help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1130
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Raff, H.
Right arrow Articles by Engeland, W. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raff, H.
Right arrow Articles by Engeland, W. C.
Endocrinology Vol. 145, No. 1 79-86
Copyright © 2004 by The Endocrine Society

Basal and Adrenocorticotropin-Stimulated Corticosterone in the Neonatal Rat Exposed to Hypoxia from Birth: Modulation by Chemical Sympathectomy

Hershel Raff, Julie J. Lee, Eric P. Widmaier, Martin K. Oaks and William C. Engeland

Endocrine and Transplant Research Laboratories (H.R., M.K.O.), St. Luke’s Medical Center, Milwaukee, Wisconsin 53215; Department of Medicine (H.R.), Medical College of Wisconsin, Milwaukee, Wisconsin 53226; Department of Biology (J.J.L., E.P.W.), Boston University, Boston, Massachusetts 02215; and Departments of Surgery and Neuroscience (W.C.E.), University of Minnesota, Minneapolis, Minnesota 55455

Address all correspondence and requests for reprints to: Hershel Raff, Ph.D., Endocrinology, St. Luke’s Physician’s Office Building, 2801 W KK River Parkway Suite 245, Milwaukee, Wisconsin 53215. E-mail: hraff{at}mcw.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously demonstrated that 7-d-old rat pups exposed to hypoxia from birth exhibit ACTH-independent increases in corticosterone associated with an increase in steroidogenic acute regulatory (StAR) and peripheral-type benzodiazepine receptor (PBR) proteins. The purpose of the present study was to determine whether this increase in corticosterone could be attenuated by chemical sympathectomy induced with guanethidine treatment. Rat pups were exposed to normoxia or hypoxia from birth and treated with vehicle or guanethidine and studied at 7 d of age. Hypoxia per se resulted in an increase in plasma corticosterone without a change in plasma ACTH. Guanethidine treatment attenuated the increase in basal corticosterone in hypoxic pups but did not attenuate ACTH-stimulated corticosterone production. This effect was specific as basal and ACTH-stimulated aldosterone was not affected. Guanethidine also attenuated the increase in StAR protein induced by hypoxia. Neither the effect of hypoxia nor that of guanethidine could be explained by changes in the levels of adrenal tyrosine hydroxylase, StAR, or P450scc mRNA, adrenal tyrosine hydroxylase immunohistochemistry, or adrenal catecholamine content. We conclude that chemical sympathectomy normalizes basal corticosterone levels but has no effect on ACTH-stimulated corticosterone levels in 7-d-old rats exposed to hypoxia from birth. The mechanism of the effect of guanethidine to normalize hypoxia-stimulated basal corticosterone remains to be identified, although StAR protein may be an important mediator. This ACTH-independent increase in corticosterone may be a mechanism by which the neonate can increase circulating glucocorticoids necessary for survival while bypassing the hyporesponsiveness of the neonatal hypothalamic-pituitary-adrenal axis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE ENDOCRINE RESPONSE to stress is a critical component of the neonatal adaptation to extrauterine life (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12). The stress response has been extensively examined in the neonatal rat, and several unique characteristics have been identified. In particular, maternal care appears to have a critical effect on the response of the neonatal hypothalamic-pituitary-adrenal axis because extended separation of the pups from their dams augments neonatal responses to acute stress (11, 13, 14). Recently, it has been demonstrated that neonatal chemical sympathectomy with guanethidine attenuates the augmenting effects of maternal separation (13). The cellular mechanisms or implications of this phenomenon have yet to be elucidated.

A variety of common heart and lung diseases can result in prolonged neonatal hypoxia requiring intensive care (15, 16). Several groups, including ours, have exposed neonatal rat pups to hypoxia from birth as a model of chronic postnatal hypoxia in humans (17, 18, 19, 20). Using this model, we recently demonstrated a primary, ACTH-independent increase in steroidogenesis and in corticosterone responses to ACTH in 7-d-old rat pups exposed to hypoxia from birth (19, 20). Our previous study suggested that the mediators of the rate-limiting step of steroidogenesis, steroidogenic acute regulatory (StAR) and peripheral-type benzodiazepine receptor (PBR) proteins, might be involved in the ACTH-independent augmentation of corticosterone production (20). Because the neonatal adrenomedullary response is critical to the adaptation to hypoxia (21), we hypothesized that the augmentation of corticosteronogenesis by hypoxia from birth would be attenuated by chemical sympathectomy and that this attenuation would correlate with StAR and/or PBR protein expression.

Therefore, we exposed rat pups to hypoxia from birth to 7 d of age during which chemical sympathectomy was induced with guanethidine. At 7 d of age, we measured basal plasma steroid levels and assessed the adrenal response to ACTH injection. We also analyzed adrenal StAR and PBR protein levels, StAR, tyrosine hydroxylase (TH), and P450scc mRNA expression, TH protein expression, as well as tissue catecholamine levels.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animal treatment and exposure to hypoxia
All animal experimental procedures were approved by the Medical College of Wisconsin and Aurora Health Care Institutional Animal Care and Use Committees and conformed to the American Physiological Society’s Guiding Principles for Research Involving Animals and Human Beings. Timed pregnant Sprague-Dawley rats (Harlan, Indianapolis, IN; n = 16) were obtained at 14 d gestation and maintained on a standard sodium diet and water ad libitum in a controlled environment (0600–1800 h lights on). Parturition occurred spontaneously on the afternoon of gestational d 21 during which rats were kept under observation. As soon as a litter was completely delivered, the pups were weighed and cross-fostered (10–12 pups/dam), and the dam and her pups were moved to an environmental chamber and exposed to normobaric normoxia (21% O2) or hypoxia (12% O2) as described in detail previously (17, 19, 20). We have previously shown that this exposure leads to arterial PO2 levels in adults of approximately 50–55 torr with sustained respiratory alkalosis with metabolic compensation (22, 23, 24).

