| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Geriatrics, Reynolds Center on Aging (S.O.R., B.L.-C.), Department of Orthopaedic Surgery, Center for Orthopaedic Research (L.J.S., D.G., D.C.M.), and Department of Physiology and Biophysics (L.J.S., D.G, D.C.M.), University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205
Address all correspondence and requests for reprints to: Beata Lecka-Czernik, Department of Geriatrics, Reynolds Center on Aging, University of Arkansas for Medical Sciences, 629 South Elm Street, Little Rock, Arkansas 72205. E-mail: BLecka-Czernik{at}uams.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
(PPAR-). In addition to sensitizing cells to insulin, the PPAR-2 isoform appears to be critical for the regulation of osteoblast and adipocyte differentiation from common mesenchymal bone marrow progenitors. We have demonstrated previously that PPAR-2 activated with rosiglitazone acts as a dominant inhibitor of osteoblastogenesis in murine bone marrow in vitro. Here, we show that in vivo, rosiglitazone administration results in significant bone loss. When rosiglitazone (20 µg/g body weight/d) was given to 6-month-old, nondiabetic C57BL/6 mice for 7 wk, a significant decrease in total body bone mineral density was observed. Analysis of bone microarchitecture, using micro-computed tomography, demonstrated a decrease in bone volume, trabecular width, and trabecular number and an increase in trabecular spacing. Histomorphometric analysis showed a decrease in bone formation rate, with a simultaneous increase in fat content in the bone marrow. Changes in bone morphology and structure were accompanied by changes in the expression of osteoblast- and adipocyte- specific marker genes; the expression of the osteoblast-specific genes Runx2/Cbfa1, Dlx5, and 
1(I)collagen were decreased, whereas the expression of the adipocyte-specific fatty acid binding protein aP2, was increased. These in vivo data suggest that rosiglitazone therapy may pose a significant risk of adverse skeletal effects in humans. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
Rosiglitazone is a high-affinity ligand and activator of the peroxisome proliferator-activated receptor- (PPAR-), and most of its effects are mediated via this transcription factor (8, 9, 10). PPAR- is a member of the nuclear receptor superfamily of transcription factors, a large and diverse group of proteins that mediate ligand-dependent transcriptional activation and repression (10). PPAR- exists in two isoforms, PPAR-1 and PPAR-2, as a result of alternative promoter usage and alternative splicing (11). The PPAR-1 isoform is expressed in many cell types, including adipocytes, osteoblasts, muscle cells, and macrophages, whereas PPAR-2 expression is restricted primarily to adipose cells and is absolutely necessary for fat development in mice (12).
Osteoblasts, or bone-forming cells, share a common mesenchymal precursor in the bone marrow with adipocytes (13, 14). Osteoblast development is controlled by several phenotype-specific transcription factors, among them Runx2/Cbfa1 and Dlx5, whereas formation of terminally differentiated adipocytes in murine marrow requires the activity of PPAR-2 (15, 16, 17, 18, 19). We demonstrated previously that in the presence of PPAR-2, rosiglitazone converts cells of the osteoblast lineage to terminally differentiated adipocytes and simultaneously and irreversibly suppresses the osteoblast phenotype (17, 18). PPAR-2 inhibited the ability of osteoblasts to mineralize the extracellular matrix, a hallmark of their activity, and suppressed the expression of Runx2/Cbfa1 and other osteoblast-specific genes such as 1(I)collagen, osteopontin, alkaline phosphatase, and osteocalcin (17).
To date, there are limited reports of the effects of glitazone administration on human bone. An analysis of the data from the Health, Aging, and Body Composition cohort studies revealed that intake of glitazones (rosiglitazone or pioglitazone) for longer than 24 months by older (age 70–79 yr) diabetic patients decreased bone mineral density (BMD) in the femoral neck and hip (20). Although analysis was performed on only a small group of patients, these results suggest a strong correlation between decreases in BMD, glitazones, and the duration of therapy.
