help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2004-0180
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/11/4948    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kudo, M.
Right arrow Articles by Ito, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kudo, M.
Right arrow Articles by Ito, S.
Endocrinology Vol. 145, No. 11 4948-4956
Copyright © 2004 by The Endocrine Society

Transcription Suppression of Peroxisome Proliferator-Activated Receptor {gamma}2 Gene Expression by Tumor Necrosis Factor {alpha} via an Inhibition of CCAAT/ Enhancer-binding Protein {delta} during the Early Stage of Adipocyte Differentiation

Masataka Kudo, Akira Sugawara, Akira Uruno, Kazuhisa Takeuchi and Sadayoshi Ito

Division of Nephrology, Endocrinology and Vascular Medicine, Department of Medicine, Tohoku University Graduate School of Medicine, Sendai, 980-8574 Japan

Address all correspondence and requests for reprints to: Akira Sugawara, M.D., Ph.D., Division of Nephrology, Endocrinology, and Vascular Medicine, Tohoku University Graduate School of Medicine, 1-1, Seiryo-cho, Aoba-ku, Sendai, 980-8574 Japan. E-mail: akiras2i{at}mail.tains.tohoku.ac.jp.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TNF{alpha} is known to inhibit adipocyte differentiation and induce insulin resistance. Moreover, TNF{alpha} is known to down-regulate peroxisome proliferator-activated receptor (PPAR){gamma}2, an adipocyte-specific nuclear receptor of insulin-sensitizer thiazolidinediones. To clarify molecular mechanisms of TNF{alpha}- mediated PPAR{gamma}2 down-regulation, we here examined the effect of TNF{alpha} on transcription regulation of PPAR{gamma}2 gene expression during the early stage of adipocyte differentiation. 3T3-L1 preadipocytes (2 d after 100% confluent) were incubated in a differentiation mixture (dexamethasone, insulin, 3-isobutyl-1-methlxanthine), with or without 50 ng/ml TNF{alpha}, for 24 h. TNF{alpha} significantly decreased PPAR{gamma}2 expression both at mRNA and protein levels (to ~40%), as well as aP2 mRNA expression. The mouse PPAR{gamma}2 gene promoter region (2.2-kb) was isolated and was used for luciferase reporter assays by transient transfection. TNF{alpha} significantly suppressed PPAR{gamma}2 gene transcription (to ~50%), and deletion analyses demonstrated that the suppression was mediated via CCAAT/enhancer-binding protein (C/EBP) binding elements at the –320/–340 region of the promoter. Moreover, TNF{alpha} significantly decreased expression of C/EBP{delta} mRNA and protein levels (to ~40%). EMSA, using 3T3-L1 cells nuclear extracts with the –320/–340 region as a probe, demonstrated the binding of C/EBP{delta} to the element, which was significantly decreased by TNF{alpha} treatment. Overexpression of CEBP/{delta} prevented the TNF{alpha}-mediated suppression of PPAR{gamma}2 transactivation. Taken together, TNF{alpha} suppresses PPAR{gamma}2 gene transcription by the inhibition of C/EBP{delta} expression and its DNA binding during the early stage of adipocyte differentiation, which may contribute to the inhibition of adipocyte differentiation, as well as the induction of insulin resistance.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
TUMOR NECROSIS FACTOR {alpha}, an adipocyte-derived cytokine, is well known to inhibit adipocyte differentiation (1, 2) and induce insulin resistance via several mechanisms, including insulin signaling modification (3, 4, 5, 6), which may contribute to the progression of hypertension and cardiovascular events (7, 8, 9). In contrast to TNF{alpha}, antidiabetic thiazolidinediones, which function as ligands of nuclear peroxisome proliferator-activated receptor (PPAR) {gamma} (10), have recently been known to improve insulin sensitivity (11). Among PPAR{gamma} isoforms ({gamma}1 and {gamma}2), PPAR{gamma}2 is adipocyte-specific and plays a dominant role in adipocyte differentiation (12). During adipocyte differentiation, both PPAR{gamma}2 and CCAAT/enhancer-binding proteins (C/EBPs) function as key factors in the complex of transcriptional cascade by their subsequent transactivation of adipocyte-specific genes (13, 14). Genetic analyses of human PPAR{gamma}2 polymorphism have demonstrated an association between PPAR{gamma}2 and insulin sensitivity (15, 16).

Recently, expression of PPAR{gamma}2 in mature adipocytes has been demonstrated to be down-regulated by TNF{alpha} treatment (17, 18). Because PPAR{gamma}2 ligand thiazolidinediones have also been reported to decrease plasma TNF{alpha} levels (19, 20) as well as to inhibit TNF{alpha} actions (21, 22), PPAR{gamma}2 and TNF{alpha} may functionally antagonize each other. However, the molecular mechanisms by which TNF{alpha} down-regulates PPAR{gamma}2 expression, especially in terms of gene transcription regulation, remain unclear. Moreover, little is known regarding the effects of TNF{alpha} on PPAR{gamma}2 expression during the early stage of adipocyte differentiation, which may be important to understand the onset of adipocyte differentiation as well as insulin resistance. We therefore isolated mouse PPAR{gamma}2 (mPPAR{gamma}2) gene promoter region (2.2-kb) further upstream of the previously isolated clone (615-bp) (23) and examined the effects of TNF{alpha} on PPAR{gamma}2 gene transcription regulation during the early stage of adipocyte differentiation using 3T3-L1 cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
Luciferase Assay Systems and pGL3-Basic Vector were purchased from Promega (Madison, WI). Recombinant human TNF{alpha} was purchased from Genzyme TECHNE (Minneapolis, MN). Insulin, 3-isobutyl-1-methlxanthine, and dexamethasone were purchased from Sigma-Aldrich (St. Louis, MO). FuGENE 6 Transfection Reagent was purchased from Roche Applied Science (Indianapolis, IN). [{alpha}-32P] Deoxycytidine triphosphate (6000 Ci/mmol) was obtained from Amersham Biosciences (Piscataway, NJ). Total RNA was prepared from 3T3-L1 using TRIzol reagent (Life Technologies, Rockville, MD).

Cell culture
3T3-L1 preadipocytes (24) (purchased from ATCC, Manassas, VA) were grown in DMEM with 10% calf serum. Two days after 100% confluent, the cells were replaced with the differentiation mixture (DMEM with 10% fetal bovine serum plus 0.5 mM 3-isobutyl-1-methlxanthine, 1 µM dexamethasone, and 10 µg/ml insulin) (25) for 24 h with or without TNF{alpha} (50 ng/ml). In some experiments, the 3T3-L1 cells (2 d after 100% confluent) were grown in DMEM with 10% calf serum alone for 24 h instead of the differentiation mixture.