Chemical sympathectomy
Pups were treated with guanethidine monosulfate (Sigma Chemical Co., St. Louis, MO) or vehicle as a modification of two previously published protocols (13, 25). On the morning of postnatal d 3, pups were weighed and injected with isotonic saline (vehicle) or guanethidine sc (20 mg/kg). Pups were weighed and injected again on the morning of postnatal d 5 (40 mg/kg) and the afternoon of postnatal d 6 (40 mg/kg). The next morning, experimentation was performed.

ACTH injection and blood and tissue sampling
At 0800 h at 7 d of age, approximately two thirds of the pups in each litter were quickly removed from the chamber, weighed, and decapitated (basal samples). Trunk blood was collected in sodium EDTA (two to three pups/tube), and adrenal glands, the heart, and the spleen were removed. Subcapsules (zonae fasciculata/reticularis) were separated, and all tissue was immediately frozen for subsequent analysis (see below). The remaining pups were weighed and injected ip with porcine ACTH (Sigma) diluted in normal saline as described in detail previously (26). Pups were injected with 20 µg/kg ACTH (10 µl/g body weight) and immediately returned to their home cages with their dams in the appropriate normoxic or hypoxic environment. The pups were then decapitated at 30 min after ACTH injection, with blood and adrenal glands collected as described above. This time point was chosen based on peak responses to ACTH described previously (20).

Hormone assays
Plasma ACTH and corticosterone were analyzed in unextracted plasma by RIA using reagents purchased from ICN Pharmaceuticals (Costa Mesa, CA) as described previously (19, 20, 24). Intra- and interassay coefficients of variation for the ACTH assay were 6.0% (n = 10) and 11% (n = 10), respectively. Intra- and interassay coefficients of variation for the corticosterone assay were 7.1% (n = 10) and 8.6% (n = 15), respectively. Because of hyperlipidemia that occurs in suckling rats (27), plasma was centrifuged at 16,000 x g for 2 min before assay to avoid interference of lipids in the ACTH assay. Plasma samples after ACTH injection were diluted 1:5 for analysis of plasma ACTH. Plasma aldosterone was analyzed by solid-phase RIA (Diagnostic Systems Labs, Webster, TX) following the manufacturer’s specifications, except that standards and samples were assayed with 50 µl (instead of 100 µl), which still provided sufficient sensitivity (25 pg/ml). Intra- and interassay coefficients of variation were 3.6% (n = 10) and 7.3% (n = 10), respectively. Plasma renin activity was measured as angiotensin I generation in vitro as described previously (28). Intra- and interassay coefficients of variation were 6.7% (n = 15) and 10.0% (n = 15), respectively.

RT-PCR for TH, StAR, and P450scc mRNA
Total cellular RNA was extracted by the guanidine thiocyanate method using kit-supplied reagents (RNAgents, Promega Biotec, Madison, WI). Single-strand cDNA was generated from 1 µg total cellular RNA with the use of Superscript II preamplification reagents (Life Technologies, Bethesda, MD) according to the manufacturer’s instructions. PCR was carried out in 25-µl volumes of 1x PCR buffer [60 mM Tris-HCl (pH 9.0), 15 mM (NH4)2SO4, 2.5 mM MgCl2] containing 1/10 the contents of the RT reaction, 0.2 mM each dNTP, 0.5 µM each primer, and 0.05 U/µl Taq DNA polymerase (Promega, Madison, WI).

For TH PCR, the reactions were subjected to 35 amplification cycles on a Perkin-Elmer-Cetus thermal cycler. The amplification cycle profile was >95 C denaturation for 1 min, followed by primer annealing at 62 C for 1 min and extension for 2 min at 72 C. Primers were designed using commercially available software (Primer Designer, S&E Software, State Line, PA) from the previously published sequence of rat TH gene (29). The following are the 5'->3' sequences of the sense (s) and antisense (as) primers used in these studies: rTH-s, GGAATGCTGTTCTCAACCTG; rTH-as, GTGACACTTGTCCAATTCCG. The primers were synthesized by Operon Technologies (Alameda, CA). During the validation process of the TH RT-PCR assay, PCR product was purified and then sequenced by Sequetech Corp. (Mountain View, CA). StAR and P450scc PCR were performed using previously published methods and primer sequences (19, 30). Semiquantitative analysis was performed by normalization of the target signal to ß-actin as described previously (31). Gels were digitized and scanned using an Alphaimager System (Alpha Innotech, San Leandro, CA).

StAR and PBR protein immunoblot analysis was performed as described in detail previously (26) with antibodies kindly provided by V. Papadopoulos (Georgetown University School of Medicine, Washington, DC). Protein was extracted from subcapsules (zona fasciculata/reticularis) and fractionated by one-dimensional SDS-PAGE on a 15% acrylamide gel. Proteins were transferred onto 0.45-µm nitrocellulose membranes for 30 min using a Trans-Blot Cell (Idea, Corvalis, OR). Membranes were blocked for nonspecific absorption using 3% (wt/vol) dry nonfat milk. The blots were treated for immunodetection of PBR, stripped, and reblotted for detection of StAR protein using anti-PBR and anti-StAR at 1:1000 dilution prepared as previously described (26). Data were normalized to ß-actin protein using antimouse actin antibody at 1:1000 dilution (Sigma). Goat antimouse IgG-horseradish peroxidase was used as secondary antibody at 1:6000 followed by chemiluminescent detection with reagents from Perkin-Elmer (Boston, MA). NIH Image J software was used to quantify blots.

Immunohistochemistry for neural tyrosine hydroxylase
Adrenal and spleen nerve immunohistochemistry (n = 5/group) for TH-positive chromaffin cells and nerve fibers was performed as described previously (32). Tissue was fixed in Zamboni’s fixative and stored in 20% sucrose as cryoprotectant. Tissue was frozen-sectioned (50 µm) and incubated with rabbit anti-TH sera (1:200; Pel-Freez, Rogers, AR) overnight at 4 C. Sections were washed and incubated with the secondary antibody (Cy3-labeled donkey antirabbit; Jackson ImmunoResearch, West Grove, PA) overnight at 4 C. Specific labeling was eliminated when primary antibodies were omitted or preabsorbed with the specific antigen. Optical images were collected using a monochrome charge-coupled device camera (Cohu, San Diego, CA), captured with a Scion LG-3 frame-grabber, and processed on a Power Macintosh computer using the public domain NIH Image 1.62 program [by W. Rasband (National Institutes of Health) available on the Internet by anonymous ftp from zippy.nimh.nih.gov] and Adobe Photoshop 4.0 software.

Tissue catecholamines
Catecholamine content was assessed as described previously (33). Briefly, tissue was homogenized in Tris-EDTA with sodium metabisulfite and alumina. Catecholamine content was determined by reverse-phase HPLC with electrochemical detection.

Statistical analysis
Data were analyzed by unpaired t test and two- and three-factor ANOVA (P < 0.05). Post hoc analysis was performed by Duncan’s multiple range test. Data are presented as mean ± SE.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Body weight
Body weights on the days of vehicle or guanethidine injection are shown in Fig. 1Go. Chemical sympathectomy with guanethidine in normoxic pups (Norm-Guan) had no effect on body weight gain compared with vehicle-injected normoxic controls (Norm-Veh). Hypoxia per se (Hyp-Veh) resulted in a significant decrease in body weight gain. The combination of guanethedine and hypoxia (Hyp-Guan) from birth did not further alter body weight gain compared with hypoxic pups treated with vehicle (Hyp-Veh).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. Body weight in neonatal pups exposed to normoxia [Norm (control)] or hypoxia (Hyp) and injected with vehicle (Veh) or guanethidine (Guan). Arrows indicate when Veh or Guan was injected; +, indicates that Norm (Veh or Guan) is significantly different from Hyp (Veh or Guan) at time point indicated. The body weights of pups within each litter were weighed, averaged, and treated as one datum (n = 4 litters per mean/SEM).

 
Plasma ACTH and corticosterone
Guanethidine treatment in normoxic pups had no effect on basal plasma ACTH or corticosterone (Fig. 2Go, filled bars). Hypoxia per se resulted in a large increase in basal plasma corticosterone in the absence of a significant effect on plasma ACTH. Treatment of hypoxic rat pups with guanethidine restored basal corticosterone levels to levels similar to control pups (Veh or Guan-Normoxia). The plasma levels of ACTH achieved at 30 min after ACTH injection (open bars) were similar between groups. Guanethidine treatment of normoxic pups had no effect on ACTH-stimulated corticosterone levels. Hypoxia in vehicle-treated rats resulted in higher absolute levels of corticosterone achieved 30 min after ACTH injection compared with normoxic control. Guanethidine treatment of hypoxic pups did not attenuate ACTH-stimulated corticosterone levels.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2. Plasma ACTH (top) and corticosterone (bottom) in 7-d-old rat pups before (basal; black bars) or 30 min after (gray bars) injection of ACTH ip. Rat pups were exposed to either normoxia or hypoxia from birth and treated with vehicle (control) or guanethidine as indicated in Fig. 1Go. *, Significant increase after injection of ACTH; +, significant difference from normoxia vehicle (control). Each mean/SEM is n = 7–9.

 
Plasma renin activity and aldosterone
Neither hypoxia nor treatment with guanethidine nor both had a significant effect on plasma renin activity or basal or ACTH-stimulated aldosterone levels (Fig. 3Go).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 3. Plasma renin activity (top) and aldosterone (bottom) in 7-d-old rat pups before (basal; black bars) or 30 min after (gray bars) injection of ACTH ip. Rat pups were exposed to either normoxia or hypoxia from birth and treated with vehicle (control) or guanethidine as indicated in Fig. 1Go. *, Significant increase after injection of ACTH. Each mean/SEM is n = 7–9.

 
Adrenal StAR and PBR protein
Guanethidine treatment in normoxic control rat pups resulted in a small, but significant decrease in StAR protein with no effect on PBR protein (Fig. 4Go). Hypoxia in vehicle-treated pups resulted in an increase in both StAR and PBR protein. Treatment of hypoxic pups with guanethidine resulted in a normalization of StAR protein levels. PBR levels were not significantly less than vehicle-treated hypoxic rat pups, but levels were no longer different from normoxic pups.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4. StAR and PBR protein (normalized to ß-actin) in adrenal subcapsules from 7-d-old pups exposed to normoxia or hypoxia from birth and treated with vehicle or guanethidine. *, Hypoxia different from normoxia; +, guanethidine different from vehicle within same exposure. Each mean is n = 5–7.

 
Adrenal TH, StAR, and P450scc mRNA by RT-PCR
There were no significant effects of guanethedine, hypoxia, or their combination on TH, StAR, or P450scc mRNA levels (Table 1Go). The nucleotide sequencing of the 265-base-pair stretch of the TH RT-PCR product showed 100% sequence identity to the published rat TH gene.


View this table:
[in this window]
[in a new window]
 
TABLE 1. TH, StAR, and P450scc mRNA by RT-PCR (normalized to ß-actin mRNA)

 
TH immunohistochemistry
Adrenals from 7-d-old rat pups contained a number of TH-positive fibers in the adrenal capsule and outer cortex and TH-positive chromaffin cells in the medulla and scattered within the cortex (Figs. 5Go and 6Go). The spleen also had many TH-positive nerve fibers. Neither hypoxia from birth nor guanethidine nor the combination of the two appeared to alter TH-positive innervation of the neonatal adrenal gland or spleen.



View larger version (102K):
[in this window]
[in a new window]
 
FIG. 5. Neither hypoxia nor guanethidine treatment appeared to alter the TH-positive innervation of the neonatal adrenal gland. Adrenals from normoxic (A), hypoxic (B) and guanethidine-treated (C) normoxic, and hypoxic (D) rats contained a number of TH-positive fibers in the adrenal capsule and outer cortex (arrows). Sections also demonstrate TH-positive chromaffin cells in the center of the gland and scattered within the cortex (arrowheads). Bar, 100 µm.

 


View larger version (95K):
[in this window]
[in a new window]
 
FIG. 6. Neither hypoxia nor guanethidine treatment appeared to alter the TH-positive innervation of the neonatal spleen. Splenic tissue from normoxic (A), hypoxic (B) and guanethidine-treated (C) normoxic, and hypoxic (D) rats contained a number of TH-positive fibers (arrow). Bar, 100 µm.

 
Tissue catecholamines
Table 2Go shows tissue catecholamine content (normalized to organ weight) and adrenal weight. Norepinephrine content in the heart and spleen was significantly decreased by guanethidine treatment. There was no effect of hypoxia on norepinephrine content in the heart or spleen. Whereas guanethidine had no effect on adrenal norepinephrine content, it tended to increase adrenal epinephrine content. Except for a small increase in adrenal norepinephrine content in hypoxic rat pups treated with guanethidine, there were no effects of hypoxia on adrenal catecholamine content. There was no effect of either hypoxia and/or guanethidine on adrenal weight.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Catecholamine content in heart, adrenal, and spleen

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The main findings of this study were as follows. First, hypoxia from birth resulted in ACTH-independent increases in corticosterone consistent with our previous study (20). Second, chemical sympathectomy with guanethidine normalized basal corticosterone in hypoxic pups but did not attenuate corticosterone responses to exogenous ACTH, nor did it alter plasma renin activity or aldosterone. Third, the restoration of normal corticosterone levels in hypoxic rat pups treated with guanethidine occurred in parallel with StAR protein levels.

The control of steroidogenesis in the neonatal adrenal gland undergoes both quantitative and qualitative changes that are nearly complete by the time of weaning. The capacity to produce corticosterone matures over the first 3–5 wk of postnatal life, and this correlates with the expression of proteins involved in steroidogenesis (26, 34). These proteins control the rate-limiting step of steroidogenesis, cholesterol transport from the cytosol into the mitochondria for presentation to the first enzyme of steroidogenesis, P450scc (35, 36, 37). Therefore, it was logical for us to propose that the increase in corticosteronogenesis we have reported previously in hypoxic rat pups (20) might be mediated by either StAR or PBR, or both.

We also previously reported that this primary increase in corticosterone production did not require a significant increase in plasma ACTH (20). The current study confirmed this finding. What, then, might be the stimulus to steroidogenesis if not ACTH? Several previous studies led us to hypothesize that the sympathetic nervous system might be involved in some way (13, 14). Studies using other neonatal stressors such as separation from the dam demonstrated this phenomenon. In particular, chemical sympathectomy with guanethidine attenuated the corticosterone response to maternal separation in neonatal rat pups (13). Another study showed that this phenomenon was associated with increased expression of c-fos and TH (14). Furthermore, at 7 d of age, there has not yet been significant innervation of the neonatal adrenal medulla by preganglionic nerves, so any control by hypoxia is either humoral or direct (38). This is different from the adult where splanchnic nerve input is an important controller of steroidogenesis (39, 40).

The current study clearly demonstrated that chemical sympathectomy reduced the ACTH-independent, hypoxia-stimulated increase in basal corticosterone. Although cause and effect has not been proven, the changes in corticosterone were associated with changes in StAR protein. This is clearly an effect on posttranslational processing of StAR protein because StAR mRNA levels were unchanged. This is consistent with our previous study (20) and a now classic study by Artemenko et al. (41) that demonstrated that production of mature StAR protein is the critical component of the control of this system. It is currently not known exactly how this process occurs, but it is thought to be due to changes in either protein degradation or, more likely, acceleration of StAR protein processing to its mature form (41). It is clear from the present study that this effect is specific because aldosterone production from zona glomerulosa cells was not altered by hypoxia and/or guanethidine.

Also compelling was the finding that chemical sympathectomy had no effect on the maximal corticosterone response to exogenous ACTH. This suggests that basal (constitutive) neonatal production of corticosterone during hypoxia is regulated differently from ACTH-stimulated steroidogenesis. It may be that the use of neonatal hypoxia as an experimental model may be a useful approach to evaluate the control of basal vs. ACTH-stimulated corticosterone production.

At this point, we do not know what factor or factors in hypoxic pups result in increased StAR and PBR proteins and in increased basal corticosterone production. This could be due to a direct effect of hypoxia on the adrenal. It is hard to envision how a direct effect could be blocked by guanethidine because this compound had little effect on adrenal TH gene expression or staining or on catecholamine content. Also, the effect of hypoxia in vivo is considerably more dramatic when adrenal function is studied in vivo (Ref. 20 and current study) compared with removing adrenals from hypoxic pups and studying steroidogenesis in vitro (19, 27). This suggests the presence of factor(s) in vivo that are necessary for the augmentation of basal corticosterone and are sensitive to guanethidine.

The tissue catecholamine data demonstrated a significant effect of guanethidine in the heart and spleen. This is consistent with a previous study using higher and more frequent dosing of guanethidine (25) and with the mechanism of action of guanethidine to serve as an inactive substitute neurotransmitter in postganglionic adrenergic synaptic nerve terminals (42). The lack of an effect of guanethidine on adrenal norepinephrine content is also consistent with previous studies and indicates that the adrenal medullary chromaffin cell is not particularly sensitive to guanethidine (13, 25). The minimal effect of hypoxia on adrenal catecholamine content suggests that this is not an important factor involved in the increased basal corticosterone in hypoxic pups. The data also cannot be explained by large changes in adrenal weight due to exposure to hypoxia (20). Finally, we found an unexpected small increase in adrenal epinephrine levels with guanethidine that has not been previously demonstrated (25); we are as yet unsure of the significance and/or mechanism of this finding.

Labeling for TH protein in the adrenal and spleen demonstrated numerous TH-positive fibers in both tissues, reflecting innervation by postganglionic sympathetic nerves. The lack of effect of guanethidine on TH labeling suggests that the drug does not result in nerve degeneration. However, the reduction in spleen norepinephrine content clearly shows that guanethidine was effective in depleting neurotransmitter from postganglionic sympathetic nerves. It is possible that guanethidine had a similar effect in the adrenal cortex, which is innervated by postganglionic sympathetic nerves in the rat neonatal (32) and adult (43) adrenal. Unlike the spleen, measurement of adrenal norepinephrine cannot be used as an indicator of sympathetic fibers, because catecholamine content is largely reflective of the content of chromaffin cells. If norepinephrine is depleted in the adrenal cortex, the loss of this neural activity could contribute to the ACTH-independent changes in corticosterone after hypoxia. There was also no effect on adrenal weight of either intervention nor were there any apparent effects on morphometry of the adrenal cortex. This is consistent with our previous study that failed to show an effect of neonatal hypoxia on histomorphometry, functional zonation, or mitochondrial density (19). In addition, guanethidine by itself does not alter adrenal weight, DNA, RNA, or protein content in rats as they mature (44), suggesting that the effect of guanethidine is not mediated by changes in the structural characteristics of the adrenal cortex.

There could also be some circulating factor other than immunologically detectible ACTH that is altered by guanethidine and stimulates corticosterone. One interesting possibility is that large increases in lipids including cholesterol and triglycerides, which we have documented during neonatal hypoxia, might bypass the cytosolic control of steroidogenesis and directly increase corticosterone production (27). We are fairly certain that the effect of hypoxia is not mediated by many other circulating peptides including leptin, GH, IGF-1, PTH, or ghrelin (45, 46, 47, 48, 49). However, we have demonstrated an increase in insulin during neonatal hypoxia that may alter steroidogenesis (45, 46). A genomic study in ovaries showed a parallel increase in expression of G protein and StAR, although cause and effect was not studied (50) Adrenergic receptor agonists can increase corticosteroidogenesis, but an association with StAR expression has not been demonstrated (51). Of course, it is always possible that guanethidine has some direct effect on zona fasciculata cells that has not been previously described. This seems unlikely because guanethidine had no effect in normoxic pups. Another factor we have not yet analyzed is whether there is a difference in the phenomena described between male and female neonatal rats as has been described recently for adrenal sensitivity to ACTH (52).

There are several significant aspects of this study other than the specific effects on neonatal steroidogenesis. Human neonates are often treated with corticosteroids and with adrenergic agents for a variety of disorders (53, 54, 55, 56, 57, 58). The short- and long-term effects of these agents on the control of steroidogenesis in hypoxic neonates are unknown. Furthermore, increased corticosteroids may be necessary for an adequate response to adrenergic agents (59). Therefore, it is important to understand the effects of the neonatal sympathetic nervous system on steroidogenesis. Our previous studies also suggest that this primary increase in corticosterone production occurs in the absence of activation of the hypothalamus and pituitary (60). This ACTH-independent increase in corticosterone, which appears to be at least partly mediated by an increase in StAR protein, may be a mechanism by which the neonate can increase circulating glucocorticoids while bypassing the hyporesponsiveness of the neonatal hypothalamic-pituitary-adrenal axis.