The potential for the broad clinical application of the glitazones for treatment of a variety of pathologies demands detailed analysis of the possible effects of these compounds on target organs that are known to express PPAR-. Given that PPAR- is expressed in bone, particularly in mesenchymal stem cells, together with our in vitro evidence that rosiglitazone-activated PPAR-2 functions as a dominant negative regulator of osteoblast differentiation (17), we tested the effect of in vivo administration of rosiglitazone on murine bone.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
Animals (n = 8 per group) were fed 5 g of food per day with pelleted chow (F05072, Bio-Serv, Frenchtown, NJ) supplemented with rosiglitazone maleate (Avandia, GlaxoSmithKline, King of Prussia, PA) at the concentration of 0.14 mg/g of chow. The control group was fed the same amount of nonsupplemented chow. Animals were fed every other day for 7 wk, and food intake per cage and body weights of individual animals were monitored. At the end of the experiment the average intake of rosiglitazone per gram body weight per cage was calculated and resulted in the dose of 20 µg/g·d. To measure bone formation rates, mice were injected ip with 30 µg/g body weight of tetracycline 7 and 2 d before they were killed.
Blood collection and plasma glucose measurements
Plasma glucose levels were determined for each animal at the beginning and end of the experiment. Animals were fasted for 18 h before blood (from the tail vein) was collected. Plasma glucose levels were determined based on the enzymatic reaction of ß-D-glucose with oxygen using Beckman glucose analyzer 2 (Beckman Coulter Inc., Fullerton, CA).
Liver histology
Livers were collected immediately after the mice were killed, snap-frozen, and sectioned. Sectioned livers of representative animals were fixed with formalin (37%), stained with Oil Red O for fat, and counterstained with methyl green, as described (18).
BMD measurements
BMD was determined using the small-animal dual-energy x-ray absorptiometry (DXA) instrument Piximus (GE Lunar, Madison, WI) and software version 1.46 (21, 22). Mice were anesthetized and scanned before the onset of rosiglitazone treatment, at 4 wk and after killing at 7 wk. Total body BMD (g/cm2), excluding the head region, was obtained from each scan. The percent change in BMD was determined by inserting the values collected for each time point into the calculation: [(Vposttreatment - Vpretreatment)/Vposttreatment] x 100. Internal variations of repeated measures of total murine body BMD have been determined to be 1.7–2.0%.
Micro-computed tomography (micro-CT) analysis
After mice were killed, the right tibia of each animal was dissected and fixed in 4 C Millonig’s phosphate-buffered 10% formalin, pH 7.4. After 24 h, the tibia was dehydrated successively in 70%, 95%, and 100% ethanol and then measured without further sample preparation in a micro-CT 40 (Scanco Medical, Bassersdorf, Switzerland). Micro-CT scans were performed on 256 successively measured slices (12 µm each) to total 3.07 mm of the proximal metaphysis. The three-dimensional information was obtained by stacking the measured slices on top of each other. The volume of interest for subsequent morphometric analysis in three dimensions was the entire secondary spongiosa after extracting automatically the surrounding cortical bone (length of 3.07 mm of the radial axis) and avoiding inclusion of boundaries of the volume of interest (23, 24). The complete secondary spongiosa of the proximal tibia was evaluated to avoid sampling errors incurred by random deviations within a single section. Careful contouring of this region in the secondary spongiosa yields volumetric information of bone volume (BV), total volume (TV), and calculated ratio of BV/TV, as well as trabecular thickness (TbTh), trabecular number (TbN), and trabecular spacing (TbSp).
Estimation of the plate-rod characteristics of the specimen was achieved using the structure model index (SMI). For an ideal plate and rod structure, the SMI values are 0 and 3, respectively. For a mixed structure, the values are between 0 and 3, depending on the volume ratio between rods and plates. The geometrical degree of anisotropy (DA) is defined as the ratio between the maximal and the minimal radius of the mean intercept length ellipsoid. The connectivity density (ConnD) is calculated using the Euler method. The computation of both DA and ConnD are described in detail elsewhere (23).