Cloning of the promoter region of the mPPAR{gamma}2 gene
The promoter region of the PPAR{gamma}2 gene that was cloned by PCR using GenomeWalker kits (Clontech, Palo Alto, CA) as described previously (26). Briefly, the first PCR was conducted with a combination of adaptor primer 1 (provided in the kit) and mPPAR{gamma}2 5'-untranslated region (UTR) primer 1 (5'-CAGCATAAAACAGAGATTTGCTG-3') (23) using mouse genomic libraries from ICR Swiss mice provided in the kit as a template. Nested PCR was then carried out with a combination of adaptor primer 2 (provided in the kit) and mPPAR{gamma}2 5'-UTR primer 2 (5'-CACTGGTGTTTTGTCTATGTCTTGC-3') using the first PCR product (produced from EcoRV library) as a template. The 2.2-kb PCR product was subcloned into the pCR2.1-TOPO TA vector using TOPO TA cloning kit (Invitrogen, Carlsbad, CA), and the plasmid was termed as pTOPO-5'-flanking region (FL)-mPPAR-{gamma}2. The sequencing analysis of the insert was performed in both directions by the PCR cycle sequence method with an automatic sequence analyzer (ABI PRISM 310 Genetic Analyzer; Applied Biosystems, Foster City, CA). The GenBank accession number of the isolated clone is AY339883.

Plasmids
Newly subcloned chimeric constructs containing mPPAR{gamma}2 gene promoter and luciferase cDNA were used for transient transfection studies: –2232/+17-luc (2232-bp 5'-FL and 17-bp 5'-UTR of mPPAR{gamma}2 gene); –1115/+17-luc (1115-bp 5'-FL and 17-bp 5'-UTR); –615/+17-luc (615-bp 5'-FL and 17-bp 5'-UTR); –527/+17-luc (527-bp 5'-FL and 17-bp 5'-UTR); –357/+17-luc (357-bp 5'-FL and 17-bp 5'-UTR); –320/+17-luc (320-bp 5'-FL and 17-bp 5'-UTR); –239/+17-luc (239-bp 5'-FL and 17-bp 5'-UTR); –201/+17-luc (201-bp 5'-FL and 17-bp 5'-UTR); –67/+17-luc (67-bp 5'-FL and 17-bp 5'-UTR); and their control plasmid pGL3-Basic. Distal mut (mutated) –357/+17-luc [–357/+17 of mPPAR{gamma}2 gene whose C/EBP binding site at the –340/–336 region (23) was mutated from ATTTTACTGCAATTTTAA to ATTTTACTGCGGTTTTAA; mutated sites are underlined] and proximal mut –357/+17-luc (–357/+17 of mPPAR{gamma}2 gene whose C/EBP binding site at the –327/–323 region was mutated from AAAAAGCAATCAATATTG to AAAAAGCGGTCAATATTG; mutated sites are underlined) were generated using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). ß-galactosidase control plasmid in pCMV was purchased from Clontech.

RNA preparation/Northern blot analyses/RT-PCR
Two days after 3T3-L1 cells became 100% confluent, the cells were replaced with the differentiation mixture and were incubated for 24 h with or without TNF{alpha} (50 ng/ml). In some experiments, the cells were incubated in the absence of the differentiation mixture for 24 h. Their total RNA was then extracted using TRIzol reagent (Life Technologies). For Northern blot analyses, 10 µg of isolated total RNA was subjected to electrophoresis in 1% agarose-formaldehyde gels and transferred to nylon membrane (Hybond-N; Amersham Biosciences), and the blot was hybridized with 32P-labeled C/EBP probes ({alpha}, ß, and {delta}) as described previously (27). All values were normalized to the densities of ß-actin mRNA level (26). For the determination of mPPAR{gamma}2 mRNA expression, we have performed semiquantitative RT-PCR using isoform-specific primers to distinguish PPAR{gamma}2 mRNA from PPAR{gamma}1 mRNA, because the mPPAR{gamma}2 cDNA encodes an additional 30 amino acids N terminal to the first ATG codon of PPAR{gamma}1 (23), and it is therefore difficult to distinguish them by Northern blot analyses (17). Semiquantitative RT-PCR was performed with the One Step RNA PCR kit (Takara Bio, Kyoto, Japan) with a forward primer (5'-GGTGAAACTCTGGGAGATTC-3') and a reverse primer (5'-CAACCATTGGGTCAGCTCTTG –3') for amplifying mPPAR{gamma}2 mRNA (28), or with a forward primer (5'-AACACCGAGATTTCCTTCAA-3') and a reverse primer (5'-TCACGCCTTTCATAACACAT-3') for amplifying mouse fatty acid binding protein (aP2) gene (29). Constitutively expressed mouse ß-actin mRNA was also amplified with a forward primer (5'-GGGAAATCGTGCGTGACAT-3') and a reverse primer (5'-CAGGAGGAGCAATGATCTT-3') (30). RT-PCR was performed under the following conditions: 50 C for 30 min and 94 C for 2 min for reverse transcription, 94 C for 30 sec; 60 C for 30 sec; 72 C for 1 min for 30 cycles. Under these conditions, a linear correlation between the densitometric intensity units of the PCR product and amounts of template was confirmed. mPPAR{gamma}2 mRNA expression was determined by a ratio between the densitometric intensity units of the PCR products from mPPAR{gamma}2 and ß-actin mRNAs on an ethidium bromide-stained 1.5% agarose gel. Densitometric intensities of the PCR products were determined using a computerized analysis system (Luminous Imager 2.0; Aisin Cosmos R&D, Kariya, Japan). For determination of mPPAR{gamma}2 mRNA stability, 3T3-L1 cells incubated in the differentiation mixture either with or without TNF{alpha} (50 ng/ml) for 24 h were coincubated with 5 µg/ml actinomycin D (Nacalai Tesque, Osaka, Japan) for an additional 2 or 4 h before harvesting.

Western blot analyses
Nuclear extracts were prepared from 3T3-L1 cells incubated in the differentiation mixture, either with or without TNF{alpha} (50 ng/ml) for 24 h, as described previously (31). Protein concentration was measured by Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA). Western blot analyses were performed as previously described (31). Briefly, 10 µg of the nuclear extracts (for both PPAR{gamma}2 and C/EBPs proteins) were subjected to SDS-PAGE (9% acrylamide gel), and the proteins were transferred to polyvinylidene difluoride (Bio-Rad Laboratories). The blots were then incubated either with an isoform-specific anti-mPPAR{gamma}2 antibody that we generated (32, 33), anti-C/EBP{alpha} antibody (14AA X; Santa Cruz Biotechnology, Santa Cruz, CA), anti-C/EBPß antibody (C-19 X; Santa Cruz Biotechnology), or anti-C/EBP{delta} antibody (M-17 X; Santa Cruz Biotechnology) diluted at 1:500 for 1 h at room temperature. The isoform-specificity of the anti-mPPAR{gamma}2 antibody was previously confirmed by Western blot analyses using in vitro translated PPAR{gamma}1 and PPAR{gamma}2 (32, 33). The blots were subsequently incubated with horseradish peroxidase-linked donkey antirabbit Ig (Amersham Biosciences) diluted at 1:1000 for 1 h at room temperature, and were detected using ECL detection reagents (Amersham Biosciences). For normalization of PPAR{gamma}2 and C/EBPs proteins expression, blots loaded with 10 µg cytosolic proteins that were simultaneously obtained during preparation of the nuclear extracts (31) were incubated with monoclonal anti-ß-tubulin 1 antibody (mouse ascites fluid, Clone SAP.4G5; Sigma-Aldrich) diluted at 1:3000, and were subsequently incubated with horseradish peroxidase-linked sheep antimouse IgG (Amersham Biosciences) diluted at 1:3000.