    Acknowledgments
 
We thank Eric Bruder, Barbara Jankowski, Peter Homar, Karen Hallett, Camille Torres, and Lisa Henderson for their expert technical assistance.


    Footnotes
 
This work was supported by NIH Grant DK54685 to H.R., NIH Grant DK55793 to E.P.W., and NSF IBN-0112543 to W.C.E.

Abbreviations: PBR, peripheral-type benzodiazepine receptor; StAR, steroidogenic acute regulatory; TH, tyrosine hydroxylase.

Received August 28, 2003.

Accepted for publication September 22, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sapolsky RM, Meaney MJ 1986 Maturation of the adrenocortical stress response: neuroendocrine control mechanisms and the stress hyporesponsive period. Brain Res Rev 11:65–76
  2. Viau V, Sharma S, Meaney MJ 1996 Changes in plasma adrenocorticotropin, corticosterone, corticosterone-binding globulin, and hippocampal glucocorticoid receptor occupancy/translocation in rat pups in response to stress. J Neuroendocrinol 8:1–8[CrossRef][Medline]
  3. Walker CD, Dallman MF 1993 Neonatal facilitation of stress-induced adrenocorticotropin secretion by prior stress: evidence for increased central drive to the pituitary. Endocrinology 132:1101–1107[Abstract/Free Full Text]
  4. Walker CD, Perrin M, Vale W, Rivier C 1986 Ontogeny of the stress response in the rat: role of the pituitary and the hypothalamus. Endocrinology 118:1445–1451[Abstract/Free Full Text]
  5. Walker CD, Sapolsky RM, Meaney MJ, Vale WW, Rivier CL 1986 Increased pituitary sensitivity to glucocorticoid feedback during the stress nonresponsive period in the neonatal rat. Endocrinology 119:1816–1821[Abstract/Free Full Text]
  6. Walker CD, Scribner KA, Cascio CS, Dallman MF 1991 The pituitary-adrenocortical system of neonatal rats is responsive to stress throughout development in a time-dependent and stressor-specific fashion. Endocrinology 128:1385–1395[Abstract/Free Full Text]
  7. Walker SJ, Vrana KE 1993 Pituitary corticotroph function during the stress hyporesponsive period in neonatal rats. Neuroendocrinology 57:1003–1010[Medline]
  8. Widmaier EP 1989 Development in rats of the brain-pituitary-adrenal response to hypoglycemia in vivo and in vitro. Am J Physiol Endocrinol Metab 257:E757–E763
  9. Yi SJ, Baram TZ 1994 Corticotropin-releasing hormone mediates the response to cold stress in the neonatal rat without compensatory enhancement of the peptide’s gene expression. Endocrinology 135:2364–2368[Abstract]
  10. Hanukoglu A, Fried D, Nakash I, Hanukoglu I 1995 Selective increases in adrenal steroidogenic capacity during acute respiratory disease in infants. Eur J Endocrinol 133:552–556[Abstract/Free Full Text]
  11. Dent GW, Okimoto DK, Smith MA, Levine S 2000 Stress-induced alterations in corticotropin-releasing hormone and vasopressin gene expression in the paraventricular nucleus during ontogeny. Neuroendocrinology 71:333–342[CrossRef][Medline]
  12. Dent GM, Smith MA, Levine S 2000 Rapid induction of corticotropin-releasing hormone gene transcription in the paraventricular nucleus of the developing rat. Endocrinology 141:1593–1598[Abstract/Free Full Text]
  13. Walker CD 1995 Chemical sympathectomy and maternal separation affect neonatal stress responses and adrenal sensitivity to ACTH. Am J Physiol 268:R1282–R1288
  14. Okimoto DK, Blaus A, Schmidt M, Gordon MK, Dent GW, Levine S 2002 Differential expression of c-fos and tyrosine hydroxylase mRNA in the adrenal gland of the infant rat: evidence for an adrenal hyporesponsive period. Endocrinology 143:1717–1725[Abstract/Free Full Text]
  15. Frankel L, Stevenson DK 1987 Metabolic emergencies of the newborn: hypoxemia and hypoglycemia. Compr Ther 13:14–19[Medline]
  16. Rubaltelli FF, Bonafe L, Tangucci M, Spagnolo A, Dani C 1998 Epidemiology of neonatal acute respiratory disorders. Biol Neonate 74:7–15[CrossRef][Medline]
  17. Thomas T, Marshall JM 1995 A study on rats of the effects of chronic hypoxia from birth on respiratory and cardiovascular responses evoked by acute hypoxia. J Physiol 487:513–525[Abstract/Free Full Text]
  18. Corno AF, Milano G, Samaja M, Tozzi P, von Segesser LK 2002 Chronic hypoxia: a model for cyanotic congenital heart defects. J Thorac Cardiovasc Surg 124:105–112[Abstract/Free Full Text]
  19. Raff H, Jankowski BM, Bruder ED, Engeland WC, Oaks MK 1999 The effect of hypoxia from birth on the regulation of aldosterone in the 7-day-old rat: plasma hormones, steroidogenesis in vitro, and steroidogenic enzyme mRNA. Endocrinology 140:3147–3153[Abstract/Free Full Text]
  20. Raff H, Hong JJ, Oaks MK, Widmaier EP 2003 Adrenocortical responses to ACTH in the neonatal rat: the effect of hypoxia from birth on corticosterone, StAR, and PBR. Am J Physiol Regul Integr Comp Physiol 284:R78–R85
  21. Seidler FJ, Slotkin TA 1985 Adrenomedullary function in the neonatal rat: responses to acute hypoxia. J Physiol 358:1–16[Abstract/Free Full Text]
  22. Raff H, Chadwick CJ 1986 Aldosterone responses to ACTH during hypoxia in conscious rats. Clin Exp Pharmacol Physiol 13:827–830[Medline]
  23. Raff H, Roarty TP 1998 Renin, ACTH, and aldosterone during acute hypercapnia and hypoxia in conscious rats. Am J Physiol Regul Integr Comp Physiol 254:R431–R435
  24. Raff H, Sandri RB, Segerson TP 1986 Renin, ACTH, and adrenocortical function during hypoxia and hemorrhage in conscious rats. Am J Physiol Regul Integr Comp Physiol 250:R240–R244
  25. Johnson EM, Cantor E, Douglas JR 1975 Biochemical and functional evaluation of the sympathectomy produced by the administration of guanethidine to newborn rats. J Pharm Exp Ther 193:503–512[Abstract/Free Full Text]
  26. Zilz A, Castello R, Papadopoulos V, Widmaier EP 1999 Developmental expression of the peripheral-type benzodiazepine receptor and the advent of steroidogenesis in rat adrenal glands. Endocrinology 140:859–864[Abstract/Free Full Text]
  27. Raff H, Bruder ED, Jankowski BM, Goodfriend TL 2000 Neonatal hypoxic hyperlipidemia in the rat: effects on aldosterone and corticosterone synthesis in vitro. Am J Physiol Regul Integr Comp Physiol 278:R663–R668