Bone histomorphometry
After micro-CT analysis, undecalcified tibiae were embedded in methyl methacrylate, sectioned on an automatic, retractable Microtom 355 with a D-profile, tungsten carbide steel knife at 4 µm. Adjacent sections were stained with Masson trichrome, Goldner trichrome, and Von Kossa, and one was left unstained for tetracycline labeling evaluation (25, 26). The histomorphometric examination was performed using an OsteoMeasure system, which includes a Nikon microscope with motorized stage, interfaced with a computer and digitizer tablet (OsteoMetrics Inc., Atlanta, GA). All cancellous measurements were two-dimensional, confined to the secondary spongiosa, and made using a x40 objective (numerical aperture 0.75). The terminology and units used were those recommended by the Histomorphometry Nomenclature Committee of the American Society for Bone and Mineral Research (27). Static measurements and dynamic lengths of single- and double-labeled bone surfaces were obtained as described previously (25, 26). Static measurements were performed on six representative fields per bone sample and included fat volume [fat volume per total volume (BV/TV, percent)] and adipocyte number per high-power field. Histodynamic parameters of mineralized surface per bone surface (MS/BS), mineral apposition rate (MAR), and bone formation rate per bone surface (BFR/BS) were measured on the same specimens as above, using six representative fields per bone sample, in epifluorescent light.
RNA isolation and quantitative real-time RT-PCR analysis
Total RNA was isolated from the left tibia of each animal, and gene expression in each bone was analyzed using quantitative real-time RT-PCR (28). Immediately after an animal was killed, the tibia bone was cleaned of any remaining soft tissue, cut into pieces, and homogenized in the presence of TRIzol reagent followed by RNA isolation as described by the manufacturer (Invitrogen, Carlsbad, CA). The gene-specific primer sequences were selected using the TaqMan probe and primer design function of the Primer Express version 1.5 software (Applied Biosystems, Forest City, CA). RT reactions were carried out using 2 µg RNA, subjected previously to DNase digestion, and a TaqMan reverse transcription reagents (Applied Biosystems), followed by PCR in real time using a SYBR Green PCR master mix (Applied Biosystems) and an ABI Prism 7700 sequence detection system (Applied Biosystems). The reactions were performed in the following cycling conditions: 95 C for 10 min and then 40 cycles of 95 C for 15 sec followed by 60 C for 1 min. The optimal concentrations of primers and templates that were used in each reaction were established based on the standard curve created before the reaction and corresponded to the nearly 100% efficiency of the reaction. The results were then normalized to the expression of 18 S rRNA in the same samples. Gene expression was analyzed using the following pairs of primers: aP2 (forward, GCGTGGAATTCGATGAAATCA; reverse, CCCGCCATCTAGGG), Runx2/Cbfa1 (forward, GGGCACAAGTTCTATCTGGAAAA; reverse, CGGTGTCACTGCGCTGAA), Dlx5 (forward, TGACAGGCGTGTTTGACAGAAGAG; reverse, CGGGAACGGAGCTTGGA), osteocalcin (forward, CGGCCCTGAGTCTGACAAA; reverse, GCCGGAGTCTGTTCACTACCTT), 1(I)collagen (forward, ACTGTCCCAACCCCCAAAG; reverse, CGTATTCTTCCGGGCAGAAA), and 18 S rRNA (forward, TTCGAACGTCTGCCCTATCAA; reverse, ATGGTAGGCACGGCGACTA).
Statistical analysis
Statistically significant differences between groups were detected using one-way ANOVA followed by post hoc analysis by Student-Neuman-Keuls within the SigmaStat software (SPSS, Inc., Chicago, IL) after establishing the homogeneity of variances and normal distribution of the data. In all cases, P < 0.05 was considered significant.
|
Results and Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
).
|
). Furthermore, histological examination revealed that rosiglitazone administration significantly increased fat liver content compared with the control animals (Fig. 2). Liver steatosis in response to rosiglitazone intake was previously observed in lipoatrophic, A-ZIP/F-1, and obese diabetic, KK-Ay and ob/ob, mice but not in nondiabetic, lean animals (30, 31, 32, 33). C57BL/6 mice are considered a diabetic-prone strain (34, 35); therefore it is possible that their genetic background predisposed them to develop liver steatosis in response to rosiglitazone treatment.
|
). The weight of epididymal WAT was decreased by 30%, whereas the weight of interscapular BAT was increased by 25% in the rosiglitazone-fed group. A stimulatory effect of rosiglitazone on BAT, an adipose tissue involved in rapid energy dissipation and thermogenesis, and a suppressive effect on WAT, a tissue that is responsible for energy storage, indicates that rosiglitazone effects fatty acid metabolism. These data are consistent with previous reports of glitazone effects on murine adipose tissues (36) and demonstrate the efficacy of our treatment schedule and dose.
DXA analysis of total BMD demonstrated a significant decrease in the BMD of animals fed for 7 wk rosiglitazone-supplemented diet compared with the control mice (0.0462 ± 0.0001 vs. 0.0493 ± 0.0016 g/cm2; P < 0.001) (Fig. 3A). No differences in BMD were observed at 4 wk (data not shown). Longitudinal measurements of the same animals, at the beginning and end of the experiment, demonstrated almost a 10% decrease in BMD of rosiglitazone-fed animals (P < 0.001) (Fig. 3B).
|
and Table 1). Bone content, as measured by the ratio BV/TV, was decreased by 24.1%. This dramatic decrease was accompanied by significant decreases in TbN (-11.2%) and TbTh (-10.6%) and an increase in TbSp (17.4%).
|
|
2 transcription factor (17). Therefore, we reasoned that in vivo, bone loss that occurred in response to rosiglitazone administration was due to its action on the osteoblast progenitors that express PPAR-2. Thus, activation of PPAR-2 should result in the inhibition of osteoblast differentiation and stimulation of adipocyte differentiation in the bone of treated animals.
Indeed, histomorphometric analysis of the trabecular bone of proximal tibia revealed that rosiglitazone administration increased both fat content and the number of adipocytes by 3-fold (Fig. 5A). This was accompanied by a decrease in the osteoblast surface and/or their activity. The MS/BS (control, 18%; rosiglitazone, 6%) and MAR decreased 3-fold (Fig. 5B), and the rate of BFR/BS decreased by approximately 10-fold (control, 0.7 µm3/µm2·d; rosiglitazone, 0.06 µm3/µm2·d).
|
1(I)collagen. In contrast, the abundance of mRNA for the adipocyte-specific marker, fatty acids binding protein aP2, was increased (Table 2).
|
2. The observed decrease in bone formation and osteoblast number correlates with increased fat content and increased adipocyte number. These data support the hypothesis that an inverse relationship exists between osteoblast and adipocyte differentiation from a common mesenchymal progenitor (13, 14, 37, 39). Thus, stimulation of adipocyte formation by rosiglitazone appears to occur at the expense of osteoblast formation.
When considered in light of the recent studies by Tornvig et al. (40) using troglitazone and our previous in vitro observation (18), the studies presented here suggest that PPAR- agonists differentially regulate the reciprocal relationship between osteoblastic and adipocytic cell differentiation in the bone marrow. Further evaluation of the efficacy and potency of selective PPAR- modulators are required to address these important observations.
In conclusion, our results indicate that murine bone marrow is a target for rosiglitazone, an antidiabetic drug and activator of the PPAR-2 adipocyte-specific transcription factor. Furthermore, these results suggest that longitudinal rosiglitazone therapy may pose a significant risk to human bone, and provides the rationale for the development of new, selective and effective antidiabetic PPAR- agonists with little or no adverse effects on bone.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: BAT, Brown adipose tissue; BFR/BS, bone formation rate per bone surface; BMD, bone mineral density; BS, bone surface; BV, bone volume; ConnD, connectivity density; CT, computed tomography; DA, degree of anisotropy; DXA, dual-energy x-ray absorptiometry; FV/TV, fat volume per total volume; MAR, mineral apposition rate; MS, mineral surface; PPAR-, peroxisome proliferator-activated receptor-; SMI, structure model index; TbN, trabecular number; TbSp, trabecular spacing; TbTh, trabecular thickness; WAT, white adipose tissue.
Received June 13, 2003.
Accepted for publication September 10, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
ligands inhibit development of atherosclerosis in LDL receptor-deficient mice. J Clin Invest 106:523–531[Medline]
ligands: taking part in chemoprevention. Gastroenterology 124:564–567[CrossRef][Medline]
agonists in Alzheimer’s disease. Neurobiol Aging 22:937–944[CrossRef][Medline]
(PPAR-). J Biol Chem 270:12953–12956: a nuclear regulator of metabolism, differentiation, and cell growth. J Biol Chem 276:37731–37734 (mPPAR-) gene: alternative promoter use and different splicing yield two mPPAR- isoforms. Proc Natl Acad Sci USA 92:7921–7925 knockdown by engineered transcription factors: exogenous PPAR2 but not PPAR1 reactivates adipogenesis. Genes Dev 16:27–322. J Cell Biochem 74:357–371[CrossRef][Medline]
2 ligands on adipocyte versus osteoblast differentiation. Endocrinology 143:2376–2384 activation by thiazolidinediones induces adipogenesis in bone marrow stromal cells. Mol Pharmacol 50:1087–1094[Abstract]
-activating properties. J Biol Chem 273:32679–32684 in leptin-deficient mice improves fatty liver but aggravates diabetic phenotypes. J Clin Invest 111:737–747[CrossRef][Medline]
1 (PPAR1) overexpression. J Biol Chem 278:498–5051 gene expression and develop hepatic steatosis upon chronic treatment with antidiabetic thiazolidinediones. J Hepatol 35:17–23[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  M. Almeida, E. Ambrogini, L. Han, S. C. Manolagas, and R. L. Jilka Increased Lipid Oxidation Causes Oxidative Stress, Increased Peroxisome Proliferator-activated Receptor-{gamma} Expression, and Diminished Pro-osteogenic Wnt Signaling in the Skeleton J. Biol. Chem., October 2, 2009; 284(40): 27438 - 27448. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Trudel, M. Payne, B. Madler, N. Ramachandran, M. Lecompte, C. Wade, G. Biolo, S. Blanc, R. Hughson, L. Bear, et al. Bone marrow fat accumulation after 60 days of bed rest persisted 1 year after activities were resumed along with hemopoietic stimulation: the Women International Space Simulation for Exploration study J Appl Physiol, August 1, 2009; 107(2): 540 - 548. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. M. Gregoire, F. Zhang, H. J. Clarke, T. A. Gustafson, D. D. Sears, S. Favelyukis, J. Lenhard, D. Rentzeperis, L. E. Clemens, Y. Mu, et al. MBX-102/JNJ39659100, a Novel Peroxisome Proliferator-Activated Receptor-Ligand with Weak Transactivation Activity Retains Antidiabetic Properties in the Absence of Weight Gain and Edema Mol. Endocrinol., July 1, 2009; 23(7): 975 - 988. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Bredella, P. K. Fazeli, K. K. Miller, M. Misra, M. Torriani, B. J. Thomas, R. H. Ghomi, C. J. Rosen, and A. Klibanski Increased Bone Marrow Fat in Anorexia Nervosa J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 2129 - 2136. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Ackert-Bicknell, K. R. Shockley, L. G. Horton, B. Lecka-Czernik, G. A. Churchill, and C. J. Rosen Strain-Specific Effects of Rosiglitazone on Bone Mass, Body Composition, and Serum Insulin-Like Growth Factor-I Endocrinology, March 1, 2009; 150(3): 1330 - 1340. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. K. Loke MBBS MD, S. Singh MD MPH, and C. D. Furberg MD PhD Long-term use of thiazolidinediones and fractures in type 2 diabetes: a meta-analysis Can. Med. Assoc. J., January 6, 2009; 180(1): 32 - 39. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Manolagas De-fense! De-fense! De-fense: Scavenging H2O2 While Making Cholesterol Endocrinology, July 1, 2008; 149(7): 3264 - 3266. [Full Text] [PDF]
|
|
|
|
|
|
D. Glintborg, M. Andersen, C. Hagen, L. Heickendorff, and A. P. Hermann Association of Pioglitazone Treatment with Decreased Bone Mineral Density in Obese Premenopausal Patients with Polycystic Ovary Syndrome: A Randomized, Placebo-Controlled Trial J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1696 - 1701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Kahn, B. Zinman, J. M. Lachin, S. M. Haffner, W. H. Herman, R. R. Holman, B. G. Kravitz, D. Yu, M. A. Heise, R. P. Aftring, et al. Rosiglitazone-Associated Fractures in Type 2 Diabetes: An analysis from A Diabetes Outcome Progression Trial (ADOPT) Diabetes Care, May 1, 2008; 31(5): 845 - 851. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Biserni, F. Giannessi, A. F. Sciarroni, F. M. Milazzo, A. Maggi, and P. Ciana In Vivo Imaging Reveals Selective Peroxisome Proliferator Activated Receptor Modulator Activity of the Synthetic Ligand 3-(1-(4-Chlorobenzyl)-3-t-butylthio-5-isopropylindol-2-yl)-2,2-dimethylpropanoic acid (MK-886) Mol. Pharmacol., May 1, 2008; 73(5): 1434 - 1443. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Meier, M. E. Kraenzlin, M. Bodmer, S. S. Jick, H. Jick, and C. R. Meier Use of Thiazolidinediones and Fracture Risk Arch Intern Med, April 28, 2008; 168(8): 820 - 825. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Miyawaki, S. Kamei, K. Sakayama, H. Yamamoto, and H. Masuno 4-Tert-Octylphenol Regulates the Differentiation of C3H10T1/2 Cells into Osteoblast and Adipocyte Lineages Toxicol. Sci., March 1, 2008; 102(1): 82 - 88. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Monami, B. Cresci, A. Colombini, L. Pala, D. Balzi, F. Gori, V. Chiasserini, N. Marchionni, C. M. Rotella, and E. Mannucci Bone Fractures and Hypoglycemic Treatment in Type 2 Diabetic Patients: A case-control study Diabetes Care, February 1, 2008; 31(2): 199 - 203. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. J. Suva, E. Hartman, J. D. Dilley, S. Russell, N. S. Akel, R. A. Skinner, W. R. Hogue, U. Budde, K. I. Varughese, T. Kanaji, et al. Platelet Dysfunction and a High Bone Mass Phenotype in a Murine Model of Platelet-Type von Willebrand Disease Am. J. Pathol., February 1, 2008; 172(2): 430 - 439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E Murphy and P. T Rodgers Effects of Thiazolidinediones on Bone Loss and Fracture Ann. Pharmacother., December 1, 2007; 41(12): 2014 - 2018. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Yang, V. MacLeod, Y. Dai, Y. Khotskaya-Sample, Z. Shriver, G. Venkataraman, R. Sasisekharan, A. Naggi, G. Torri, B. Casu, et al. The syndecan-1 heparan sulfate proteoglycan is a viable target for myeloma therapy Blood, September 15, 2007; 110(6): 2041 - 2048. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Berberoglu, A. Gursoy, N. Bayraktar, A. C. Yazici, N. Bascil Tutuncu, and N. Guvener Demirag Rosiglitazone Decreases Serum Bone-Specific Alkaline Phosphatase Activity in Postmenopausal Diabetic Women J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3523 - 3530. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. C. Chuang, R. S. Yang, K. S. Tsai, F. M. Ho, and S. H. Liu Hyperglycemia Enhances Adipogenic Induction of Lipid Accumulation: Involvement of Extracellular Signal-Regulated Protein Kinase 1/2, Phosphoinositide 3-Kinase/Akt, and Peroxisome Proliferator-Activated Receptor {gamma} Signaling Endocrinology, September 1, 2007; 148(9): 4267 - 4275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Tannehill-Gregg, T. P. Sanderson, D. Minnema, R. Voelker, B. Ulland, S. M. Cohen, L. L. Arnold, B. E. Schilling, C. R. Waites, and M. A. Dominick Rodent Carcinogenicity Profile of the Antidiabetic Dual PPAR {alpha} and {gamma} Agonist Muraglitazar Toxicol. Sci., July 1, 2007; 98(1): 258 - 270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. V. Schwartz and D. E. Sellmeyer Thiazolidinedione Therapy Gets Complicated: Is bone loss the price of improved insulin resistance? Diabetes Care, June 1, 2007; 30(6): 1670 - 1671. [Full Text] [PDF]
|
|
|
|
|
|
O. P. Lazarenko, S. O. Rzonca, W. R. Hogue, F. L. Swain, L. J. Suva, and B. Lecka-Czernik Rosiglitazone Induces Decreases in Bone Mass and Strength that Are Reminiscent of Aged Bone Endocrinology, June 1, 2007; 148(6): 2669 - 2680. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yaturu, B. Bryant, and S. K. Jain Thiazolidinedione Treatment Decreases Bone Mineral Density in Type 2 Diabetic Men Diabetes Care, June 1, 2007; 30(6): 1574 - 1576. [Full Text] [PDF]
|
|
|
|
|
|
V. David, A. Martin, M.-H. Lafage-Proust, L. Malaval, S. Peyroche, D. B. Jones, L. Vico, and A. Guignandon Mechanical Loading Down-Regulates Peroxisome Proliferator-Activated Receptor {gamma} in Bone Marrow Stromal Cells and Favors Osteoblastogenesis at the Expense of Adipogenesis Endocrinology, May 1, 2007; 148(5): 2553 - 2562. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. V. Schwartz and D. E. Sellmeyer Thiazolidinediones: New Evidence of Bone Loss J. Clin. Endocrinol. Metab., April 1, 2007; 92(4): 1232 - 1234. [Full Text] [PDF]
|
|
|
|
|
|
A. Grey, M. Bolland, G. Gamble, D. Wattie, A. Horne, J. Davidson, and I. R. Reid The Peroxisome Proliferator-Activated Receptor-{gamma} Agonist Rosiglitazone Decreases Bone Formation and Bone Mineral Density in Healthy Postmenopausal Women: A Randomized, Controlled Trial J. Clin. Endocrinol. Metab., April 1, 2007; 92(4): 1305 - 1310. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. Perrien, N. S. Akel, P. K. Edwards, A. A. Carver, M. S. Bendre, F. L. Swain, R. A. Skinner, W. R. Hogue, K. M. Nicks, T. M. Pierson, et al. Inhibin A Is an Endocrine Stimulator of Bone Mass and Strength Endocrinology, April 1, 2007; 148(4): 1654 - 1665. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Lecka-Czernik, C. Ackert-Bicknell, M. L. Adamo, V. Marmolejos, G. A. Churchill, K. R. Shockley, I. R. Reid, A. Grey, and C. J. Rosen Activation of Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) by Rosiglitazone Suppresses Components of the Insulin-Like Growth Factor Regulatory System in Vitro and in Vivo Endocrinology, February 1, 2007; 148(2): 903 - 911. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. S. Perrien, N. S. Akel, E. E. Dupont-Versteegden, R. A. Skinner, E. R. Siegel, L. J. Suva, and D. Gaddy Aging alters the skeletal response to disuse in the rat Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2007; 292(2): R988 - R996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Irwin, H. V. Lin, K. J. Motyl, and L. R. McCabe Normal Bone Density Obtained in the Absence of Insulin Receptor Expression in Bone Endocrinology, December 1, 2006; 147(12): 5760 - 5767. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Ranganathan, R. Unal, I. Pokrovskaya, A. Yao-Borengasser, B. Phanavanh, B. Lecka-Czernik, N. Rasouli, and P. A. Kern The lipogenic enzymes DGAT1, FAS, and LPL in adipose tissue: effects of obesity, insulin resistance, and TZD treatment J. Lipid Res., November 1, 2006; 47(11): 2444 - 2450. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. B. Watts and D. A. D'Alessio Type 2 diabetes, thiazolidinediones: bad to the bone? J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3276 - 3278. [Full Text] [PDF]
|
|
|
|
|
|
A. V. Schwartz, D. E. Sellmeyer, E. Vittinghoff, L. Palermo, B. Lecka-Czernik, K. R. Feingold, E. S. Strotmeyer, H. E. Resnick, L. Carbone, B. A. Beamer, et al. Thiazolidinedione Use and Bone Loss in Older Diabetic Adults J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3349 - 3354. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Mascitelli and F. Pezzetta Thiazolidinediones and the Risk of Nontraumatic Fractures in Patients With Diabetes Arch Intern Med, January 9, 2006; 166(1): 126 - 126. [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Thrailkill, C. K. Lumpkin Jr., R. C. Bunn, S. F. Kemp, and J. L. Fowlkes Is insulin an anabolic agent in bone? Dissecting the diabetic bone for clues Am J Physiol Endocrinol Metab, November 1, 2005; 289(5): E735 - E745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Schwab, S. Granholm, E. Persson, B. Wilkes, U. H. Lerner, and H. H. Conaway Stimulation of Resorption in Cultured Mouse Calvarial Bones by Thiazolidinediones Endocrinology, October 1, 2005; 146(10): 4349 - 4361. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Botolin, M.-C. Faugere, H. Malluche, M. Orth, R. Meyer, and L. R. McCabe Increased Bone Adiposity and Peroxisomal Proliferator-Activated Receptor-{gamma}2 Expression in Type I Diabetic Mice Endocrinology, August 1, 2005; 146(8): 3622 - 3631. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Seeman and G. J. Strewler Clinical and Basic Research Papers - February 2005 Selections IBMS BoneKEy, March 1, 2005; 2(3): 1 - 5. [Full Text] [PDF]
|
|
|
|
|
|
A. A. Ali, R. S. Weinstein, S. A. Stewart, A. M. Parfitt, S. C. Manolagas, and R. L. Jilka Rosiglitazone Causes Bone Loss in Mice by Suppressing Osteoblast Differentiation and Bone Formation Endocrinology, March 1, 2005; 146(3): 1226 - 1235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. N. Bennett, K. A. Longo, W. S. Wright, L. J. Suva, T. F. Lane, K. D. Hankenson, and O. A. MacDougald Regulation of osteoblastogenesis and bone mass by Wnt10b PNAS, March 1, 2005; 102(9): 3324 - 3329. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Davidson, S. V. Edelman, L. Mascitelli, F. Pezzetta, and H. Yki-Jarvinen Thiazolidinediones N. Engl. J. Med., January 13, 2005; 352(2): 205 - 207. [Full Text] [PDF]
|
|
|
|
 |
|
 M A. Soroceanu, D. Miao, X.-Y. Bai, H. Su, D. Goltzman, and A. C Karaplis Rosiglitazone impacts negatively on bone by promoting osteoblast/osteocyte apoptosis J. Endocrinol., October 1, 2004; 183(1): 203 - 216. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