Luciferase reporter gene assay
Two days after 3T3-L1 cells became 100% confluent, the cells were replaced with the same fresh media (DMEM with 10% calf serum) and were incubated for 5–6 h. Then the transfection using FuGENE 6 transfection reagent was performed at a lipid/DNA ratio of 3:1 according to the manufacturer’s instructions. Briefly, 1.2 µg reporter plasmid and 0.8 µg ß-galactosidase control plasmid in pCMV were transfected per 3.5-cm plate. Twelve hours after the transfection, the cells were replaced with the differentiation mixture. The cells were then incubated either with or without TNF{alpha} (50 ng/ml) for 24 h. For studying the promoter activity in undifferentiated 3T3-L1 cells, the cells were replaced with the fresh media (DMEM with 10% calf serum) 12 h after the transfection and were incubated for an additional 24 h. After harvesting, the cell extracts were analyzed for both luciferase and ß-galactosidase activities as previously described (34). Transfection efficiency was normalized by the ß-galactosidase expression. In an experiment, 0.1 µg expression plasmid containing C/EBP{delta} cDNA in pEF-BOS (27) (kindly provided by Dr. M. Takiguchi, Chiba University, Chiba, Japan) or its control plasmid pEF-BOS was cotransfected with –2232/+17-luc into 3T3-L1 cells, and the cells were incubated either with or without TNF{alpha} (50 ng/ml) for 24 h.

EMSA
Nuclear extracts were prepared from 3T3-L1 cells incubated in the differentiation mixture either with or without TNF{alpha} (50 ng/ml) for 24 h as described above. EMSA using 3T3-L1 nuclear extracts was performed as described previously (34). Briefly, 32P-labeled double-stranded oligonucleotides containing C/EBP binding sites (23) (–340/–308 region; GTATTTTACTGCAATTTTAAAAAGCAATCAATATTGAACAATC; C/EBP binding sites are underlined) were incubated with 0.4 µg 3T3-L1 nuclear extracts for 30 min at room temperature and were subjected to electrophoresis on 4% polyacrylamide gels. For competition experiment, 100-fold excess of unlabeled oligonucleotides for the –340/–308 region was coincubated.

Antibody supershift experiments
After 30 min incubation of 3T-3L1 nuclear extracts (0.4 µg) with the –340/–308 region probe, further incubation, either with 1 µl of polyclonal anti-C/EBP{delta} antibody (C-22 X, Santa Cruz Biotechnology) or nonimmune rabbit serum at 4 C for 2 h, was performed before electrophoresis as previously described (34).

Statistical analyses
Statistical significance was calculated by one-factor ANOVA using StatView 4.0 (ABACUS Concepts, Piscataway, NJ). ANOVA was adopted to compare means among groups. The value for P < 0.01 was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effects of TNF{alpha} on PPRA{gamma}2 mRNA/protein and aP2 mRNA expression
Effects of TNF{alpha} on PPAR{gamma}2 mRNA/protein expression in 3T3-L1 cells during the early stage of adipocyte differentiation were examined. As shown in Fig. 1AGo, semiquantitative RT-PCR demonstrated a decrease of PPAR{gamma}2 mRNA expression, to 40%, by 50 ng/ml TNF{alpha} treatment for 24 h. Western blot analyses also demonstrated a decrease of PPAR{gamma}2 protein expression to 40% by TNF{alpha} treatment (Fig. 1BGo). These data indicate that TNF{alpha} suppresses the expression of PPRA{gamma}2 mRNA and protein during the early stage of adipocyte differentiation, as well as previously observed in fully differentiated adiposities (17, 18). To examine whether the effect of TNF{alpha} on PPAR{gamma}2 mRNA decrease was due to the decrease of PPAR{gamma}2 mRNA stability, we next treated the cells with 5 µg/ml actinomycin D. As shown in Fig. 1CGo, PPAR{gamma}2 mRNA equally degraded either in the absence or presence of TNF{alpha}. These results suggest that TNF{alpha} does not affect PPAR{gamma}2 mRNA stability.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 1. Effects of TNF{alpha} on PPRA{gamma}2 mRNA/protein expression during the early stage of adipocyte differentiation. A, Effects of TNF{alpha} on PPRA{gamma}2 mRNA expression demonstrated by RT-PCR. 3T3-L1 cells were incubated in the differentiation mixture either with (50 TNF{alpha}) or without (0 TNF{alpha}) for 24 h. Upper, Representative gels for PPAR{gamma}2 and ß-actin mRNAs. Bar graphs represent mean ± SE (%) of PPAR{gamma}2 mRNA expression levels normalized by ß-actin mRNA expression levels (without TNF{alpha} as 100%) (n = 6). *, P < 0.01, as compared with the control value (0). B, Effects of TNF{alpha} on PPRA{gamma}2 protein expression demonstrated by Western blot analyses. 3T3-L1 cells were incubated in the differentiation mixture either with (50) or without (0) TNF{alpha} for 24 h. Upper, Representative blot for PPAR{gamma}2 and ß-tubulin proteins. Anti-PPAR{gamma}2 antibody detected PPAR{gamma}2 protein at the expected molecular mass (60 kDa, indicated by an arrow). Bar graphs represent mean ± SE (%) of PPAR{gamma}2 protein expression levels normalized by ß-tubulin protein expression levels (without TNF{alpha} as 100%) (n = 4). *, P < 0.01, as compared with the control value (0). C, Effect of TNF{alpha} on PPRA{gamma}2 mRNA stability. 3T3-L1 cells were incubated in the differentiation mixture either with (filled square) or without (open square) TNF{alpha} for 24 h. Actinomycin D (5 µg/ml) was then added, and the cells were incubated for an additional 2 or 4 h. Extracted RNAs were then processed to RT-PCR. The horizontal line represents mean ± SE (%) of PPRA{gamma}2 mRNA expression levels normalized by ß-actin mRNA expression levels (time 0 as 100%) (n = 6).

 
We next examined the effects of the differentiation mixture and TNF{alpha} on the expression of aP2, which is well known as a marker of adipocyte differentiation (17, 18). As shown in Fig. 2Go, little expression of aP2 was observed in 3T3-L1 cells in the absence of the differentiation mixture (lane 1), indicating that the cells were undifferentiated. When the cells were incubated in the presence of the differentiation mixture for 24 h, aP2 expression dramatically increased (lane 2), suggesting the onset of adipocyte differentiation. However, when the cells were incubated in the differentiation mixture with TNF{alpha} for 24 h, aP2 expression significantly decreased (lane 3). These data indicate that TNF{alpha} suppresses the onset of adipocyte differentiation.