  28. Rieder MJ, Roman RJ, Greene AS 1997 Reversal of microvascular rarefaction and reduced renal mass hypertension. Hypertension 30:120–127[Abstract/Free Full Text]
  29. Grima B, Lamouroux A, Blanot F, Biguet NF, Mallet J 1985 Complete coding sequence of rat tyrosine hydroxylase mRNA. Proc Natl Acad Sci USA 82:617–621[Abstract/Free Full Text]
  30. Raff H, Jankowski BM, Engeland WC, Oaks MK 1996 Hypoxia in vivo inhibits aldosterone synthesis and aldosterone synthase mRNA in the rat. J Appl Physiol 81:604–610[Abstract/Free Full Text]
  31. Raff H, Bruder ED, Jankowski BM, Engeland WC 2000 The effect of fetal hypoxia on adrenocortical function in the 7-day old rat. Endocrine 13:111–116[CrossRef][Medline]
  32. Engeland WC, Wotus C, Rose JC 1998 Ontogeny of innervation of rat and ovine fetal adrenals. Endocrine Res 24:889–898[Medline]
  33. Meuller PJ, O’Hagan KP, Skogg KA, Buckwalter JB, Clifford PS 1998 Renal hemodynamic responses to dynamic exercise in rabbits. J Appl Physiol 85:1605–1614[Abstract/Free Full Text]
  34. Nagaya M, Arai M, Widmaier EP 1995 Ontogeny of immunoreactive and bioactive microsomal steroidogenic enzymes during adrenocortical development in the rat. Mol Cell Endocrinol 114:27–34[CrossRef][Medline]
  35. Papadopoulos V, Amri H, Boujrad N, Cascio C, Culty M, Garnier M, Hardwick M, Li H, Vidic B, Brown AS, Reversa JL, Bernassau JM, Drieu K 1997 Peripheral benzodiazepine receptor in cholesterol transport and steroidogenesis. Steroids 62:21–28[CrossRef][Medline]
  36. Ronen-Fuhrmann T, Timberg R, King SR, Hales KH, Hales DB, Stocco DM, Orly J 1998 Spatio-temporal expression patterns of steroidogenic acute regulatory protein (StAR) during follicular development in the rat ovary. Endocrinology 139:303–315[Abstract/Free Full Text]
  37. Stocco DM, Clark RJ 1996 Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev 17:221–244[Abstract/Free Full Text]
  38. Slotkin TA, Seidler FJ 1988 Adrenomedullary catecholamine release in the fetus and newborn: secretory mechanisms and their role in stress and survival. J Dev Physiol (Oxf) 10:1–16
  39. Jasper MS, Engeland WC 1994 Splanchnic neural activity modulates ultradian and circadian rhythms in adrenocortical secretion in awake rats. Neuroendocrinology 59:97–109[Medline]
  40. Engeland WC, Gann DS 1989 Splanchnic nerve stimulation modulates steroid secretion in hypophysectomized dogs. Neuroendocrinology 50:124–131[Medline]
  41. Artemenko IP, Zhao D, Hales DB, Hales KH, Jefcoate CR 2001 Mitochondrial processing of newly synthesized steroidogenic acute regulatory protein (StAR), but not total StAR, mediates cholesterol transfer to cytochrome P450 side chain cleavage enzyme in adrenal cells. J Biol Chem 276:46583–46596[Abstract/Free Full Text]
  42. Oates JA 1996 Antihypertensive agents and the drug therapy of hypertension. In: Hardman JG, Limbird LE, eds. Goodman and Gilman’s the pharmacological basis of therapeutics. 9th ed, New York: McGraw-Hill; 780–808
  43. Ulrich-Lai YM, Engeland WC 2002 Adrenal splanchnic innervation modulates adrenal cortical responses to dehydration stress in rats. Neuroendocrinology 76:79–92[CrossRef][Medline]
  44. Kleitman N, Holzwarth MA 1985 Compensatory adrenal cortical growth is inhibited by sympathectomy. Am J Physiol Endocrinol Metab 248:E261–E263
  45. Raff H, Bruder ED, Jankowski BM 1999 The effect of hypoxia on plasma leptin and insulin in newborn and juvenile rats. Endocrine 11:37–39[CrossRef][Medline]
  46. Raff H, Bruder ED, Jankowski BM, Colman J 2001 Effect of neonatal hypoxia on leptin, insulin, growth hormone and body composition in the rat. Horm Metab Res 33:151–155[CrossRef][Medline]
  47. Raff H, Bruder ED, Jankowski B, Oaks MK, Colman RJ 2001 Growth hormone therapy during neonatal hypoxia in rats: body composition, bone mineral density, and IGF-1 expression. Endocrine 16:137–141
  48. Raff H 2002 Effect of hypoxia on parathyroid hormone in lactating and neonatal rats: interaction with halothane. Endocrine 17:157–160[CrossRef][Medline]
  49. Raff H 2003 Total and active ghrelin in developing rats during hypoxia. Endocrine 21:159–161[CrossRef][Medline]
  50. Espey LL, Richards JS 2002 Temporal and spatial patterns of ovarian gene transcription following an ovulatory dose of gonadotropin in the rat. Biol Reprod 67:1662–1670[Abstract/Free Full Text]
  51. Ehrhart-Bornstein M, Hinson JP, Bornstein SR, Scherbaum WA, Vinson GP 1998 Intraadrenal interactions in the regulation of adrenocortical steroidogenesis. Endocr Rev 19:101–143[Abstract/Free Full Text]
  52. Yoshimura S, Sakamoto S, Kudo H, Sassa S, Kumai A, Okamoto R 2003 Sex-differences in adrenocortical responsiveness during development in rats. Steroids 68:439–445[CrossRef][Medline]
  53. Tsukahara H, Watanabe Y, Yasutomi M, Kovata R, Tamura S, Kimura K, Hiraoka M, Mayumi M 1999 Early (4–7 d of age) dexamethasone therapy for prevention of chronic lung disease in preterm infants. Biol Neonate 76:283–290[CrossRef][Medline]
  54. Kilian K 2003 Hypertension in neonates: causes and treatments. J Perinat Neonat Nurs 17:65–74[Medline]
  55. Seri I, Evans J 2001 Controversies in the diagnosis and management of hypotension in the newborn infant. Curr Opin Pediatr 13:116–123[CrossRef][Medline]
  56. Guignard JP, Gouyon JB 1988 Adverse effects of drugs on the immature kidney. Perinat Nephrol 53:243–252
  57. Calligaro IL, Burman CA 2001 Pharmacologic considerations in the neonate with congenital heart disease. Clin Perinatol 28:209–222[CrossRef][Medline]
  58. Burchfield DJ 1999 Medication use in neonatal resuscitation. Clin Perinatol 26:683–691[Medline]
  59. Tseng YT, Wadhawan R, Stabila JP, McGonnigal BG, Padbury MD 2002 Molecular interactions between glucocorticoid and catecholamine signaling pathways. J Allergy Clin Immunol 110:S247–254
  60. Raff H, Jacobson L, Cullinan WE 2003 Elevated corticosterone and inhibition of ACTH responses to CRH and ether in the neonatal rat: effect of hypoxia from birth. Am J Physiol Regul Integr Comp Physiol 285:R1224–R1230



