ Physiol 279:H3031–H3039
  8. Parkes DG, Vaughan J, Rivier J, Vale W, May CN 1997 Cardiac inotropic actions of urocortin in conscious sheep. Am J Physiol 272:H2115–H2122
  9. Bale TA, Contarino A, Smith GW, Chan R, Gold LH, Sawchenko PE, Koob GF, Vale WW, Lee KF 2000 Mice deficient for corticotrophin-releasing hormone receptor-2 display anxiety-like behaviour and are hypertensive to stress. Nat Genet 24:410–412[CrossRef][Medline]
  10. Scarabelli TM, Pasini E, Stephanou A, Cominutei L, Curello S, Raddino R, Ferrari R, Knight R, Latchman DS 2002 Urocortin promotes hemodynamic and bioenergetic recovery and improves cell survival in the isolated rat heart exposed to ischemia/reperfusion. J Am Coll Cardiol 40:155–161[Abstract/Free Full Text]
  11. Brar BK, Railson JE, Stephanou A, Knight RA, Latchman DS 2002 Urocortin increases the expression of heat shock protein 90 in rat cardiomyocytes in a MEK1/2-dependent manner. J Endocrinol 172:283–293[Abstract]
  12. Lawrence KM, Chanalaris A, Scarabelli T, Hubank M, Pasini E, Townsend PA, Cominutei L, Ferrari R, Tinker A, Stephanou A, Knight RA, Latchman DS 2002 KATP channel gene expression is induced by urocortin and mediates its cardioprotective effect. Circulation 106:1556–1562[Abstract/Free Full Text]
  13. Brar BK, Railson JE, Stephanou A, Knight RA, Latchman DS 2002 Urocortin activates protein kinase B/Akt in cardiomyocytes and mediates cardioprotection against hypoxia/reoxygenation induced cell death. J Mol Cell Cardiol 34:483–492[CrossRef][Medline]
  14. Reyes TM, Lewis K, Perrin MH, Kunitake KS, Vaughan J, Arias CA, Hogenesch JB, Gulyas J, Rivier J, Vale WW, Sawchenko PE 2001 Urocortin II: a novel member of the corticotrophin factor (CRF) neuropeptide family that is selectively bound by type 2 CRF receptors. Proc Natl Acad Sci USA 98:2843–2848[Abstract/Free Full Text]
  15. Hsu SY, Hseueh AJ 2001 Human stresscopin and stresscopin-related peptide are selective ligands for the type 2 corticotropin-releasing hormone receptor. Nat Med 7:605–611[CrossRef][Medline]
  16. Lewis K, Li C, Perrin MH, Blount A, Kunitake K, Donaldson C, Vaughan J, Reyes T M, Gulyas J, Fischer W, Bilezikjian L, Rivier J, Sawchenko PE, Vale WW 2001 Identification of urocortin III an additional member of the corticotropin-releasing factor (CRF) family with high affinity for the CRFR2 receptor. Proc Natl Acad Sci USA 98:7570–7575[Abstract/Free Full Text]
  17. Perrin MH, Vale WW 1999 Corticotropin releasing factor receptors and their ligand family. Ann NY Acad Sci 885:312–328[Abstract/Free Full Text]
  18. Gottowik J, Goetschy V, Henriot S, Kitas E, Fluhman B, Clerc RG, Moreau JL, Monsma FJ, Kilpatrick GJ 1997 Labelling of CRF1 and CRF2 receptors using the novel radioligand [3H]-urocortin. Neuropharmacology 36:1439–1446[CrossRef][Medline]
  19. Brar BK, Perrin MH, Vale WW 2003 CRF receptor signaling. Encyclopedia of Hormones. San Diego: Academic Press 1:313–325
  20. Turnbull AV, Vaughan J, Rivier JE, Vale WW, Rivier C 1999 Urocortin is not a significant regulator of intermittent electrofootshock-induced adrenocorticotropin secretion in the intact male rat. Endocrinology 140:71–78[Abstract/Free Full Text]
  21. Traustadottir T, Bosch PR, Matt KS 2003 Gender differences in cardiovascular and hypothalamic-pituitary-adrenal axis responses to psychological stress in healthy older adult men and women. Stress 6:133–140[Medline]
  22. Koertge J, Al-Khalili F, Ahnve S, Janszky I, Svane B, Schenck-Gustafsson K 2002 Cortisol and vital exhaustion in relation to significant coronary artery stenosis in middle-aged women with acute coronary syndrome. Psychoneuroendocrinology 27:893–906[CrossRef][Medline]
  23. Lundberg U 1999 Coping with stress: neuroendocrine reactions and implications for health. Noise Health 1:67–74[Medline]
  24. Singh RB, Kartik C, Otsuka K, Pella D, Pella J 2002 Brain-heart connection and the risk of heart attack. Biomed Pharmacother 56(Suppl 2):257S–265S
  25. Whitworth JA 1992 Adrenocorticotrophin and steroid-induced hypertension in humans. Kidney Int Suppl 37:S34–S35
  26. Rivier J, Gulyas J, Kirby D, Low W, Perrin MH, Kunitake K, Digruccio M, Vaughan J, Reubi JC, Waser B, Koerber SC, Martinez V, Wang L, Tache Y, Vale W 2002 Potent and long-acting corticotropin releasing factor (CRF) receptor 2 selective peptide competitive antagonists. J Med Chem 45:4737–4747[CrossRef][Medline]
  27. Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR 1995 A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci USA 92:7686–7689[Abstract/Free Full Text]
  28. Gao Y, Usha Raj J 2002 Effects of SQ 22536, an adenylyl cyclase inhibitor, on isoproterenol-induced cyclic AMP elevation and relaxation in newborn ovine pulmonary veins. Eur J Pharmacol 436:227–233[CrossRef][Medline]
  29. Nelson DP, Setser E, Greg H, Schwartz SM, Hewitt T, Klevitsky R, Osinska H, Bellgrau D, Duke RC, Robbins J 2000 Proinflammatory consequences of transgenic Fas ligand expression in the heart. J Clin Invest 105:1199–1208[Medline]
  30. Wagner M, Perry RP 1985 Characterisation of the multigene family encoding the mouse S16 ribosomal protein: strategy for distinguishing and expressed gene from its processed pseudogene counterparts by an analysis of total genomic DNA. Mol Cell Biol 5:3560–3576[Abstract/Free Full Text]
  31. Zhou L, Donaldson CJ, Smith GW, Vale WW 1998 The structures of the mouse and human urocortin genes. Genomics 50:23–33[CrossRef][Medline]
  32. Vita N, Laurent P, Lefort S, Chalon P, Lelias JM, Kaghad M, Le Fur G, Caput D, Ferrara P 1993 Primary structure and functional expression of mouse pituitary and human brain corticotrophin releasing factor receptors. FEBS Lett 355:1–5[CrossRef]
  33. Stenzel P, Kesterson R, Yeung W, Cone RD, Rittenberg MB, Stenzel-Poore MP 1995 Identification of a novel murine receptor for corticotropin-releasing hormone expressed in the heart. Mol Endocrinol 9:637–645[Abstract]
  34. Jonassen AK, Sack MN, Mjøs OD, Yellon DM 2001 Myocardial protection by insulin at reperfusion requires early administration and is mediated via Akt and p70s6 kinase cell-survival signaling. Circ Res 89:1191–1198[Abstract/Free Full Text]
  35. Theroux P 2000 Myocardial cell protection: a challenging time for action and a challenging time for clinical research. Circulation 101:2874–2876[Free Full Text]
  36. Kimura Y, Takahashi K, Totsune K, Muramatsu Y, Kaneko C, Darnel AD, Suzuki, T, Ebina M, Nukiwa T, Sasano H 2002 Expression of urocortin and corticotropin-releasing factor receptor subtypes in the human heart. J Clin Endocrinol Metab 87:340–346[Abstract/Free Full Text]
  37. Vinten-Johansen J, Zhao ZQ, Corvera JS, Morris CD, Budde JM, Thourani VH, Guyton RA 2003 Adenosine in myocardial protection in on-pump and off-pump cardiac surgery. Ann Thorac Surg 75:S691–S699
  38. Peart JN, Gross GJ 2003 Adenosine and opioid receptor-mediated cardioprotection in the rat: evidence for cross-talk between receptors. Am J Physiol Heart Circ Physiol 285:H81–H89
  39. Yamashita K, Kajstura J, Discher DJ, Wasserlauf BJ, Bishopric NH, Anversa P, Webster KA 2001 Reperfusion-activated Akt kinase prevents apoptosis in transgenic mouse hearts overexpressing insulin-like growth factor-1. Circ Res 88:609–614[Abstract/Free Full Text]
  40. Baxter GF, Mocanu MM, Brar BK, Latchman DS, Yellon DM 2001 Cardioprotective effects of transforming growth factor-beta1 during early reoxygenation or reperfusion are mediated by p42/p44 MAPK. J Cardiovasc Pharmacol 38:930–939[CrossRef][Medline]
  41. Liao Z, Brar BK, Cai Q, Stephanou A, O’Leary RM, Pennica D, Yellon DM, Latchman DS 2002 Cardiotrophin-1 (CT-1) can protect the adult heart from injury when added both prior to ischaemia and at reperfusion. Cardiovasc Res 53:902–910[Abstract/Free Full Text]
  42. Railson JE, Liao Z, Brar BK, Buddle JC, Pennica D, Stephanou A, Latchman DS 2002 Cardiotrophin-1 and urocortin cause protection by the same pathway and hypertrophy via distinct pathways in cardiac myocytes. Cytokine 17:243–253[CrossRef][Medline]
  43. Brar BK, Stephanou A, Liao Z, O’Leary RM, Pennica D, Yellon DM, Latchman DS 2001 Cardiotrophin-1 can protect cardiac myocytes from injury when added both prior to simulated ischaemia and at reoxygenation. Cardiovasc Res 51:265–274[Abstract/Free Full Text]
  44. Jin H, Yang R, Keller GA, Ryan A, Ko A, Finkle D, Swanson TA, Li W, Pennica D, Wood WI, Paoni NF 1996 In vivo effects of cardiotrophin-1. Cytokine 8:920–926[CrossRef][Medline]
  45. Zumkeller W, Westphal M 2001 The IGF/IGFBP system in CNS malignancy. Mol Pathol 54:227–229[Abstract/Free Full Text]
  46. Fausto N, Mead JE, Gruppuso PA, Castilla A, Jakowlew SB 1991 Effects of TGF-beta s in the liver: cell proliferation and fibrogenesis. Ciba Found Symp 157:165–177[Medline]
  47. Fredholm BB, IJzerman AP, Jacobson KA, Klotz KN, Linden J 2001 International Union of Pharmacology. XXV. Nomenclature and classification of adenosine receptors. Pharmacol Rev 53:527–552[Abstract/Free Full Text]
  48. Wollert KC, Taga T, Saito M, Narazaki M, Kishimoto T, Glembotski CC, Vernallis AB, Heath JK, Pennica D, Wood WI, Chien KR 1996 Cardiotrophin-1 activates a distinct form of cardiac muscle cell hypertrophy. Assembly of sarcomeric units in series VIA gp130/leukemia inhibitory factor receptor-dependent pathways. J Biol Chem 271:9535–9545[Abstract/Free Full Text]
  49. Okosi A, Brar BK, Chan M, D’Souza L, Smith E, Stephanou A, Chowdrey HS, Latchman DS, Knight RA 1998 Expression and protective effects of urocortin in cardiomyocytes. Neuropeptides 32:167–171[CrossRef][Medline]
  50. Baigent SM, Lowry PJ 2000 mRNA expression profiles for corticotrophin-releasing factor (CRF), urocortin, CRF receptors and CRF-binding protein in peripheral rat tissues. J Mol Endocrinol 25:43–52[Abstract]
  51. Rossant CJ, Pinnock RD, Hughes J, Hall MD, McNulty S 1999 Corticotropin-releasing factor type 1 and type 2{alpha} receptors regulate phosphorylation of calcium/cyclic adenosine 3', 5'-monophosphate response element-binding protein and activation of P42/44 mitogen-activated protein kinase. Endocrinology 140:1525–1536[Abstract/Free Full Text]
  52. Pederson WA, Wan R, Zhang P, Mattson MP 2002 Urocortin but not urocortin II, protects cultured hippocampal neurons from oxidative and excitotoxic cell death via corticotrophin-releasing hormone receptor type 1. J Neurosci 22:404–412[Abstract/Free Full Text]
  53. Shah BH, Catt KJ 2003 A central role of EGF receptor transactivation in angiotensin II -induced cardiac hypertrophy. Trends Pharmacol Sci 24:239–244[Medline]
  54. Gordon JM, Dusting GJ, Woodman OL, Ritchie RH 2003 Cardioprotective action of CRF peptide urocortin against simulated ischemia in adult rat cardiomyocytes. Am J Physiol Heart Circ Physiol 284:H330–H336
  55. Schulman D, Latchman DS, Yellon DM 2002 Urocortin protects the heart from reperfusion injury via up regulation of p42/p44 signaling pathway. Am J Physiol Heart Circ Physiol 283:H1481–H1488
  56. Karihaloo A, O’Rourke DA, Nickel C, Spokes K, Cantley LG 2001 Differential MAPK pathways utilized for HGF- and EGF-dependent renal epithelial morphogenesis. J Biol Chem 2001 276:9166–9173[Abstract/Free Full Text]
  57. Squires MS, Nixon PM, Cook SJ 2002 Cell-cycle arrest by PD184352 requires inhibition of extracellular signal-regulated kinases (ERK) 1/2 but not ERK5/BMK1. Biochem J 366(Pt 2):673–680
  58. Kamakura S, Moriguchi T, Nishida E 1999 Activation of the protein kinase ERK5/BMK1 by receptor tyrosine kinases. Identification and characterization of a signaling pathway to the nucleus. J Biol Chem 274:26563–26571[Abstract/Free Full Text]
  59. Chao TH, Hayashi M, Tapping RI, Kato Y, Lee JD 1999 MEKK3 directly regulates MEK5 activity as part of the big mitogen-activated protein kinase 1 (BMK1) signaling pathway. J Biol Chem 274:36035–36038[Abstract/Free Full Text]
  60. Regan CP, Li W, Boucher DM, Spatz S, Su MS, Kuida K 2002 Erk5 null mice display multiple extraembryonic vascular and embryonic cardiovascular defects. Proc Natl Acad Sci USA 99:9248–9253[Abstract/Free Full Text]
  61. Punn A, Mockridge JW, Farooqui S, Marber MS, Heads RJ 2000 Sustained activation of p42/p44 mitogen-activated protein kinase during recovery from simulated ischaemia mediates adaptive cytoprotection in cardiomyocytes. Biochem J 350(Pt 3):891–899
  62. Yue TL, Wang C, Gu JL, Ma XL, Kumar S, Lee JC, Feuerstein GZ, Thomas H, Maleeff B, Ohlstein EH 2000 Inhibition of extracellular signal-regulated kinase enhances ischemia/reoxygenation-induced apoptosis in cultured cardiac myocytes and exaggerates reperfusion injury in isolated perfused heart. Circ Res 86:692–699[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur Heart JHome page
M. E. Davis, C. J. Pemberton, T. G. Yandle, S. F. Fisher, J. G. Lainchbury, C. M. Frampton, M. T. Rademaker, and M. Richards
Urocortin 2 infusion in human heart failure
Eur. Heart J., November 1, 2007; 28(21): 2589 - 2597.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. A. Townsend, S. M. Davidson, S. J