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 2. Effects of TNF{alpha} on aP2 mRNA expression. Effects of TNF{alpha} on aP2 mRNA expression demonstrated by RT-PCR. 3T3-L1 cells were incubated in the absence of the differentiation mixture (lane 1) (ND), or in the presence of the differentiation mixture either with (lane 3) (D+ TNF{alpha}) or without (lane 2) (D) TNF{alpha} for 24 h. Indicated are representative gels for aP2 (upper) and ß-actin (lower) mRNAs.

 
Structure of mPPAR{gamma}2 gene promoter
To examine the promoter activity of PPAR{gamma}2, we isolated mPPAR{gamma}2 gene promoter region up to –2232-bp of its transcription start site (GenBank accession no. AY339883), further upstream of the previously isolated clone (up to –615 bp) (23). Several putative cis-elements, including E-box (35), sterol regulatory element-like motif (35), and CCAAT-box (36, 37) were observed in the sequence. The position between –323 and –340 was previously confirmed as a tandem repeat of C/EBP binding sites (23, 38). The sequence of the clone was analyzed using NCBI Map Viewer (Mus musculus genome view), and was matched to the region 116,200–116,205K on chromosome 6.

Effects of TNF{alpha} on PPRA{gamma}2 gene promoter activity
We next studied the effects of TNF{alpha} on mPPAR{gamma}2 gene promoter activity during the early stage of adipocyte differentiation. When 3T3-L1 preadipocytes were transfected, and were incubated in the absence of the differentiation mixture for 24 h, transcription activity of full-length –2232/+17-luc was almost identical with that of control plasmid pGL3-Basic (Fig. 3AGo, lines 1 and 2), indicating that PPAR{gamma}2 gene promoter has no activity in undifferentiated 3T3-L1 cells. However, when the transfected cells were incubated in the presence of the differential mixture for 24 h, transcription activity of –2232/+17-luc significantly increased, compared with that of pGL3-Basic (Fig. 3BGo, lines 1 and 2). Moreover, coincubation of TNF{alpha} for 24 h significantly suppressed the transcription activity of –2232/+17-luc (Fig. 3BGo, lines 2 and 3). These data suggest that the transcription activity of PPAR{gamma}2 gene promoter is increased according to the induction of adipocyte differentiation, and the decrease of PPAR{gamma}2 expression by TNF{alpha} is mediated at the gene transcription level.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 3. Effects of adipocyte differentiation and TNF{alpha} on PPRA{gamma}2 promoter activity. A, PPRA{gamma}2 promoter activity in undifferentiated 3T3-L1 cells. 3T3-L1 cells were transfected either with pGL3-Basic (line 1) or –2232/+17-luc (line 2). The cells were incubated in the absence of the differentiation mixture for 24 h. Bar graphs represent mean ± SE (%) of luciferase activity (line 1 as 100%) (n = 6). B, Effects of adipocyte differentiation and TNF{alpha} on PPRA{gamma}2 promoter activity. 3T3-L1 cells were transfected either with pGL3-Basic (line 1) or –2232/+17-luc (lines 2 and 3). The cells were incubated in the presence of the differentiation mixture either with (line 3) or without (lines 1 and 2) TNF{alpha} for 24 h. Bar graphs represent mean ± SE (%) of luciferase activity (line 1 as 100%) (n = 6). *, P < 0.01, compared with line 1; **, P < 0.01, compared with line 2.

 
Localization of the element(s) responsible for the transcription suppression by TNF-{alpha}
We next examined the element(s) responsible for the TNF{alpha}-mediated transcription suppression in mPPAR{gamma}2 gene promoter. As shown in Fig. 4Go, TNF{alpha}-mediated transcription suppression was observed in –2232/+17-luc, –1115/+17-luc, –615/+17-luc, –527/+17-luc, and –357/+17-luc, but not in –320/+17-luc, –239/+17-luc, –201/+17-luc, and –67/+17-luc. In addition, TNF{alpha} did not affect transcription activity of pGL3-Basic (Fig. 4Go, lines 19 and 20). The relative luciferase activities of –320/+17-luc (line 11), –239/+17-luc (line 13), and –201/+17-luc (line 15) in the absence of TNF{alpha} were not significantly different from the relative luciferase activity of –527/+17-luc in the presence of TNF{alpha} (line 8), indicating that the TNF{alpha} effect is identical with the deletion of the C/EBP binding sites. Because the relative luciferase activity of pGL3-Basic was significantly smaller than that of –67/+17-luc (Fig. 4Go, lines 17 and 19), the lack of TNF{alpha} effects in constructs shorter than –320/+17-luc should not be due to their small luciferase activity. These data suggest that the element between –357 and –320 may be responsible for the suppression. Because the element is composed of a tandem repeat of C/EBP binding sites located between –323 and –340 (23), we next investigated the involvement of the sites in the transcription suppression. As shown in Fig. 5Go, the TNF{alpha}-mediated transcription suppression observed in –357/+17-luc was abrogated when either upstream C/EBP binding site (distal mut –357/+17-luc) or downstream C/EBP binding site (proximal mut –357/+17-luc) was disrupted. There exists no significance between the relative luciferase activity of –357/+17-luc in the presence of TNF{alpha} (line 2) and the luciferase activity of either distal mut –357/+17-luc (line 3) and proximal mut –357/+17-luc (line 5) in the absence of TNF{alpha}, indicating that the TNF{alpha} effect is almost identical with the disruption of the half site of the C/EBP binding sites. These data indicate that the tandem repeat of C/EBP binding sites is necessary for the TNF{alpha}-mediated transcription suppression during the early stage of adipocyte differentiation.



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 4. Localization of the element(s) responsible for the transcription suppression by TNF-{alpha}. 3T3-L1 cells were transfected either with –2232/+17-luc (lines 1 and 2), –1115/+17-luc (lines 3 and 4), –615/+17-luc (lines 5 and 6), –527/+17-luc (lines 7 and 8), –357/+17-luc (lines 9 and 10), –320/+17-luc (lines 11 and 12), –239/+17-luc (lines 13 and 14), –201/+17-luc (lines 15 and 16), –67/+17-luc (lines 17 and 18), or pGL3-Basic (lines 19 and 20). The cells were incubated in the differentiation mixture either with or without TNF{alpha} for 24 h. Bar graphs represent mean ± SE (%) of luciferase activity [the activity of –2232/+17-luc without TNF{alpha} (line 1) as 100%] (n = 6). *, P < 0.01, compared with line 1; **, P < 0.01, compared with line 3; #, P < 0.01, compared with line 5; ##, P < 0.01, compared with line 7; §, P < 0.01, compared with line 9; §§, P < 0.01, compared with line 17. A tandem repeat of C/EBP binding sites located between –323 and –340 is indicated as boxes filled with oblique lines, and 5'-UTR is indicated by shaded areas.

 


View larger version (15K):
[in this window]
[in a new window]
  		FIG. 5. Involvement of the C/EBP binding sites in the transcription suppression by TNF-{alpha}. 3T3-L1 cells were transfected either with –357/+17 luc (lines 1 and 2), distal mut –357/+17-luc (lines 3 and 4), or proximal mut –357/+17-luc (lines 5 and 6). The cells were incubated in the differentiation mixture either with or without TNF{alpha} for 24 h. Bar graphs represent mean ± SE (%) of luciferase activity [the activity of –357/+17-luc without TNF{alpha} (line 1) as 100%] (n = 6). §, P < 0.01, compared with line 1. A tandem repeat of C/EBP binding sites composed of GCAAT located between –323 and –340 is indicated as boxes filled with oblique lines, and mutated nucleotides are indicated by small characters with asterisks. 5'-UTR is indicated by shaded areas.

 
Down-regulation of C/EBP{delta} expression by TNF-{alpha}
Because C/EBPs are reported to activate mPPAR{gamma}2 gene promoter through the C/EBP binding sites between –323 and –340 (38, 39, 40), we next examined the effects of TNF{alpha} on C/EBPs expression during the early stage of adipocyte differentiation. As shown in Fig. 6AGo, Northern blot analyses demonstrated that TNF{alpha} treatment significantly decreased C/EBP{delta} mRNA expression level during the early stage of adipocyte differentiation. C/EBP{delta} protein expression level was also decreased by TNF{alpha} treatment by Western blot analyses (Fig. 6BGo). TNF{alpha} treatment did not affect the expression of C/EBPß both at mRNA and protein levels (Fig. 6Go, A and B). Consistent with the previous observations describing that C/EBP{alpha} was not expressed during the early stage of adipocyte differentiation (13, 41), C/EBP{alpha} could not be detected both at mRNA and protein levels (Fig. 6Go, A and B). These data indicate that TNF{alpha} suppresses C/EBP{delta} expression during the early stage of adipocyte differentiation, which may be related to the TNF{alpha}-mediated transcription suppression of mPPAR{gamma}2 gene promoter.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 6. Effects of TNF{alpha} on C/EBP{delta} mRNA/protein expression during the early stage of adipocyte differentiation. A, Effects of TNF{alpha} on C/EBPs mRNAs expression demonstrated by Northern blot analyses. 3T3-L1 cells were incubated in the differentiation mixture either with (50) or without (0) TNF{alpha} for 24 h. Indicated are representative blots for C/EBP{delta} (upper), C/EBP{alpha}, C/EBPß, and ß-actin (lower) mRNAs. Bar graphs represent mean ± SE (%) of C/EBP{delta} (left) or C/EBPß (right) mRNA expression levels normalized by ß-actin mRNA expression levels (without TNF{alpha} as 100%) (n = 6). *, P < 0.01, as compared with the control value (0). B, Effects of TNF{alpha} on C/EBPs proteins expression demonstrated by Western blot analyses. 3T3-L1 cells were incubated in the differentiation mixture either with (50) or without (0) TNF{alpha} for 24 h. Indicated is a representative blot for C/EBP{delta} (upper), C/EBP{alpha}, C/EBPß, and ß-tubulin (lower) proteins. Anti-C/EBP{delta} antibody detected C/EBP{delta} protein at the expected molecular mass (33 kDa, indicated by an arrow), and anti-C/EBPß antibody detected C/EBPß protein at the expected molecular mass (40 and 35 kDa, indicated by arrows). Bar graphs represent mean ± SE (%) of C/EBP{delta} (left) or C/EBPß (right) protein expression levels normalized by ß-tubulin protein expression levels (without TNF{alpha} as 100%) (n = 4). *, P < 0.01, as compared with the control value (0).

 
Inhibition of C/EBP{delta}-DNA complex formation by TNF-{alpha}
We next examined the protein-DNA interaction on the C/EBP binding sites between –323 and –340 of mPPAR{gamma}2 gene promoter by EMSA. When 32P-labeled oligonucleotides (–340/–308) containing the C/EBP binding sites were incubated with nuclear extracts prepared from 3T3-L1 cells incubated in the differentiation mixture for 24 h, formation of a protein-DNA complex was observed (Fig. 7AGo, lane 2). The protein-DNA complex is specific to the C/EBP binding sites, because coincubation with 100-fold excess of unlabeled oligonucleotides (–340/–308) completely abrogated its formation (Fig. 7AGo, lane 4). When nuclear extracts prepared from 3T3-L1 cells incubated in the differentiation mixture for 24 h with TNF{alpha} were used, the protein-DNA complex was decreased to 64% (Fig. 7AGo, lane 3). Moreover, incubation with anti-C/EBP{delta} antibody significantly inhibited formation of the protein-DNA complex (Fig. 7BGo, lanes 1–3). Because C/EBPß has been reported not to bind to the C/EBP binding sites (39), the protein-DNA complex is most likely composed of C/EBP{delta}. These data indicate that TNF{alpha} decreases C/EBP{delta}-DNA complex formation on the C/EBP binding sites during the early stage of adipocyte differentiation, most likely due to the TNF{alpha}-mediated decrease of C/EBP{delta} expression.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 7. Effects of TNF{alpha} on C/EBP{delta}-DNA complex formation. A, Effects of TNF{alpha} on the protein-DNA complex formation. 32P-labeled oligonucleotides (–340/–308) containing the C/EBP binding sites were incubated with nuclear extracts prepared from 3T3-L1 cells incubated in the differentiation mixture for 24 h (3T3-L1 NE) with (lane 3) or without (lanes 1, 2, and 4) TNF{alpha}. A protein-DNA complex is indicated by an arrow. In lane 4, 100-fold excess of unlabeled oligonucleotides (–340/–308) (Competitor) were coincubated. B, Involvement of C/EBP{delta} in the protein-DNA complex. 32P-labeled oligonucleotides (–340/–308) containing the C/EBP binding sites were incubated with nuclear extracts prepared from 3T3-L1 cells incubated in the differentiation mixture for 24 h (3T3-L1 NE) and were sequentially incubated either without (lane 1) or with (lane 2) 1 µl nonimmune rabbit serum or anti-C/EBP{delta} antibody (lane 3). The protein-DNA complex is indicated by an arrow).

 
Effects of C/EBP{delta} overexpression on the TNF{alpha}-mediated transcription suppression
We next examined the effects of C/EBP{delta} overexpression on the TNF{alpha}-mediated transcription suppression. As shown in Fig. 8Go, TNF{alpha}-mediated transcription suppression of mPPAR{gamma}2 gene promoter (lines 1 and 2) was abrogated by the overexpression of C/EBP{delta} (line 3). These data suggest that the decrease of endogenous C/EBP{delta} expression may contribute to the TNF{alpha}-mediated transcription suppression.



View larger version (10K):
[in this window]
[in a new window]
  		FIG. 8. Effects of C/EBP{delta} overexpression on the TNF{alpha}-mediated transcription suppression. 3T3-L1 cells transfected with –2232/+17-luc were cotransfected either with 0.1 µg expression plasmid containing C/EBP{delta} cDNA in pEF-BOS (line 3) or its control plasmid pEF-BOS (lines 1 and 2) and were incubated either with (lines 2 and 3) or without (line 1) TNF{alpha} for 24 h. Bar graphs represent mean ± SE (%) of luciferase activity [the activity of –2232/+17-luc without TNF{alpha} (line 1) as 100%] (n = 6). *, P < 0.01, compared with line 1; **, P < 0.01, compared with line 2.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In the present study, we have first demonstrated the TNF{alpha}-mediated PPAR{gamma}2 expression suppression during the early stage of adipocyte differentiation. Because TNF{alpha} has previously been demonstrated to suppress PPAR{gamma}2 expression in mature adipocytes (17, 18), TNF{alpha} may therefore be able to suppress PPAR{gamma}2 expression both during and after adipocyte differentiation. During the process of adipogenesis, C/EBPß and C/EBP{delta} are induced immediately within 24 h after the differentiation stimuli (13, 41), and they synergistically induce PPAR{gamma} expression (14, 42). Among PPAR{gamma} isoforms ({gamma}1 and {gamma}2), PPAR{gamma}2 has been recognized to play a dominant role in adipocyte differentiation (12). Moreover, in contrast to PPAR{gamma}1, whose expression is induced later than 24 h, PPAR{gamma}2 expression is induced within 24 h after the differentiation stimuli in 3T3-L1 cells (25). Recently, selective disruption of PPAR{gamma}2 has been demonstrated to impair adipose tissue development (43). Because we have also demonstrated the suppression of aP2 expression by TNF{alpha} during the early stage of adipocyte differentiation, the TNF{alpha}-mediated PPAR{gamma}2 suppression may contribute to the inhibition of the onset of adipocyte differentiation.

Consistent with the previous observation indicating a rapid induction of PPAR{gamma}2 mRNA expression within 24 h after the differentiation stimuli (25), the isolated mPPAR{gamma}2 gene promoter region (2.2-kb) demonstrated a significant induction of its transcription activity by 24 h incubation in the differentiation mixture. These data suggest that the promoter region is actually activated during the early stage of adipocyte differentiation. Because coincubation with TNF{alpha} inhibited the induction of PPAR{gamma}2 gene promoter activity, TNF{alpha} may suppress PPAR{gamma}2 expression at the gene transcription level. Deletion/mutation analyses of the promoter region indicated the involvement of a tandem repeat of C/EBP binding sites located between –323 and –340 (23), which could be bound by C/EBP{alpha} and C/EBP{delta} but not by C/EBPß (39). Moreover, C/EBP{delta} induced by dexamethasone could transactivate PPAR{gamma}2 gene promoter via the sites during adipocyte differentiation (38). Because C/EBP{alpha} expression was induced later than 30 h after the differentiation stimuli (13, 41), C/EBP{delta} might be the sole factor for the C/EBP binding sites during the early stage of adipocyte differentiation. The notion was also confirmed by our EMSA demonstrating the dominant binding of endogenous C/EBP{delta} to the sites. Although TNF{alpha} has been known to suppress C/EBP{alpha} expression (44), its effect on C/EBP{delta} expression has not yet been reported. We here have first demonstrated the TNF{alpha}-mediated down-regulation of C/EBP{delta} expression during the early stage of adipocyte differentiation.

The mechanisms by which TNF{alpha} decreases C/EBP{delta} expression remain unclear. Recently, C/EBP{delta} expression in preadipocytes has been reported to be up-regulated by cAMP-response element-binding protein (CREB), through its binding to the cAMP-response element in C/EBP{delta} gene promoter (45). Moreover, cytokines including TNF{alpha} have recently been reported to decrease CREB activity by inhibition of its phosphorylation (46). It is therefore speculated that TNF{alpha} down-regulates C/EBP{delta} expression through the inhibition of CREB activity. Consistent with the decrease of C/EBP{delta} expression, TNF{alpha}-mediated inhibition of C/EBP{delta}-DNA complex formation was also demonstrated by our EMSA. Taken together, TNF{alpha} may suppress PPAR{gamma}2 gene transcription by the inhibition of C/EBP{delta} expression and its binding to the C/EBP binding sites of PPAR{gamma}2 gene promoter during the early stage of adipocyte differentiation.

TNF{alpha} has been recognized as a key molecule in inducing insulin resistance via several mechanisms, including the inhibition of insulin receptor signaling through the modulation of insulin receptor substrate 1 (3, 4, 5, 6). TNF{alpha} is also reported to suppress GLUT4 expression (44), which subsequently inhibits insulin-stimulated glucose uptake. Moreover, a strong inverse correlation between TNF{alpha} secretion and insulin-stimulated glucose uptake has been reported in human adipose tissue (47). Recently, TNF{alpha} was also demonstrated to suppress ligand-induced transactivation of PPAR{gamma} (48), indicating that TNF{alpha} inhibits PPAR{gamma} both at its function level and its expression level. Further studies are needed to define the roles of TNF{alpha} and PPAR{gamma}2 in the regulation of insulin resistance/sensitivity.

In summary, we have demonstrated the effects of TNF{alpha} on the transcription suppression of PPAR{gamma}2 gene mediated by the inhibition of C/EBP{delta} expression and its DNA binding during the early stage of adipocyte differentiation. The TNF{alpha} effects on the down-regulation of C/EBP{delta} and PPAR{gamma}2 during the early stage of adipocyte differentiation may contribute to the inhibition of adipocyte differentiation as well as the induction of insulin resistance.


   Footnotes
 
This work was supported, in part, by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology, Japan (no. 14571058 to A.S., no. 14370314 to K.T., and no. 15390264 to S.I.).

Abbreviations: C/EBP, CCAAT/enhancer-binding protein; CREB, cAMP-response element-binding protein; FL, flanking region; mPPAR, mouse PPAR; mut, mutated; PPAR, peroxisome proliferator-activated receptor; UTR, untranslated region.

Received February 11, 2004.

Accepted for publication July 20, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Petruschke T, Hauner H 1993 Tumor necrosis factor-{alpha} prevents the differentiation of human adipocyte precursor cells and causes delipidation of newly developed fat cells. J Clin Endocrinol Metab 76:742–747[Abstract]
  2. Xing H, Northrop JP, Grove JR, Kilpatrick KE, Su JL, Ringold GM 1997 TNF{alpha}-mediated inhibition and reversal of adipocyte differentiation is accompanied by suppressed expression of PPAR{gamma} without effects on Pref-1 expression. Endocrinology 138:2776–2783[Abstract/Free Full Text]
  3. Hotamisligil GS, Murray DL, Choy LN, Spiegelman BM 1994 Tumor necrosis factor {alpha} inhibits signaling from the insulin receptor. Proc Natl Acad Sci USA 91:4854–4858[Abstract/Free Full Text]
  4. Peraldi P, Hotamisligil GS, Buurman WA, White MF, Spiegelman BM 1996 Tumor necrosis factor (TNF)-{alpha} inhibits insulin signaling through stimulation of the p55 TNF receptor and activation of sphingomyelinase. J Biol Chem 271:13018–13022[Abstract/Free Full Text]
  5. Hotamisligil GS, Peraldi P, Budavari A, Ellis R, White MF, Spiegelman BM 1996 IRS-1-mediated inhibition of insulin receptor tyrosine kinase activity in TNF-{alpha}- and obesity-induced insulin resistance. Science 271:665–668[Abstract]
  6. Uysal KT, Wiesbrock SM, Marino MW, Hotamisligil GS 1997 Protection from obesity-induced insulin resistance in mice lacking TNF-{alpha} function. Nature 389:610–614[CrossRef][Medline]
  7. Reaven GM 2003 Insulin resistance/compensatory hyperinsulinemia, essential hypertension, and cardiovascular disease. J Clin Endocrinol Metab 88:2399–2403[Free Full Text]
  8. Lyon CJ, Law RE, Hsueh WA 2003 Minireview: adiposity, inflammation, and atherogenesis. Endocrinology 144:2195–2200[Abstract/Free Full Text]
  9. Fernandez-Real JM, Ricart W 2003 Insulin resistance and chronic cardiovascular inflammatory syndrome. Endocr Rev 24:278–301[Abstract/Free Full Text]
  10. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high-affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  11. Hauner H 2002 The mode of action of thiazolidinediones. Diabetes Metab Res Rev 18(Suppl 2):S10–S15
  12. Ren D, Collingwood TN, Rebar EJ, Wolffe AP, Camp HS 2002 PPAR{gamma} knockdown by engineered transcription factors: exogenous PPAR{gamma}2 but not PPAR{gamma}1 reactivates adipogenesis. Genes Dev 16:27–32[Abstract/Free Full Text]
  13. Lane MD, Tang QQ, Jiang MS 1999 Role of the CCAAT enhancer binding proteins (C/EBPs) in adipocyte differentiation. Biochem Biophys Res Commun 266:677–683[CrossRef][Medline]
  14. Mandrup S, Lane MD 1997 Regulating adipogenesis. J Biol Chem 272:5367–5370[Free Full Text]
  15. Deeb SS, Fajas L, Nemoto M, Pihlajamaki J, Mykkanen L, Kuusisto J, Laakso M, Fujimoto W, Auwerx J 1998 A Pro12Ala substitution in PPAR{gamma}2 associated with decreased receptor activity, lower body mass index and improved insulin sensitivity. Nat Genet 20:284–287[CrossRef][Medline]
  16. Kao WH, Coresh J, Shuldiner AR, Boerwinkle E, Bray MS, Brancati FL 2003 Pro12Ala of the peroxisome proliferator-activated receptor-{gamma}2 gene is associated with lower serum insulin levels in nonobese African Americans: the atherosclerosis risk in communities study. Diabetes 52:1568–1572[Abstract/Free Full Text]
  17. Zhang B, Berger J, Hu E, Szalkowski D, White-Carrington S, Spiegelman BM, Moller DE 1996 Negative regulation of peroxisome proliferator-activated receptor-{gamma} gene expression contributes to the antiadipogenic effects of tumor necrosis factor-{alpha}. Mol Endocrinol 10:1457–1466[Abstract]
  18. Rosenbaum SE, Greenberg AS 1998 The short- and long-term effects of tumor necrosis factor-{alpha} and BRL 49653 on peroxisome proliferator-activated receptor (PPAR){gamma}2 gene expression and other adipocyte genes. Mol Endocrinol 12:1150–1160[Abstract/Free Full Text]
  19. Katsuki A, Sumida Y, Murata K, Furuta M, Araki-Sasaki R, Tsuchihashi K, Hori Y, Yano Y, Gabazza EC, Adachi Y 2000 Troglitazone reduces plasma levels of tumour necrosis factor-{alpha} in obese patients with type 2 diabetes. Diabetes Obes Metab 2:189–191[CrossRef][Medline]
  20. Murase K, Odaka H, Suzuki M, Tayuki N, Ikeda H 1998 Pioglitazone time-dependently reduces tumour necrosis factor-{alpha} level in muscle and improves metabolic abnormalities in Wistar fatty rats. Diabetologia 41:257–264[CrossRef][Medline]
  21. Peraldi P, Xu M, Spiegelman BM 1997 Thiazolidinediones block tumor necrosis factor-{alpha}-induced inhibition of insulin signaling. J Clin Invest 100:1863–1869[Medline]
  22. Iwata M, Haruta T, Usui I, Takata Y, Takano A, Uno T, Kawahara J, Ueno E, Sasaoka T, Ishibashi O, Kobayashi M 2001 Pioglitazone ameliorates tumor necrosis factor-{alpha}-induced insulin resistance by a mechanism independent of adipogenic activity of peroxisome proliferator-activated receptor-{gamma}. Diabetes 50:1083–1092[Abstract/Free Full Text]
  23. Zhu Y, Qi C, Korenberg JR, Chen XN, Noya D, Rao MS, Reddy JK 1995 Structural organization of mouse peroxisome proliferator-activated receptor {gamma} (mPPAR{gamma}) gene: alternative promoter use and different splicing yield two mPPAR{gamma} isoforms. Proc Natl Acad Sci USA 92:7921–7925[Abstract/Free Full Text]
  24. Green H, Kehinde O 1975 An established preadipose cell line and its differentiation in culture II. Factors affecting the adipose conversion. Cell 3:19–26
  25. Saladin R, Fajas L, Dana S, Halvorsen YD, Auwerx J, Briggs M 1999 Differential regulation of peroxisome proliferator activated receptor {gamma}1 (PPAR{gamma}1) and PPAR{gamma}2 messenger RNA expression in the early stages of adipogenesis. Cell Growth Differ 10:43–48[Abstract/Free Full Text]
  26. Ikeda Y, Sugawara A, Taniyama Y, Uruno A, Igarashi K, Arima S, Ito S, Takeuchi K 2000 Suppression of rat thromboxane synthase gene transcription by peroxisome proliferator-activated receptor {gamma} in macrophages via an interaction with NRF2. J Biol Chem 275:33142–33150[Abstract/Free Full Text]
  27. Nishiyori A, Tashiro H, Kimura A, Akagi K, Yamamura K, Mori M, Takiguchi M 1994 Determination of tissue specificity of the enhancer by combinatorial operation of tissue-enriched transcription factors. Both HNF-4 and C/EBPß are required for liver-specific activity of the ornithine transcarbamylase enhancer. J Biol Chem 269:1323–1331[Abstract/Free Full Text]
  28. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 mPPAR{gamma}2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8:1224–1234[Abstract/Free Full Text]
  29. Margareto J, Larrarte E, Marti A, Martinez JA 2001 Up-regulation of a thermogenesis-related gene (UCP1) and down-regulation of PPAR{gamma} and aP2 genes in adipose tissue: possible features of the antiobesity effects of a ß3-adrenergic agonist. Biochem Pharmacol 61:1471–1478[CrossRef][Medline]
  30. Suzuki H, Kanamaru K, Tsunoda H, Inada H, Kuroki M, Sun H, Waga S, Tanaka T 1999 Heme oxygenase-1 gene induction as an intrinsic regulation against delayed cerebral vasospasm in rats. J Clin Invest 104:59–66[Medline]
  31. Sugawara A, Yen PM, Qi Y, Lechan RM, Chin WW 1995 Isoform-specific retinoid-X receptor (RXR) antibodies detect differential expression of RXR proteins in the pituitary gland. Endocrinology 136:1766–1774[Abstract]
  32. Sugawara A, Takeuchi K, Uruno A, Kudo M, Sato K, Ito S 2003 Effects of MAP kinase pathway and co-activator CBP on peroxisome proliferator-activated receptor-{gamma}-mediated transcription suppression of angiotensin II type 1 receptor gene. Hypertens Res 26:623–628[CrossRef][Medline]
  33. Sato K, Sugawara A, Kudo M, Uruno A, Ito S, Takeuchi K2004 Expression of peroxisome proliferator-activated receptor isoform proteins in the rat kidney. Hypertens Res 27:417–425
  34. Sugawara A, Takeuchi K, Uruno A, Ikeda Y, Arima S, Kudo M, Sato K, Taniyama Y, Ito S 2001 Transcriptional suppression of type-1 angiotensin II receptor gene expression by peroxisome proliferator-activated receptor-{gamma} in vascular smooth muscle cells. Endocrinology 142:3125–3134[Abstract/Free Full Text]
  35. Kim JB, Spotts GD, Halvorsen YD, Shih HM, Ellenberger T, Towle HC, Spiegelman BM 1995 Dual DNA binding specificity of ADD1/SREBP1 controlled by a single amino acid in the basic helix-loop-helix domain. Mol Cell Biol 15:2582–2588[Abstract]
  36. Sinha S, Maity SN, Lu J, de Crombrugghe B 1995 Recombinant rat CBF-C, the third subunit of CBF/NFY, allows formation of a protein-DNA complex with CBF-A and CBF-B and with yeast HAP2 and HAP3. Proc Natl Acad Sci USA 92:1624–1628[Abstract/Free Full Text]
  37. Ericsson J, Jackson SM, Edwards PA 1996 Synergistic binding of sterol regulatory element-binding protein and NF-Y to the farnesyl diphosphate synthase promoter is critical for sterol-regulated expression of the gene. J Biol Chem 271:24359–24364[Abstract/Free Full Text]
  38. Shi XM, Blair HC, Yang X, McDonald JM, Cao X 2000 Tandem repeat of C/EBP binding sites mediates PPAR{gamma}2 gene transcription in glucocorticoid-induced adipocyte differentiation. J Cell Biochem 76:518–527[CrossRef][Medline]
  39. Elberg G, Gimble JM, Tsai SY 2000 Modulation of the murine peroxisome proliferator-activated receptor {gamma} 2 promoter activity by CCAAT/enhancer-binding proteins. J Biol Chem 275:27815–27822[Abstract/Free Full Text]
  40. Clarke SL, Robinson CE, Gimble JM 1997 CAAT/enhancer binding proteins directly modulate transcription from the peroxisome proliferator-activated receptor {gamma}2 promoter. Biochem Biophys Res Commun 240:99–103[CrossRef][Medline]
  41. Tang QQ, Lane MD 1999 Activation and centromeric localization of CCAAT/enhancer-binding proteins during the mitotic clonal expansion of adipocyte differentiation. Genes Dev 13:2231–2241[Abstract/Free Full Text]
  42. Wu Z, Bucher NL, Farmer SR 1996 Induction of peroxisome proliferator-activated receptor {gamma} during the conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBPß, C/EBP{delta}, and glucocorticoids. Mol Cell Biol 16:4128–4136[Abstract]
  43. Zhang J, Fu M, Xiao Y, Mou Y, Floyd D, Liang J, Zhu X, Chen YE 2003 Selective disruption of peroxisome proliferator-activated receptor {gamma}2 impairs fat tissue development and insulin sensitivity. Circulation 108(Suppl IV):IV-176–IV-177
  44. Stephens JM, Pekala PH 1992 Transcriptional repression of the C/EBP-{alpha} and GLUT4 genes in 3T3–L1 adipocytes by tumor necrosis factor-{alpha}. Regulation is coordinate and independent of protein synthesis. J Biol Chem 267:13580–13584[Abstract/Free Full Text]
  45. Belmonte N, Phillips BW, Massiera F, Villageois P, Wdziekonski B, Saint-Marc P, Nichols J, Aubert J, Saeki K, Yuo A, Narumiya S, Ailhaud G, Dani C 2001 Activation of extracellular signal-regulated kinases and CREB/ATF-1 mediate the expression of CCAAT/enhancer binding proteins ß and {delta} in preadipocytes. Mol Endocrinol 15:2037–2049[Abstract/Free Full Text]
  46. Jambal P, Masterson S, Nesterova A, Bouchard R, Bergman B, Hutton JC, Boxer LM, Reusch JE, Pugazhenthi S 2003 Cytokine-mediated down-regulation of the transcription factor cAMP-response element-binding protein in pancreatic ß-cells. J Biol Chem 278:23055–23065[Abstract/Free Full Text]
  47. Lofgren P, van Harmelen V, Reynisdottir S, Naslund E, Ryden M, Rossner S, Arner P 2000 Secretion of tumor necrosis factor-{alpha} shows a strong relationship to insulin-stimulated glucose transport in human adipose tissue. Diabetes 49:688–692[Abstract]
  48. Suzawa M, Takada I, Yanagisawa J, Ohtake F, Ogawa S, Yamauchi T, Kadowaki T, Takeuchi Y, Shibuya H, Gotoh Y, Matsumoto K, Kato S 2003 Cytokines suppress adipogenesis and PPAR-{gamma} function through the TAK1/TAB1/NIK cascade. Nat Cell Biol 5:224–230[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J ANIM SCIHome page
M. Lorenzo, S. Fernandez-Veledo, R. Vila-Bedmar, L. Garcia-Guerra, C. De Alvaro, and I. Nieto-Vazquez
Insulin resistance induced by tumor necrosis factor-{alpha} in myocytes and brown adipocytes
J Anim Sci, April 1, 2008; 86(14_suppl): E94 - E104.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Zhou, R. Wu, W. Dong, A. Jacob, and P. Wang
Endotoxin downregulates peroxisome proliferator-activated receptor-{gamma} via the increase in TNF-{alpha} release
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2008; 294(1): R84 - R92.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
J.-i. Machiya, Y. Shibata, K. Yamauchi, N. Hirama, T. Wada, S. Inoue, S. Abe, N. Takabatake, M. Sata, and I. Kubota
Enhanced Expression of MafB Inhibits Macrophage Apoptosis Induced by Cigarette Smoke Exposure
Am. J. Respir. Cell Mol. Biol., April 1, 2007; 36(4): 418 - 426.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. Saito, A. Sugawara, A. Uruno, M. Kudo, H. Kagechika, Y. Sato, Y. Owada, H. Kondo, M. Sato, M. Kurabayashi, et al.
All-trans Retinoic Acid Induces in Vitro Angiogenesis via Retinoic Acid Receptor: Possible Involvement of Paracrine Effects of Endogenous Vascular Endothelial Growth Factor Signaling
Endocrinology, March 1, 2007; 148(3): 1412 - 1423.
[Abstract] [Full Text] [PDF]