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. D. Bruder, J. K. Taylor, K. J. Kamer, and H. Raff
Development of the ACTH and corticosterone response to acute hypoxia in the neonatal rat
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1195 - R1203.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. V Schmidt, C. Liebl, V. Sterlemann, K. Ganea, J. Hartmann, D. Harbich, S. Alam, and M. B Muller
Neuropeptide Y mediates the initial hypothalamic-pituitary-adrenal response to maternal separation in the neonatal mouse
J. Endocrinol., May 1, 2008; 197(2): 421 - 427.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
E. D. Bruder, J. J. Lee, E. P. Widmaier, and H. Raff
Microarray and real-time PCR analysis of adrenal gland gene expression in the 7-day-old rat: effects of hypoxia from birth
Physiol Genomics, April 24, 2007; 29(2): 193 - 200.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
H. Raff and L. Jacobson
Glucocorticoid feedback control of corticotropin in the hypoxic neonatal rat
J. Endocrinol., February 1, 2007; 192(2): 453 - 458.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
E. D Bruder, L. Jacobson, and H. Raff
Plasma leptin and ghrelin in the neonatal rat: interaction of dexamethasone and hypoxia
J. Endocrinol., June 1, 2005; 185(3): 477 - 484.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. E. Mohn, J. Fernandez-Solari, A. De Laurentiis, J. P. Prestifilippo, C. de la Cal, R. Funk, S. R. Bornstein, S. M. McCann, and V. Rettori
The rapid release of corticosterone from the adrenal induced by ACTH is mediated by nitric oxide acting by prostaglandin E2
PNAS, April 26, 2005; 102(17): 6213 - 6218.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. D. Bruder, P. C. Lee, and H. Raff
Metabolomic analysis of adrenal lipids during hypoxia in the neonatal rat: implications in steroidogenesis
Am J Physiol Endocrinol Metab, May 1, 2004; 286(5): E697 - E703.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Raff, H.
Right arrow Articles by Engeland, W. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raff, H.
Right arrow Articles by Engeland, W. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals