| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Clayton Foundation Laboratories for Peptide Biology (B.K.B., A.C., A.N., M.H.P., K.-F.L., W.V.), The Salk Institute, La Jolla, California 92037; Department of Medical Physiology (A.K.J., E.M.E., O.D.M.), Institute of Medical Biology, Faculty of Medicine, University of Tromsø, 9037 Tromsø, Norway; and Institute of Child Health (D.S.L.), University College London, London, United Kingdom WC1N 1EH
Address all correspondence and requests for reprints to: Wylie Vale, The Clayton Foundation Laboratories for Peptide Biology, The Salk Institute, La Jolla, California 92037. E-mail: vale{at}salk.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The neuropeptide corticotropin-releasing factor (CRF) is distributed throughout the brain in which it plays an important role in the behavioral and autonomic responses to stress (4, 5). Interest has emerged over the past few years in the use of the CRF-related peptide urocortin (Ucn)-I as a cardioprotective agent against ischemia (2). Ucn-I is found in rat (6) and human heart (7) and is cardioprotective when added to the intact rat heart at reperfusion after regional ischemia (2). Exogenously administered Ucn-I causes vasodilation, increases heart rate, cardiac output, and coronary blood flow and has a positive inotropic effect (8, 9). Recently Ucn-I has been shown to promote hemodynamic and bioenergetic recovery of isolated rat hearts exposed to regional ischemia (10).
Identification of the intracellular signaling pathways that control apoptosis in cardiomyocytes exposed to I/R and the process by which Ucn-I prevents apoptosis could potentially lay the foundation for novel therapeutic strategies. One mechanism by which Ucn-I is cardioprotective is by activation of the MAPK kinase (MEK1). MEK1 in turn activates MAPKs ERK1/2-p42, 44 and an increase in protein synthesis (2, 11, 12, 13).
Recently two other mammalian homologs of Ucn-I have been discovered, Ucn-II/stresscopin-related peptide (14, 15) and Ucn-III/stresscopin (15, 16). RT-PCR showed that a small amount of Ucn-III/stresscopin and a greater level of Ucn-II/stresscopin-related peptide are found in human heart (15). The actions of CRF and the urocortins are mediated through several class B seven-transmembrane domain G protein-coupled receptors. CRF receptors are all coupled to adenylate cyclase (AC) by G
s. Thus, activated receptors increase intracellular levels of cAMP. CRF receptor (CRFR) type 1 is expressed at very high levels within the brain and pituitary (17), whereas CRFR2 is the only type of CRFR found in the heart: the
-form in man (17) and the ß-form in rat/mouse (17). Compared with CRF, Ucn-I binds with 10-fold greater affinity to CRFR2ß (18) and binds to CRFR2 and CRFR1 with equal affinity (19).
A potential complication of using Ucn-I to treat I/R is that it can also activate CRFR1 and thus the hypothalamic pituitary axis (HPA). In our laboratory we have previously shown that Ucn-I administered to rats in vivo activates the HPA by increasing plasma ACTH levels (20). Elevated plasma ACTH levels can then give rise to elevated cortisol levels, which have been shown to have detrimental effects on the hearts of humans (21, 22). There are other untoward effects of HPA activation on other systems that would limit the application of Ucn-I (23). In addition, there are many studies correlating stress with coronary heart disease in humans (24). Also, since the introduction of ACTH and adrenocortical steroids into clinical practice, they have been found to raise blood pressure (25). Because Ucn-I has not been administered to patients, we do not know the long-term or short-term effects that activation of the HPA will have on recovery from myocardial infarction. However, we speculate that activation of the HPA may complicate the use of Ucn-I as a therapy against ischemic heart disease. Therefore, CRFR2 selective ligands Ucn-II or Ucn-III may be preferred over Ucn-I for the treatment of cardiac I/R.
In this study, we used neonatal and adult mouse ventricular cardiomyocytes as a model to investigate the cardioprotective effects of the CRFR2 selective peptides, Ucn-II and Ucn-III, at reperfusion. The in vitro protection studies have been extended to the ex vivo Langendorff-perfused rat heart for infarct size measurement after regional ischemia. We investigated the cell signaling pathways that mediate Ucn-II and Ucn-III cardioprotective effect, with emphasis on the ERK1/2-p42, 44 and cAMP signaling pathways. In addition, we studied the role of CRFR2 in mediating cardioprotection against I/R injury using CRFR2-null mice.
| Materials and Methods |
|---|
|
|
|---|
Preparation of neonatal mouse cardiomyocyte cultures
Cardiomyocytes were isolated from hearts of C57BL/6 mice as before (2) using sequential digestion in collagenase type II (Worthington Biochem Inc., Lakewood, NJ). The cardiomyocyte cell suspension was transferred to 24-well, (1-cm diameter) 2% (wt/vol) gelatin-coated plates at a density of 105 cells/well for protein extraction experiments. Cells were plated on 8-well glass chamber slides (Nalge Nunc International, Naperville, IL) for experiments involving assessment of cell death. After 24 h, cell medium was replaced with DMEM supplemented with 1% (vol/vol) fetal bovine serum for an additional 24 h before treatment. Within 2 d, a confluent monolayer of spontaneously beating myocytes was formed. cAMP assays were performed on 48-well (0.5 cm2) gelatin-coated plates with 104 cells/well. Cardiomyocytes were additionally prepared from mice that do not express a functional CRFR2 (CRFR2-/-). The CRFR2-/- mice were of a mixed C57BL/6 and 129 genetic background and were generated as previously described (9). Homozygous breeding of both male and female R2-/- mutant mice resulted in homozygous R2-/- mouse pups. Wild-type littermate controls were used to prepare the wild-type cardiomyocytes for these experiments.
Preparation of adult mouse cardiomyocyte cultures
Adult mouse ventricular cardiomyocytes were prepared as before (29) with the following changes. Three-month-old wild-type mice or CRFR2-/- mice were anticoagulated with heparin (250 U/mouse ip 5 min before anesthesia with 0.25% (wt/vol) Avertin. A 37 C heated glass perfusion system with an built-in bubble trap was constructed and connected to a pump. Hearts were excised from the mice and placed in ice-cold DMEM containing 4% (vol/vol) fetal bovine serum (FBS). The aorta was located and a plastic cannula inserted into the aorta. The aorta was tied to the cannula and hung vertically to the perfusion apparatus. Hearts were perfused at a rate of 3.5 ml/min for 1 min with prewarmed 37 C Ca2+-free Jokliks medium. The Ca2+-free Jokliks medium was supplemented with 10 mM HEPES, 30 mM taurine, 2 mM DL-carnitine, and 2 mM creatine (pH 7.367.4) (Sigma). The hearts were then perfused and digested with 0.75 mg/ml collagenase type 2 in 0.1% (wt/vol) BSA for 915 min (20 µM CaCl2) in supplemented Jokliks media. The hearts were excised and digested for a further 36 min in the collagenase solution and washed thoroughly in 70 µm2 nylon mesh with supplemented Jokliks medium containing 10% (w/v) BSA and 20 µM CaCl2 (wash solution). CaCl2 was added gradually until a concentration of 2 mM was reached. The cardiomyocytes were then plated in DMEM medium (Gibco BRL, Grand Island, NY) containing 4% (vol/vol) FBS at a density of 1 x 103 cells/well on 10 µg/ml prelaminated (Sigma) coated plates for 1 h (6 cm2). The media were replaced with DMEM (serum free) before experimentation.
RT-PCR conditions for detection of CRFRs and Ucn-I, Ucn-II, and Ucn-III
Total RNA was extracted from mouse neonatal cardiomyocytes (Trizol RNA isolation reagent, Molecular Research Center, Cincinnati, OH) and treated with DNase for 30 min at 37 C using the RQ1 ribonuclease L-free DNase (Promega Corp., Madison, WI). Poly A+ RNA was purified from the total RNA using the Nucleo Trap nucleic acid purification kit (Clontech, Palo Alto, CA) based on Oligo (dT)-latex beads. RT-PCR was used to amplify the levels of endogenous mRNA. Total RNA from mouse brain served as a positive control. The expression of the ribosomal S-16 (30) served as an internal control. For all the PCR reactions, cDNA equivalent to 20 ng Poly A+RNA was amplified by PCR for 35 cycles and the annealing temperatures were 67 and 60 C. The PCR reactions were conducted in 3 mM MgCl2 and 2.5 U Taq DNA polymerase (BIO-X-ACT DNA polymerase, Bioline UK Ltd., London, UK). Specific S-16 (30), Ucn-I (31), CRFR1 (32), CRFR2 (33), and oligonucleotide primers were used in the PCR reactions. For Ucn-II, the following primers were used: 5' GGCCGCCGCTGAGACTGAA 3' and 5' GGCCTGTGGACCTTAGATGGACTT 3' and a predicted size of 402 bp. For Ucn-III, the following primers were used: 5' CTGCTGCCACTTCTGCTGCTCCTA 3' and 5' CAAAAGCGACCGGGGCACC 3' and a predicted size of 342 bp.
Detection of phosphorylated ERK1/2-p42, 44 and immunoblot analysis
Cardiomyocytes were cultured in serum-free medium for 2 h at 37 C in a normoxic environment and treated with Ucn-II or Ucn-III for various time periods and concentrations. ERK1/2-p42, 44 activation was compared with the no treatment vehicle control, which was treated with vehicle for 5 min. At all time points tested (1 min or 20 min, vehicle control had no affect on ERK1/2-p42, 44 activation data not shown). Cell lysates were subjected to immunoblot analysis as before (2) and probed with phosphorylated ERK1/2-p42, 44 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and subsequently with horseradish peroxidase-conjugated mIgG (Denmark House, Cambridge, UK). Total ERK2-p44 was determined by probing the membranes with antibody directed to total ERK2-p44 protein (Santa Cruz Biotechnology). Cell signaling inhibitors were used to investigate upstream signaling of ERK1/2-p42, 44 phosphorylation by the CRFR2 ligands. Neonatal cardiomyocytes were also incubated with 10 nM Ucn-II or Ucn-III for 5 min after 6 h of simulated ischemia. To determine whether Ucn-II could activate ERK1/2-p42, 44 in normoxic adult cardiomyocytes, adult mouse cardiomyocytes were treated with Ucn-II for 1 or 5 min and the cell lysates subjected to immunoblot analysis.
Measurement of intracellular cAMP
Neonatal cardiomyocytes were isolated from both wild-type mice and CRFR2-/- mice and cultured in 48-well tissue culture dishes (Costar, Cambridge, MA) at a density of 104 cells/well. Cell medium was changed from DMEM/1% FBS to DMEM/0.1% FBS at least 2 h before treatment. The cells were preincubated for 90 min in the presence of 0.1 mM 3-isobutyl-1-methylxanthine and then exposed to doses of Ucn-II and Ucn-III ranging from 0.01 to 1 µM for 20 min at 37 C. Intracellular cAMP was extracted and measured from triplicate wells using a RIA kit (Biomedical Technologies, Stoughton, MA) as before (14). Forskolin (1 µM) was added to the cells to test their viability/ability to stimulate cAMP. Values for pmol/well cAMP were determined using Prism 3.0 software (GraphPad Inc., San Diego, CA) from three independent experiments.
Exposure of cardiomyocytes to lethal simulated hypoxia/ischemia
For lethal simulated hypoxia/ischemia, cells were incubated in the hypoxic/ischemic chamber at 37 C for 6 h in a humidified atmosphere of 5% CO2, 0% O2, balance gas N2 at a pressure of 4 lb/in.3 using Esumi ischemic buffer as before (2). Esumi ischemic buffer contains 137 mM NaCl, 12 mM KCL, 0.49 mM MgCl2, 0.9 mM CaCl.2H20, 4 mM HEPES, 10 mM deoxyglucose, and 20 mM sodium lactate (pH 6.2). Untreated cells were cultured in a normoxic environment in Esumi control buffer and is different from the ischemic buffer because it contains 3.8 mM KCL, 10 mM glucose, and no sodium lactate (pH 7.4) (2). Ucn-II or Ucn-III was added to cells after ischemia at the point of reoxygenation with and without PD or SQ for 2 h and cell death was determined. Cell death was measured using trypan blue exclusion or terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end-labeling (TUNEL) (Roche Diagnostics GMbH, Mannheim, Germany) as before (2) (Fig. 1
). For trypan blue exclusion, the cells were harvested as described previously (2). After the addition of an equal volume of 0.4% trypan blue (Sigma) in PBS, the percentage of blue cells (dead cells)/total cells was counted by scoring 250 cells, a minimum of three times per well, using a hemocytometer. Apoptotic nuclei were assessed by the end labeling of DNA 3'-OH ends with fluorescein isothiocyanate-deoxyuridine 5-triphosphate using a modification of the TUNEL method as described previously (2). TUNEL-positive cells were then imaged by fluorescent microscopy. The percentage of apoptotic nuclei is expressed as a percentage of total nuclei from scoring 250 cells a minimum of three times per well.
|
CRFR2-null or wild-type adult mice cardiomyocytes were exposed to 30 min of ischemia (1 h of ischemia is too lethal for CRFR2-/- cells as >90% die) and were reoxygenated for 2 h. The cells were fixed in their medium with 0.25% (vol/vol) gluteraldehyde to count all cells (floating and nonfloating) and cell survival was calculated as the percentage of cones (dead round cells) over rods (live elongated cells). To look at survival of the adult myocytes, morphology was used rather than trypan blue in the neonates because it is more accurate. Also, it is very difficult to analyze cell survival by morphology in neonatal myocytes because of their smaller size.
Modulation of CRFR2 mRNA levels after I/R
To determine whether CRFR2 mRNA levels are modulated after I/R, neonatal cardiomyocytes were exposed to no ischemia in Esumi control buffer (no treatment control) or for 2 or 4 h of ischemia followed by 24 h reoxygenation. Total RNA was subjected to RT-PCR for CRFR2 and S16 as before. For these PCR reactions, CRFR2 was amplified by PCR for 30 cycles and S16 was amplified for 32 cycles. CRFR2 and S16 levels were quantified using ImageQuant 1.2 and the amount of CRFR2 was normalized to the levels of S16.
Isolated rat heart preparation (Langendorff perfusion): Langendorff perfusion procedure
The Langendorff perfusion model was used to investigate the cardioprotective actions of Ucn-II and Ucn-III on infarct size only (2, 34). The investigation conforms to the guidelines formulated by the European Convention for the protection of vertebrate animals used for experimental purposes. Male Wistar rats (250300 g, n = 61) were heparinized (200 IU) and anesthetized with sodium pentobarbital (50 mg/kg) ip. The hearts were studied using a Langendorff perfusion system and exposed to regional ischemia system as previously described (34), and Ucn-II (10 nM) and Ucn-III (10 nM) were given at the onset of reperfusion (Fig. 1
). Furthermore, to explore whether ERK1/2-p42, 44 was involved in the cardioprotective effect of Ucn-II or Ucn-III, the MEK1 inhibitor PD was administered for 30 min at reperfusion with Ucn-II or Ucn-III (Ucn-IIrep ± PD or Ucn-IIIrep ± PD). To determine whether the inhibitor PD would have any effects on the ex vivo hearts, PD was administered alone (see Fig. 1B
for experimental protocol). To examine whether the cardioprotective action of Ucn-II or Ucn-III at reperfusion was CRFR mediated, 100 nM of the CRFR2 antagonist Ast-2B was administered for 30 min at reperfusion with and without Ucn-II or Ucn-III (Ucn-IIrep ± Ast-2B or Ucn-IIIrep ± Ast-2B or Ast-2B alone). Infarct size and risk ratio were determined using Evans Blue dye and 1% (wt/vol) triphenyl-tetrazolium-chloride staining (Sigma) as described previously (34). The infarcted area (triphenyl-tetrazolium-chloride staining negative) and the risk zone (nonblue) were determined in a blinded fashion using a computerized planimetry program (Summa Sketch II, Summa Graphics, Seymour, CT).
Statistical analysis
Data for in vitro cell survival experiments are expressed as means ± SEM. Single-factor one-way ANOVA was performed for each group of treatments, and significance was assumed when P < 0.05. Differences among means were compared within the treatment groups using t test. The n value corresponds to the mean of three random fields/well of cells with a minimum of 250 cells scored per view. For infarct size data, values are presented as mean ± SEM. Infarct size results were tested for group differences by one-way ANOVA combined with Fishers post hoc test. Comparisons of coronary flow, heart rate, and left ventricular developed pressure between groups were performed with repeated-measures general linear model, and within-group differences were tested by the paired t test. P < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
|
|
To determine whether levels of CRFR2 are modulated by I/R, neonatal cardiomyocytes were subjected to no ischemia (control), 2 h of ischemia followed by 24 h reoxygenation, or 4 h of ischemia followed by 24 h of reoxygenation. The levels of CRFR2 were normalized from the levels of S16 mRNA in each treatment (Fig. 3D
). Figure 3D
shows that the levels of CRFR2 mRNA do not significantly decrease after 2 h of ischemia per 24 h of reoxygenation (control = 106.7 ± 9.5% vs. 2 h I/R = 97.1 ± 8.9%, P > 0.05) or 4 h of ischemia per 24 h of reoxygenation (control = 106.7 ± 9.5% vs. 88.8 ± 10.4%, P > 0.05). However, there does appear to be a trend toward a decrease in the levels of CRFR2 after I/R. Adult mouse cardiomyocytes were treated with Ucn-II and ERK1/2-p42, 44 phosphorylation was analyzed. Similar to the neonatal cells, ERK1/2-p42, 44 phosphorylation was greater at 5 min, compared with 1 min of peptide stimulation (Fig. 3E
). In contrast to the neonatal cardiomyocytes, maximal ERK1/2-p42, 44 phosphorylation was seen at 100 nM peptide.
In mouse neonatal cardiomyocytes, Ucn-II and Ucn-III activation of ERK1/2-p42, 44 at 5 min was inhibited by PD but not by AC inhibition by SQ (Fig. 3F
). PD by itself reduced basal levels of ERK1/2-p42, 44 in untreated cells. The Ras inhibitor, Man, and R1-K1 did abolish ERK1/2-p42, 44 phosphorylation by the peptides (Fig. 3F
). The total levels of ERK2-p44 remained constant in these studies. Therefore, both peptides activate ERK1/2-p42, 44 by a Ras/Raf-1 kinase-dependent mechanism and elevate cAMP levels in cells expressing endogenous (Fig. 4
) or transfected CRFR2 (14, 16). Hence, ERK1/2-p42, 44 phosphorylation is independent of cAMP stimulation in cardiomyocytes. We found no difference in the mechanism of ERK1/2-p42, 44 activation in neonatal mouse cardiomyocytes, compared with neonatal rat cardiomyocytes (our unpublished observations).
|
|
In vitro cardioprotection of Ucn-II and Ucn-III
We investigated the cardioprotective actions of Ucn-II and Ucn-III to simulated I/R. No increase in the percentage of cell death was seen when the peptides were incubated with the cardiomyocytes in a normoxic environment (Table 1
, group 1). Cells were exposed to I/R with and without Ucn-II or Ucn-III (group 2). In treatment group 3 (group 3), Ucn-II or Ucn-III was added at reperfusion with the MEK1 inhibitor PD. Ucn-II or Ucn-III was added at reperfusion with or without the AC inhibitor as shown in treatment group 4. Ucn-II and Ucn-III protected cardiomyocytes from I/R injury (group 2). For Ucn-II and Ucn-III, the cardioprotective effect at reperfusion was abolished by PD (group 3), suggesting that the cardioprotective mechanism of these peptides involves phosphorylation of ERK1/2-p42, 44. SQ failed to inhibit the cardioprotective effect of Ucn-II and Ucn-III in I/R (group 4). When the cardiomyocytes were treated with Ucn-II or Ucn-III for 15 min after ischemia, no protection of Ucn-II or Ucn-III against I/R was seen. Therefore, Ucn-II and Ucn-III protect cardiomyocytes from simulated hypoxia/ischemia and I/R injury via activation of the ERK1/2-p42, 44 signaling pathway when administered at the point of reperfusion.
|
|
| Discussion |
|---|
|
|
|---|
The management of patients with acute myocardial infarction has improved dramatically with the restoration of arterial perfusion with thrombolytic and antiplatelet therapy. Attention has turned to adjunctive pharmacological treatments to enhance myocardial tolerance to I/R injury. This strategy is being pursued in an attempt to further reduce mortality in conjunction with reperfusion therapy (35). Because Ucn-II and Ucn-III protect the heart from reperfusion injury and are expressed in human heart (15, 36), they may be candidate pharmacological treatments to enhance myocardial tolerance to I/R in the clinical setting. A number of endogenous substances have been shown to protect hearts from I/R injury. These agents include adenosine (37, 38), IGF-1 (39), TGF-1 (40), and cardiotrophin-1 (CT-1) (41, 42, 43). As yet, only a few strategies to prevent myocardial I/R injury have been tested clinically. Whether Ucn-II or Ucn-III will be preferred therapy over these other agents is not known because extensive in vivo studies with Ucn-II and Ucn-III have yet to be completed, and clinical trials have not been initiated. However, Ucn-II or Ucn-III displays effects similar to those of adenosine (37), CT-1 (41), TGFß1 (40), and IGF-1 (39) in treating I/R injury because all of these compounds reduce infarct size ex vivo by approximately 50% in murine models of simulated I/R. Studies so far have shown that CT-1 (44), IGF-1 (45), TGFß1 (46), and adenosine (47) act on other cell types in addition to the heart and therefore exhibit potential side effects. In addition, CT-1 has been shown to induce cardiac hypertrophy both in vivo (44) and in vitro (48). The CT-1 mediated hypertrophy has since been shown to be consistent with that caused by volume overload and chronic volume overload hypertrophy can result in irreversible loss of cardiac function. CT-1 increases the heart weight:body weight ratio of mice (44), and the effects of CT-1 were not specific to the heart because it stimulated growth of the liver, kidney, and spleen and caused atrophy of the thymus. Whether Ucn-II or Ucn-III will have greater beneficial effects against I/R injury over these other peptides is not yet known. Also, whether these other compounds can be used in combination with Ucn-II or Ucn-III to provide further cardioprotective benefits needs to be investigated.
In this study we have shown that cardiomyocytes express Ucn-II mRNA. The expression of Ucn-I and CRFR2 has been reported previously in rat heart (6, 49, 50). The coexpression of Ucn-II and Ucn-I with CRFR2 in cardiomyocytes suggests that these ligands and receptors may have a physiological function in mouse heart and may act as a paracrine system against ischemic heart failure. We show by RT-PCR that CRFR1 is not detectable in neonatal mouse cardiomyocytes, consistent with previous findings in which CRFR1 mRNA was not found in the rat heart (50).
Ucn-I activates ERK1/2-p42, 44 in neonatal rat cardiomyocytes (2). We show Ucn-II and Ucn-III phosphorylate ERK1/2-p42, 44 in mouse neonatal cardiomyocytes in which phosphorylation was completely abolished by MEK1, Ras, and Raf-1 kinase inhibitors and not by inhibition of AC. It has been reported that activation of MAPK is independent of protein kinase A (PKA) and cAMP in Chinese hamster ovary cells expressing exogenous CRFR1
or CRFR2
(51), consistent with the activation of ERK1/2-p42, 44 by Ucn-II and Ucn-III in mouse cardiomyocytes. In contrast to cardiomyocytes, Ucn-I activation of ERK1/2-p42, 44 in primary cultures of rat hippocampal neurons is regulated by protein kinase C (PKC), PKA, and MEK1 (52), and all three enzymes appear to contribute to the cardioprotective action of Ucn-I in these cells. Inhibition of both PKC and PKA had no effect on the cardioprotective action of Ucn-I, Ucn-II, and Ucn-III in cardiomyocytes or the phosphorylation of ERK1/2-p42, 44 (Brar, B. K., unpublished observations). Therefore, the cytoprotective mechanisms of urocortins are cell type specific.
The lack of inhibition of ERK1/2-p42, 44 activation by AC inhibitors suggests that ERK1/2-p42, 44 activation by Ucn-II and Ucn-III is mediated by proteins other than G
s. The identity of the G proteins coupled to CRFR2ß in the heart is not known. It is possible that CRFR2-mediated ERK1/2-p42, 44 activation in cardiomyocytes is mediated by G
q. However, there are no cell-permeable inhibitors of G
q that can confirm this. A number of G protein-coupled receptors have been shown to interact with growth factor receptor signaling. For example, the epidermal growth factor receptor couples to the angiotensin receptor in the heart to activate MAPK and hypertrophic responses (53). Whether CRFR2ß is coupled to the epidermal growth factor receptor in heart is not known.
Our in vitro studies showed that the mechanism of Ucn-II and Ucn-III cardioprotection against reperfusion injury is via activation of ERK1/2-p42, 44, consistent with the ex vivo studies. The cardioprotective effect of Ucn-II or Ucn-III is abolished in reperfusion by the CRFR2 antagonist, Ast-2B, suggesting that the effects of Ucn-II and Ucn-III are CRFR2 mediated. Interestingly, neonatal and adult cardiomyocytes isolated from CRFR2-null mice were more susceptible to I/R-induced cell death, compared with wild-type cells. However, acute administration of Ast-2B produced no significant increase in reperfusion injury of the intact heart. The reason for this is not known. It is possible that complete loss of functional CRFR2 in the CRFR2-null mice may result in other long-term developmental/survival problems.
We do not know how MEK1 is involved in mediating the CRFR2 cardioprotective effect. However, MEK1 activation has been shown to increase the expression of cytoprotective heat shock protein-90 in cardiomyocytes within 10 min of Ucn-I administration (11). The expression of heat shock protein-90 by Ucn-II and Ucn-III in reperfusion injury is presently being investigated. Ucn-I has been shown to increase synthesis of other proteins in cardiomyocytes, in particular the mitochondrial KATP potassium channel Kir 6.1 (12). It is possible that MEK1 may increase the expression of Kir 6.1. A recent study has shown that in adult rat cardiomyocytes, the Ucn-I cardioprotective effect is mediated by PKC and ATP-sensitive potassium channels (54). Therefore, in addition to the MEK1/2 (2) and phosphatidylinositol-3 (PI-3) kinase/Akt pathway (13), PKC (54) and Kir 6.1(12) are involved in the Ucn-I-mediated cardioprotective effect. However, the pivotal role of the MEK1, ERK1/2-p42, 44 MAPK pathway has been established using in vitro (2), ex vivo (2), and in vivo models of ischemia (55). How these components interact in Ucn-I-mediated cardioprotective effect as well as their possible involvement with Ucn-II and Ucn-III cardioprotection needs to be established. We speculate that the PI-3 kinase pathway will be involved in Ucn-II- and Ucn-III-mediated cardioprotection as for Ucn-I. In mouse and rat neonatal cardiomyocytes, ERK1/2-p42, 44 activation by Ucn-I is directly regulated by PI-3 kinase (our unpublished observations). Therefore, CRFR2 activation by the Ucn ligands results in PI-3 kinase activation of the Ras, Raf-1 kinase pathway that leads to the activation of MEK and ERK1/2-p42, 44. ERK1/2-p42, 44 play the pivotal roles in the cardioprotective action of Ucn-II and III. ERK1/2-p42, 44 phosphorylation may result in activation of transcription factors and as of yet unknown cardioprotective pathways.
We cannot conclude whether Ucn-II or Ucn-III modulates the c-Jun N-terminal kinase/stress-activated protein kinase or p38 MAPK pathway in I/R. However, in normoxic conditions, ligand activation of CRFR2 does not activate p38 or c-Jun N-terminal kinase in cardiomyocytes (2) or Chinese hamster ovary cells expressing CRFR1 or CRFR2 (51). It has also been reported that inhibition of the p38 MAPK by SB203580 does not affect the ischemic cardioprotective action of Ucn-I (2). PD has also been shown to inhibit the activity of big MAPK1 pathway or ERK5 (56, 57, 58). However, we have previously demonstrated that the Ucn-I-mediated protective effect against I/R in vitro is inhibited by a genetic, dominant negative inhibitor of MEK1 (13, 41). The regulation of the ERK5 MAPK pathway is less well understood. MEK1 and MEK2 phosphorylate ERK1 and ERK2 but cannot phosphorylate and activate ERK5 directly (57). Recent biochemical studies have demonstrated a direct link between the activation of MEKK3 and subsequent activation of ERK5 via MEK5 (59, 60). Whether MEK1 is upstream of ERK5 has not been reported. Therefore, because Ucn-II and Ucn-III act on the same and only CRFR expressed in cardiomyocytes, we presume that Ucn-II and Ucn-III protect against I/R injury via activation of MEK1. However, using PD98059, we cannot rule out that the cardioprotective effects of Ucn-II and Ucn-III are through ERK5.
I/R has been shown to increase ERK1/2-p42, 44 phosphorylation in response to I/R injury (61). Although we did see an increase of ERK1/2-p42, 44 phosphorylation in I/R-treated cardiomyocytes, we show that Ucn-II and Ucn-III further increase ERK1/2-p42, 44 activation in I/R (Fig. 3
). Also, inhibition of ERK1/2-p42, 44 activation has been shown to enhance I/R-induced apoptosis in cultured cardiomyocytes and exaggerates reperfusion injury in isolated perfused hearts (62). In that study, a dose of 50 µM PD was used, and that dose is 10 times greater than the 5 µM dose of PD used in this study. Here we show that PD had no effect on cell survival alone using both in vitro and ex vivo models of I/R. A similar nontoxic effect of PD administered in reperfusion has been demonstrated in a number of other studies (2, 39, 40).
The Langendorff perfusion model has its limitations because it is accurate at measuring infarct size only and not hemodynamics, such as the working heart model. Ucn-II and Ucn-II caused no significant hemodynamic changes, compared with control hearts exposed to regional ischemia. We are presently extending our studies to measure hemodynamic parameters in vivo. Studies in our laboratory have shown that Ucn-II and CRFR2 influence murine left ventricular function and cardiovascular hemodynamics in vivo (our unpublished observations). Like Ucn-I, it is highly likely that Ucn-II and Ucn-III will promote hemodynamic and bioenergetic recovery in isolated rat hearts exposed to I/R because all three Ucn ligands act on the same CRFR in the heart and appear to signal through the ERK1/2-p42, 44 signaling pathway (10).
In this study we show that absence of functional CRFR2 from cardiomyocytes renders these cells more susceptible to simulated I/R injury. This suggests that the CRFR2 is essential in mediating endogenous cardioprotective signals during I/R. At present, there is no reliable method of performing simulated ischemia reperfusion in vivo in mice. Once this technology has been developed, we hope to expose the CRFR2-/- mice to simulated ischemia and reperfusion for 2436 h and analyze infarct size.
Because no adverse effects of activated HPA on I/R hearts are presented in this study, it would be interesting to activate the HPA of rats and then expose the hearts to I/R to determine whether the stress resulting from activation of the HPA axis increases the percentage of heart infarct size, compared with that in hearts of unstressed rats. We speculate that CRFR2 selective ligands, Ucn-II and Ucn-III, or future synthetic CRFR2 selective analogs may be useful in the therapy of conditions associated with I/R of heart such as myocardial infarction, heart transplantation, and cardiac by pass surgery because they do not activate CRFR1 and hence do not result in the stress response.
| Acknowledgments |
|---|
| Footnotes |
|---|
This work was supported by a British Heart Foundation International Fellowship (to B.B.), National Institutes of Health Grant DK 26741, The Robert J. and Helen C. Kleberg Foundation, and in part by the Foundation for Research. Work in addition was supported with grants from the Norwegian Research Council. W.V. is a senior Foundation for Research investigator.
Abbreviations: AC, Adenylate cyclase; Ast-2B, astressin-2B; CRF, corticotropin-releasing factor; CRFR, CRF receptor; CT-1, cardiotrophin-1; FBS, fetal bovine serum; HPA, hypothalamic pituitary axis; I/R, ischemic reperfusion; Man, Manumycin A; MEK 1, MAPK kinase; PD, PD98059; PI-3, phosphatidylinositol-3 (kinase); PKA, protein kinase A; PKC, protein kinase C; R1-K1, Raf-1 kinase inhibitor; SQ, SQ-22, 536; TUNEL, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end-labeling; Ucn, urocortin.
Received June 3, 2003.
Accepted for publication September 2, 2003.
| References |
|---|
|
|
|---|
receptors regulate phosphorylation of calcium/cyclic adenosine 3', 5'-monophosphate response element-binding protein and activation of P42/44 mitogen-activated protein kinase. Endocrinology 140:15251536This article has been cited by other articles:
![]() |
D. J. Hausenloy and D. M. Yellon Cardioprotective growth factors Cardiovasc Res, July 15, 2009; 83(2): 179 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sztainberg, Y. Kuperman, O. Issler, S. Gil, J. Vaughan, J. Rivier, W. Vale, and A. Chen A novel corticotropin-releasing factor receptor splice variant exhibits dominant negative activity: a putative link to stress-induced heart disease FASEB J, July 1, 2009; 23(7): 2186 - 2196. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ikeda, K. Tojo, Y. Inada, Y. Takada, M. Sakamoto, M. Lam, W. C Claycomb, and N. Tajima Regulation of urocortin I and its related peptide urocortin II by inflammatory and oxidative stresses in HL-1 cardiomyocytes J. Mol. Endocrinol., June 1, 2009; 42(6): 479 - 489. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Huang, D. Kempuraj, N. Papadopoulou, T. Kourelis, J. Donelan, A. Manola, and T. C Theoharides Urocortin induces interleukin-6 release from rat cardiomyocytes through p38 MAP kinase, ERK and NF-{kappa}B activation J. Mol. Endocrinol., May 1, 2009; 42(5): 397 - 405. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Angelone, A. M. Quintieri, B. K. Brar, P. T. Limchaiyawat, B. Tota, S. K. Mahata, and M. C. Cerra The Antihypertensive Chromogranin A Peptide Catestatin Acts as a Novel Endocrine/Paracrine Modulator of Cardiac Inotropism and Lusitropism Endocrinology, October 1, 2008; 149(10): 4780 - 4793. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mazza, A. Gattuso, C. Mannarino, B. K. Brar, S. F. Barbieri, B. Tota, and S. K. Mahata Catestatin (chromogranin A344-364) is a novel cardiosuppressive agent: inhibition of isoproterenol and endothelin signaling in the frog heart Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H113 - H122. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Davis, C. J. Pemberton, T. G. Yandle, S. F. Fisher, J. G. Lainchbury, C. M. Frampton, M. T. Rademaker, and M. Richards Urocortin 2 infusion in human heart failure Eur. Heart J., November 1, 2007; 28(21): 2589 - 2597. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Townsend, S. M. Davidson, S. J. Clarke, I. Khaliulin, C. J. Carroll, T. M. Scarabelli, R. A. Knight, A. Stephanou, D. S. Latchman, and A. P. Halestrap Urocortin prevents mitochondrial permeability transition in response to reperfusion injury indirectly by reducing oxidative stress Am J Physiol Heart Circ Physiol, August 1, 2007; 293(2): H928 - H938. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Wu, P.-q. Yuan, L. Wang, Y. L. Peng, C.-Y. Chen, and Y. Tache Identification and Characterization of Multiple Corticotropin-Releasing Factor Type 2 Receptor Isoforms in the Rat Esophagus Endocrinology, April 1, 2007; 148(4): 1675 - 1687. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Davis, C. J. Pemberton, T. G. Yandle, S. F. Fisher, J. G. Lainchbury, C. M. Frampton, M. T. Rademaker, and A. M. Richards Urocortin 2 Infusion in Healthy Humans: Hemodynamic, Neurohormonal, and Renal Responses J. Am. Coll. Cardiol., January 30, 2007; 49(4): 461 - 471. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Negro, B. K. Brar, Y. Gu, K. L. Peterson, W. Vale, and K.-F. Lee erbB2 is required for G protein-coupled receptor signaling in the heart PNAS, October 24, 2006; 103(43): 15889 - 15893. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. W. Hillhouse and D. K. Grammatopoulos The Molecular Mechanisms Underlying the Regulation of the Biological Activity of Corticotropin-Releasing Hormone Receptors: Implications for Physiology and Pathophysiology Endocr. Rev., May 1, 2006; 27(3): 260 - 286. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Solinas, S. Summermatter, D. Mainieri, M. Gubler, J. P. Montani, J. Seydoux, S. R. Smith, and A. G. Dulloo Corticotropin-Releasing Hormone Directly Stimulates Thermogenesis in Skeletal Muscle Possibly through Substrate Cycling between de Novo Lipogenesis and Lipid Oxidation Endocrinology, January 1, 2006; 147(1): 31 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Rademaker, C. J. Charles, E. A. Espiner, C. M. Frampton, J. G. Lainchbury, and A. M. Richards Endogenous urocortins reduce vascular tone and renin-aldosterone/endothelin activity in experimental heart failure Eur. Heart J., October 1, 2005; 26(19): 2046 - 2054. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chen, M. Perrin, B. Brar, C. Li, P. Jamieson, M. DiGruccio, K. Lewis, and W. Vale Mouse Corticotropin-Releasing Factor Receptor Type 2{alpha} Gene: Isolation, Distribution, Pharmacological Characterization and Regulation by Stress and Glucocorticoids Mol. Endocrinol., February 1, 2005; 19(2): 441 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Guillemin Hypothalamic hormones a.k.a. hypothalamic releasing factors J. Endocrinol., January 1, 2005; 184(1): 11 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takahashi, K. Totsune, O. Murakami, M. Saruta, M. Nakabayashi, T. Suzuki, H. Sasano, and S. Shibahara Expression of Urocortin III/Stresscopin in Human Heart and Kidney J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1897 - 1903. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Woodcock Unc-II and Unc-III Are Cardioprotective against Ischemia Reperfusion Injury: An Essential Endogenous Cardioprotective Role for CRFR2 in the Murine Heart Endocrinology, January 1, 2004; 145(1): 21 - 23. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |