help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2004-0625
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stocco, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stocco, C.
Endocrinology Vol. 145, No. 11 4957-4966
Copyright © 2004 by The Endocrine Society

In Vivo and in Vitro Inhibition of cyp19 Gene Expression by Prostaglandin F2{alpha} in Murine Luteal Cells: Implication of GATA-4

Carlos Stocco

Department of Obstetrics, Gynecology & Reproductive Science, Yale University School of Medicine, New Haven, Connecticut 06520

Address all correspondence and requests for reprints to: Carlos Stocco, Department of Obstetrics, Gynecology & Reproductive Science, Yale University School of Medicine, 333 Cedar Street, P.O. 208063, New Haven, Connecticut 06520. E-mail: carlos.stocco{at}yale.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A major function of the corpus luteum (CL) is to secrete progesterone. In rats, this gland also produces significant amounts of 17ß-estradiol. Progesterone and 17ß-estradiol are important regulators of rat luteal cell function. Estrogen biosynthesis is catalyzed by P450aromatase (P450arom), which is encoded by the cyp19 gene. In the rat CL, P450arom is expressed throughout pregnancy until the day before parturition, when it rapidly decreases. The mechanisms that control P450arom expression in luteal cells, particularly, the one or more factors that cause its rapid fall before parturition, are not known. Inasmuch as prostaglandin (PG) F2{alpha} plays a key role in the regulation of luteal function at the end of pregnancy, the purpose of this investigation was to determine whether PGF2{alpha} affect the expression of P450arom in the CL before parturition. PGF2{alpha} decreased luteal P450arom mRNA and protein levels in vivo and in vitro. A decrease in P450arom mRNA was also observed in mice CL just before parturition, but this change did not take place in PGF2{alpha} receptor knockout mice. The time course of the decrease in P450arom mRNA by PGF2{alpha} reflected the P450arom mRNA half-life determined by actinomycin D. Moreover, nuclear run-on assay showed that PGF2{alpha} attenuates P450arom gene transcription. Gel shift assays revealed that GATA-4 binds to the P450aromatase promoter, and that such binding is increased by PGF2{alpha}. It is concluded that PGF2{alpha} decreases luteal P450arom mRNA levels at the end of pregnancy in rodents by inhibiting cyp19 expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A MAJOR FUNCTION of the corpus luteum (CL) is to secrete progesterone. In rats, this gland also produces significant amounts of 17ß-estradiol. Progesterone and 17ß-estradiol are important regulators of rat luteal cell function. Estrogen biosynthesis is catalyzed by a complex called aromatase that comprises the ubiquitous flavoprotein reduced nicotinamide adenine dinucleotide phosphate cytochrome reductase and the unique cytochrome P450aromatase (P450arom), which is encoded by the cyp19 gene. In the rat CL, dramatic changes in P450arom mRNA levels take place throughout pregnancy (1, 2), suggesting that cyp19 expression is tightly regulated. P450arom mRNA content is low on d 4 of pregnancy, increases 3-fold on d 7–11, and 10-fold on d 15–19 of gestation. P450arom mRNA then rapidly decreases to almost undetectable levels on d 23, the day of parturition. The mechanisms that control P450arom expression in luteal cells, particularly, the one or more factors that cause its rapid fall before parturition, are not known.

Along with the rapid decrease in P450arom expression in the rat CL at the end of pregnancy, a dramatic rise in 20{alpha}-hydroxysteroid dehydrogenase (20{alpha}HSD) expression takes place (2). 20{alpha}HSD catabolizes progesterone to the inactive metabolite 20{alpha}-dihydroprogesterone. In rodents, inactivation of progesterone by 20{alpha}HSD causes the decrease in serum progesterone necessary for parturition to occur (3). Using mice rendered deficient for the prostaglandin (PG) PGF2{alpha} receptor and in vivo administration of PGF2{alpha} to d 19 pregnant rats, it was demonstrated that PGF2{alpha} induces luteal 20{alpha}HSD expression at the end of pregnancy in rodents (3). Considering that PGF2{alpha} plays a key role in the initiation of parturition (4), that estradiol is luteotropic in rats (5), and that changes in luteal P450arom and 20{alpha}HSD mRNA levels before parturition are diametrically opposite (2), we hypothesized that PGF2{alpha} may also induce luteal regression by inhibiting cyp19 expression in rats at the end of pregnancy.

This communication presents evidence indicating that PGF2{alpha} rapidly decreases P450arom mRNA levels when administered to pregnant rats on d 19 of pregnancy. Participation of PGF2{alpha} in the physiological decrease of P450arom expression at the end of pregnancy in rodents was confirmed by using PGF2{alpha} receptor knockout mice. In these mutant animals, no decrease in P450arom expression was observed. A direct effect of PGF2{alpha} on luteal cells is supported by in vitro experiments. Nuclear run-on assays support the conclusion that the effect of PGF2{alpha} on P450arom mRNA levels is mediated by an attenuation of cyp19 gene transcription. It is also shown that GATA-4 is expressed in the CL at the end of pregnancy, that this transcription factor binds to the P450arom promoter and that such binding is increased by PGF2{alpha} treatment in vivo and in vitro.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Pregnant Sprague Dawley rats (d 1 = sperm positive) purchased from Harlan (Indianapolis, IN) were housed at 24 C with a 14-h light, 10-h dark cycle (lights on 0500–1900 h) and allowed free access to food and water. PGF2{alpha} receptor knockout mice with a mixed genetic background of 129/Ola and C57BL/6 strains were used (4). Wild-type and PGF2{alpha} receptor knockout mice were maintained at 23 C under a 12-h light cycle. Virgin females (9–12 wk of age) housed overnight with males were checked the following morning for vaginal plug. The day the plug was found was counted as d 1 of pregnancy. Animal care and handling conformed to the National Institutes of Health (NIH) guidelines for animal research. The experimental protocol was approved by the Yale University Animal Resources Center.

Cell culture
Granulosa cells were obtained from immature rats treated with FSH (15 IU/rat) for 48 h. At this time, ovaries were isolated and granulosa cells obtained by puncture of preovulatory follicles. Cells were then cultured in DMEM-Ham F-12 (DMEM/F-12, 1:1) plus Nutridoma NS (Roche Molecular Biochemicals, Indianapolis, IN) and 0.1% of BSA in laminin (Roche)-coated wells. Immediately after plating, granulosa cells were treated with LH (500 ng/ml) overnight. After luteinization, cells were cultured for 3 d before the initiation of the experiments (6). To harvest cells after treatments, each well was washed twice with ice-cold PBS.

EMSA
Nuclear extract from CL or luteinized granulosa cells were homogenized in solution A [10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol]. Nuclei were obtained by 30-sec centrifugation at 4 C in an Eppendorf centrifuge and resuspended in solution B, which was similar to solution A except that it contained 420 mM NaCl, 5% (vol/vol) glycerol, and no KCl. Nuclei were rocked for 30 min at 4 C and then centrifuged at 14000 x g at 4 C for 20 min. The supernatant was then divided into portions and stored at –80 C. Double-stranded DNA probes spanning the regions –137 to –107 of the rat promoter were end-labeled with 32P and incubated with 5 µg of nuclear proteins for 30 min at 25 C in the presence of 0.1 µg/µl of poly (deoxyinosine-deoxycytosine). Samples were then loaded in a 6% polyacrylamide nondenaturing gel; electrophoresis was carried out in 0.5x Tris-borate-EDTA buffer at 4 C for 90 min. Free and bound probes were identified by autoradiography of dried gels. For supershift assay, nuclear extracts were preincubated with GATA-4 or GATA-6 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) for 15 min before the addition of labeled probe.

RNA isolation and semiquantitative RT-PCR analysis
Total RNA from frozen rat CL or mouse ovary was isolated using Tri-Reagent following the manufacturer’s instructions. For mRNA analysis by RT-PCR, 1 µg of total RNA was reverse-transcribed at 42 C using Advantage RT-for-PCR kit (Promega, Madison, WI) and later diluted to a final volume of 100 µl. The PCR mixture, containing specific oligonucleotide primers (500 pmol), deoxynucleotide triphosphate (150 µM), Taq DNA polymerase (1 U), was added to each tube containing 5 µl of reverse transcription (RT) product. Each PCR included also primers ß-actin used as an internal control. Before proceeding with the semiquantitative PCR, conditions were established such that the amplification of the products was in the exponential phase, and the assay was linear with respect to the amount of input RNA. Band intensity was determined by using the Image software from NIH.

Quantitative real-time PCR
Total RNA isolation and RT was performed as described above. To generate standard curves, P450arom cDNA was cloned into pCR 2.1 vector (Invitrogen Life Technologies, Carlsbad, CA), sequenced, and excised by restriction enzyme. Purified cDNA was diluted to concentrations ranging from 103 to 109 copies/5 µl. Five-microliter aliquots of standard cDNA or sample cDNA were combined with Lightcycler Master SYBR Green I (Roche), specific primers for rat P450arom, and water to 10 µl final volume. The sequences of the rat P450arom primers used are: sense, ctgctgatcatgggcctcct; antisense, ctccacaggctcgggttgtt. Real-time quantification of the PCR product in each cycle was carried out in a LightCycler real-time PCR machine (Roche) with the following cycling conditions: preincubation at 95 C for 2 min, followed by 40 cycles of denaturation at 95 C for 5 sec, annealing at 60 C for 10 sec, extension at 72 C for 10 sec. The melting peak of each sample was routinely determined by melting curve analysis to ascertain that only the expected products had been generated. The minimal number of cycles sufficient to produce detectable levels of fluorescence (Cp) was calculated using the Roche LightCycler software. The amount of P450arom mRNA molecules present in each sample was calculated using a standard curve (Fig. 1AGo, inset) and expressed as copies per microgram of total RNA.



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 1. Developmental regulation of P450arom mRNA levels in the rat CL. A, P450arom mRNA levels on CL from rat on different days of pregnancy were quantitated, using real-time RT-PCR. The number of P450arom mRNA molecules per microgram of total RNA was determined by using a standard curve generated from known quantities of P450arom cDNA. Values represent average ± SEM (n = 3) (***, P < 0.001, ANOVA I). A typical standard curve showing amplification efficiencies of 3-fold serial dilutions of the standards is shown. Cp, Detectable levels of fluorescence. B, Semiquantitative RT-PCR was performed in the same samples by coamplification of P450arom and ß-actin messages.

 
Western blotting analysis
CL from PGF2{alpha}-treated rats were homogenized in ice-cold lysis buffer [10 mM Tris-Cl (pH 8.0); 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 40 µM phenylmethylsulfonyl fluoride, 0.3 µM aprotinin, and 1 µM leupeptin]. This was followed by 30-min incubation on ice and centrifugation at 10,000 x g for 20 min at 4 C. The supernatant was transferred to new tubes, aliquoted and stored at –70 C until the time of electrophoresis. An aliquot of the supernatant was kept for protein measurement using BSA as a standard. Samples were denatured by adding sample buffer [62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 0.01% bromophenol blue], followed by boiling for 10 min. Thirty micrograms of protein were separated on 10% SDS-PAGE gels in Tris-glycine, 0.1% SDS buffer, and transferred to nitrocellulose paper in 25 mM Tris, 192 mM glycine, and 20% methanol buffer at 250 mA for 1.5 h. Blots were incubated for 2 h at RT in 5% nonfat dry milk to block unspecific binding. Blots were then washed and incubated over night at 4 C with anti-P450arom antibody (Serotech, Oxford, UK) at a 1/4000 dilution, and were washed and incubated with a secondary antibody conjugated to horseradish peroxidase (1/6000 dilution) for 2 h at room temperature. Protein-antibody complexes were visualized using Western blotting luminol reagent following manufacturer’s protocol (Santa Cruz Biotechnology).

Isolation of nuclei and transcription run-on assays
Luteinized granulosa cells were washed three times with PBS and scraped in lysis buffer containing 0.5% Nonidet P-40, 10 mM KCl, 10 mM MgCl2, 10 mM HEPES (pH 7.9), and 0.5 mM ß-mercaptoethanol. Nuclei were collected by centrifugation, washed once by centrifugation in a lysis buffer without Nonidet P-40, and stored in liquid nitrogen in 50 mM Tris-HCl (pH 7.9), 5 mM MgCl2, 0.5 mM ß-mercaptoethanol, and 40% glycerol. Run-on transcription was carried out at 30 C for 45 min in a reaction mixture containing 5 x 106 nuclei and 10 mM biotin-16-uridine triphosphate (UTP) (Roche) in a final volume of 60 µl. RNA was extracted with TRIzol, ethanol-precipitated, and resuspended in 50 µl of diethylpyrocarbonate water. Biotinylated RNA was purified by adding streptavidin magnetic particles (Roche), followed by 2 h of incubation at 25 C in a rocking platform. Beads were separated with a magnet and washed two times with 2x standard sodium citrate-15% formamide for 15 min and twice with 2x standard sodium citrate for 5 min. Biotinylated RNA was finally dissolved in 10 µl of diethylpyrocarbonate water and used to prepare cDNA using random hexamer, following the protocol described above. Amplification of P450arom and ß-actin run-on RNA was performed using semiquantitative and real-time PCR.

Statistical analysis
The statistical analysis of data was performed using the Prism software (GraphPad Software, Inc., San Diego, CA). The statistical test used in each particular experiment is depicted in figure legend. All case values were considered statistically significant at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Developmental regulation of P450arom mRNA levels, a quantitative analysis
To study P450arom expression a quantitative RT-PCR methodology was set up, using total RNA from corpora lutea of rats on different days of pregnancy. Using this methodology, low luteal P450arom expression was found on d 4 of pregnancy (Fig. 1AGo). The number of P450arom mRNA molecules per microgram of total RNA progressively increased from d 4–8 of gestation and remained constant through d 15. Higher levels of luteal P450arom expression were found from d 18–21. A 10-fold decrease in cyp19 expression was observed between d 21 and 22 of pregnancy (P < 0.001). Correlation analysis indicated a progressive increase in P450arom expression in the CL from d 4–18 (r: 0.9373; P, 0.0058). Relative RT-PCR analysis, using ß-actin as an internal control, further confirmed these results (Fig. 1BGo).

PGF2{alpha} effect on P450arom expression
To determine whether PGF2{alpha} affects luteal P450arom expression, d 19 pregnant rats were injected with PGF2{alpha} (400 µg/rat) or vehicle. Corpora lutea were isolated at 1, 3, 6, or 10 h after PGF2{alpha} administration. Luteal P450arom mRNA levels were determined by using quantitative and semiquantitative RT-PCR (Fig. 2AGo). This time course analysis revealed that PGF2{alpha} rapidly decreased luteal P450arom expression. As early as 3 h after PGF2{alpha} treatment, a 3-fold decrease (P < 0.05) in the number of P450arom mRNA molecules per microgram of total RNA was observed. Six hours after treatment, P450arom mRNA levels in PGF2{alpha}-treated animals were 10 times lower than in vehicle-treated rats (P < 0.01, ANOVA I).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2. A, In vivo and in vitro effect of PGF2{alpha} on luteal P450arom expression. A, Rats on d 19 of pregnancy were treated with 400 µg of PGF2{alpha} ip and killed at 1, 3, 6, and 10 h thereafter. P450arom mRNA levels were determined by quantitative and relative RT-PCR as described in Materials and Methods. Bars represent means ± SEM, n = 3. (*, P < 0.05; ***, P < 0.001 when compared with 0 h (ANOVA I). Western blot: Whole corpora lutea proteins were separated by SDS-PAGE transferred to nitrocellulose, and immunoblotted with a specific P450arom antiserum. The blot is representative of two different experiments. B, Luteinized granulosa cells were treated with 0.5 µM of PGF2{alpha} for 0.5, 1, 2, or 4 h (left) or with 0.02, 0.1, or 0.5 µM of PGF2{alpha} for 3 h (right). Bars represent the mean ± SEM of three independent experiments; *, P < 0.05; **, P < 0.01 when compared with 0 h or vehicle (ANOVA I). P450arom mRNA levels were determined by quantitative RT-PCR as described in Materials and Methods.

 
The effect of PGF2{alpha} on P450arom protein levels was examined by Western blot analysis in corpora lutea extracted at different times after treatment with PGF2{alpha} or vehicle on d 19 of pregnancy. As expected, high levels of P450arom protein were detected in vehicle-treated animal; P450arom protein levels were significantly decreased 10 h after PGF2{alpha} treatment (Fig. 2AGo).

Finally, using an in vitro system, we examined whether PGF2{alpha} decreases P450arom expression by acting directly on luteal cells. Luteinized granulosa cells were treated with 0.5 µM of PGF2{alpha} for 0.5, 1, 2, and 4 h. As shown in Fig. 2BGo (left panel), this treatment caused a time-dependent decrease in P450arom mRNA levels. A dose-response effect of PGF2{alpha} on P450arom expression was also observed (Fig. 2BGo, right panel).

P450arom mRNA levels in wild-type and PGF2{alpha} receptor knockout mice
To examine whether PGF2{alpha} is responsible for the rapid decrease in P450arom expression observed at the end of pregnancy, P450arom mRNA levels were determined in ovaries of wild-type or PGF2{alpha} receptor knockout animals on d 18–20 of pregnancy. As with rats, a decrease in luteal P450arom mRNA levels in wild-type mice was observed just before parturition (Fig. 3Go). In contrast, in PGF2{alpha} receptor knockout mice, P450arom remained highly expressed until d 20 of pregnancy.



View larger version (65K):
[in this window]
[in a new window]
 
FIG. 3. P450arom expression at the end of pregnancy in wild-type and PGF2{alpha} receptor knockout (KO) mice. Total RNA from ovaries of wild-type or mutant animals was subjected to RT-PCR analysis by coamplification with specific primers for mouse P450arom and ß-actin. This determination was performed in two independent sets of samples, with identical results.

 
Effect of PGF2{alpha} on P450arom mRNA stability and cyp19 gene’s transcription rate
The results presented so far demonstrate that luteal P450arom mRNA levels are decreased by PGF2{alpha}. To determine whether changes in P450arom mRNA levels are due to alteration of the transcription rate of the cyp19 gene, nuclear run-on assay was performed following the protocol of Patrone et al. (7). Transcription of active genes in nuclei isolated from cells treated with vehicle or PGF2{alpha} (0.5 µM) for 4 h was completed by the addition of ATP, GTP, and thymidine triphosphate and biotin-16-UTP. Biotin-16-UTP-labeled transcripts were purified using streptavidin magnetic particles. Total cDNA was then synthesized by means of random hexamer primed RT of captured biotin-RNA. Transcript abundance in cDNA, from run-on RNA or total RNA, was determined by quantitative real-time PCR and by relative semiquantitative PCR. ß-Actin was used as an internal control because it is constitutively expressed and its transcriptional rate is relatively constant. To monitor undesired RNA capture to beads, a control reaction was performed in which UTP was added in place of biotin-16-UTP; no signal for P450arom or for ß-actin was observed in these conditions (data not shown). As shown in Fig. 4AGo, the amount of run-on transcripts for P450arom was significantly lower in samples treated with PGF2{alpha} when compared with control samples, whereas no changes for run-on ß-actin transcripts were observed.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 4. Effect of PGF2{alpha} on cyp19 gene transcription and P450arom mRNA stability. A, Transcription of active genes in nuclei isolated from cells treated with vehicle or PGF2{alpha} (0.5 µM) for 4 h was completed by the addition of ATP, GTP, and thymidine triphosphate and biotin-16-UTP. Biotin-16-UTP-labeled transcript abundance was determined by quantitative real-time RT-PCR (top) and relative semiquantitative RT-PCR (bottom). Bars represent the mean ± SEM of three different experiments; ***, P < 0.01 vs. control (Student’s t test). B, Luteinized-granulosa cells were treated with PGF2{alpha} (0.5 µM) alone (PG), PG + actinomycin D (ActD), or ActD alone for various times. P450arom mRNA levels were determined by using semiquantitative RT-PCR, using ß-actin as internal standard. The average of three experiments ± SEM is shown in the top graph. A representative gel for each group is shown.

 
To examine whether PGF2{alpha} affects the half-life of the P450arom mRNA, an inhibitor of RNA synthesis was used. Luteinized granulosa cells were divided into four groups, two of which were treated with actinomycin D, and the other two were treated with dimethylsulfoxide for 30 min. After this pretreatment, either vehicle or PGF2{alpha} (0.5 µM) was added. Cells were incubated for 2, 4, 8, and 16 h. At the end of this incubation, total mRNA was isolated and expression levels of P450arom and ß-actin were quantified. As shown in Fig. 4BGo (top panel), P450arom mRNA levels decrease in a time-dependent manner after PGF2{alpha} treatment. As expected, inhibition of RNA synthesis caused a progressive decrease in P450arom mRNA levels (Fig. 4BGo, bottom panel). PGF2{alpha} treatment of actinomycin D pretreated cells did not affect this progressive decrease (Fig. 4BGo, middle panel). A linear regression analysis indicated that there is no difference in the decreasing rate of P450arom mRNA levels in the presence of actinomycin D or in the presence of actinomycin D plus PGF2{alpha} (slopes: actinomycin D: –6.4 ± 0.8; actinomycin D plus PGF2{alpha}: –6.3 ± 0.5). The calculated half-life of P450arom in luteinized granulosa cells in both groups is of approximately 5 h.

P450arom proximal promoter is used in the rat CL throughout pregnancy
In rats, two P450arom promoters have been described thus far: the proximal promoter region, which controls P450arom expression in granulosa cells of the follicle (ovarian promoter) (8) and a brain promoter, which drives P450arom expression in this tissue (9). Evidence also indicates that P450arom expression in the rat CL seems to be regulated by mechanisms different from those present in granulosa cells (10), suggesting that a switch in P450arom promoter usage may occur during differentiation of granulosa cells into luteal cells. To examine this possibility and to determine which promoter may be regulated by PGF2{alpha}, the presence of transcripts specific to ovarian or brain promoters was investigated in the CL of pregnant rats. PCR was performed by amplifying the 5' regions of transcript variants encoded by the first exon. Specific primers for the ovarian exon I (11), or the brain exon I (9) and the common exon II (11), were used. As shown in Fig. 5AGo, a unique transcript was found in the brain, whereas in the CL both brain and ovarian transcripts were detected. In the CL, transcripts produced by brain promoter were only detectable after 35 cycles of PCR, whereas ovarian transcripts were detectable after 22 cycles of PCR. Developmental studies (Fig. 5BGo) revealed that expression levels of the ovarian transcript, but not those of the brain transcript, correlate with changes in P450arom coding sequence.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 5. Analysis of alternative exon I transcripts in rat CL throughout pregnancy. A, Total RNA from CL or brain of d 19 pregnant rats was used to amplify the ovarian or the brain-specific P450arom exon I. B, Expression levels of the ovarian and brain P450arom transcripts were determined in rat CL throughout pregnancy. The number of cycles necessary to detect each product is indicated. A representative blot is shown (n = 3).

 
Interspecies sequence alignment and analysis of the cyp19 proximal promoter
To examine possible mechanisms by which the cyp19 proximal promoter activity may be regulated by PGF2{alpha} in the CL, we aligned and compared the sequence of this promoter region in rats, mice and humans. These species are known to express P450arom in the CL and possess a single-copy of this gene (12). We also scanned these promoters for transcription factor binding sequences, using the Transfac database (13). As depicted by bold sequences in Fig. 6Go, the 5'-proximal region of the cyp19 gene is highly conserved across species. Interestingly, the human promoter contains two inserted regions not found in rodents (Fig. 6Go, region A and B). The region A (–253 to –235) contains the TATA box of the human’s promoter I.3. The region B (human –124 to –85) contains 39 bp, and it is located immediately after the steroidogenic factor-1 (SF-1) binding site. This insert contains part of a previously identified silencer element (14). This silencer, named S1, has been shown to inhibit the activity of the human promoters II and I.3 in normal breast tissue (15).



View larger version (62K):
[in this window]
[in a new window]
 
FIG. 6. Comparison of the nucleic acid sequences of the proximal promoter regions of the human, rat and mouse cyp19 genes. Bolded sequences indicate identical nucleotides among species. The TATA boxes are indicated by boxes. Circled bases indicate transcription initiation start sites (+1) of mouse ovarian exon I, human exons l.3 and II, and rat ovarian exon I. Dashed lines denote silencer sequence (S1 and S2). Solid lines indicate transcription factors binding sequences (NRHS = SF-1/COUP-TF). Inserted sequences in the human promoter are indicated as A and B regions.

 
Two consensus-binding sites for the GATA family of transcription factors were found upstream of the SF-1 binding sites. These binding sites are conserved in the three species examined. In humans, this region was characterized as a silencer and was named S2 (16). S2 represses promoter activity even when inserted 5'-3' or 3'-5' in front of thymidine kinase or proglucagon promoters, indicating that S2 is an orientation-independent strong silencer element, even for heterologous promoters. The GATA binding site has been shown to be the core of this silencer (16). Because S2 is highly conserved between species, it is possible to postulate that this region may also play a role in the inhibition of P450arom expression in rodents.

This analysis also revealed the presence of a putative binding site for the Yin Yang 1 (YY1) transcription factor located immediately downstream from the SF-1 binding site in rats and mice, but separated from SF-1 by the inserted region B in humans.

GATA-4 binds to the proximal promoter of the cyp19 gene
Gel shift analysis was used to determine whether PGF2{alpha} affects protein binding to the conserved region S2, previously identified as a silencer element. For this experiment, nuclear extracts from CL of vehicle- or PGF2{alpha}-treated rats, and oligonucleotides containing the two GATA response elements found in the S2 region, were used (Fig. 7AGo). As shown in Fig. 7BGo two bandshifts were observed. Interestingly, an increase in the intensity of the top band occurred in PGF2{alpha}-treated samples, when compared with controls. This increase in protein binding was also observed in vitro after treatment of luteinized granulosa cells with PGF2{alpha}. Addition of unlabeled GATA probe in excess completely prevented the formation of the shifted bands (Fig. 7CGo), whereas 100x excess of an unlabeled probe containing a mutation in the two GATA binding sites did not block their formation.



View larger version (81K):
[in this window]
[in a new window]
 
FIG. 7. EMSA and supershift assay of luteal nuclear extract and oligonucleotides containing GATA binding sites found in the proximal promoter of the rat cyp19 gene. A, Oligonucleotides probe spanning the region –136 and –107 relative to +1 of the rat cyp19 promoter. GATA binding sites are shown in bold. Underlined base pairs indicate mutation used in competitive EMSA (mGATA). B, EMSA was performed with nuclear extracts prepared from CL of d 19 pregnant rat (in vivo) or from luteinized granulosa cells (in vitro) treated with vehicle (–) or PGF2{alpha}. C, EMSA binding was competed with unlabeled wild-type oligonucleotide (GATA) or an oligonucleotide containing mutations in the GATA binding sites (mGATA). D, Supershifted analysis: Antibody against GATA-4, GATA-6 or c-jun was added to the EMSA reaction 15 min before the addition of labeled probe. S, Bandshift; SS, supershifted bands.

 
Previous studies have documented that GATA-4 and GATA-6 are expressed in the ovaries of rodents, humans, and pigs, and that this expression is regulated by gonadotropins (17, 18, 19). To determine whether GATA-4 and/or GATA-6 are present in the protein/DNA complex formed with the GATA binding site found in the S2 region, a supershift analysis was performed. As shown in Fig. 7DGo), an antibody that recognized the C-terminal portion of the GATA-4 protein completely supershifted this complex, whereas no supershift was observed with a GATA-6-specific antibody or a nonrelated antibody. A more prominent supershift was observed when 10 µg of nuclear proteins were used (Fig. 7DGo, right panel). These results show for the first time that: 1) GATA-4 is expressed in the rat CL at the end of pregnancy, 2) it binds to the P450arom promoter, and 3) such binding is up-regulated by PGF2{alpha}.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results presented demonstrate that PGF2{alpha}, a well-known luteolytic hormone, rapidly decreases P450arom mRNA and protein levels in rodents’ luteal cells. These results are further supported by the sustained levels of P450arom at the end of pregnancy observed in the PGF2{alpha} receptor null mice. In vitro experiments showing that PGF2{alpha} decreases P450arom expression in luteinized granulosa cells cultured in serum-free media, suggest a direct effect of PGF2{alpha} on these cells. Our results have also provided a quantification of the dramatic decrease (10-fold) in P450arom expression that takes place between d 21 and 22 of pregnancy in the rat CL.

It has been recently demonstrated that PGF2{alpha} increases P450arom expression in human (20) and pig (21) luteal cells, suggesting a species-specific effect of PGF2{alpha}. Because the proximal promoter drives P450arom expression in human luteal cells (22), it is possible that the inserted sequence found in the human P450arom promoter (regions A and B in Fig. 6Go) may be responsible for the differential effect of PGF2{alpha} on the expression of P450arom among species. For instance, in rodents, a nuclear receptor half-site (NRHS) and an YY1 binding site are contiguous, but are separated by region B in humans. It is possible that YY1 interferes with NRHS activation in rodents but not in humans (see below).

Nuclear run-on experiments indicated that PGF2{alpha} attenuates the transcription rate of the cyp19 gene in rat luteal cells. P450arom’s half-life was not affected by PGF2{alpha}, further indicating an effect in the activity of the cyp19 promoter. It is well known, at least in humans, that the usage of alternative promoters is the key mechanism conferring tissue-specific expression of the cyp19 gene. As mentioned before, two P450arom promoters have been described in rats: the proximal promoter region denoted ovarian promoter (8) and the brain promoter (9). In this communication, the specific untranslated first exon produced by the two alternative promoters of the cyp19 gene was determined in the rat CL during pregnancy. The results indicated that both promoters are active in luteal cells; however, brain transcripts are expressed at much lower levels than the ovarian transcripts. This result agrees with the expression levels for brain and ovary transcript previously found in the mouse ovary (23), and indicates that P450arom expression in the CL, as it is in the follicle, is attributable to the activation of the proximal promoter. Developmental studies revealed that expression levels of the ovarian promoter transcript, but not those of the brain promoter, correlate with changes in P450arom coding sequence. Transcription factors that control the cyp19 proximal promoter in rat luteal cells during pregnancy and the mechanism by which PGF2{alpha} decreases the activity of this promoter remain to be determined.

The activity of the proximal cyp19 promoter in granulosa cells is regulated by FSH, which by raising intracellular cAMP levels, stimulates P450arom expression by acting in two different cis elements (24, 25). The most proximal element, a NRHS, binds SF-l, whereas the distal element contains a cAMP response element (CRE) that binds the CRE binding protein (CREB) (Fig. 6Go). Mutational analyses have demonstrated that SF-1 and CREB interact in an additive manner to increase cyp19 expression in granulosa cells (26, 27). However, estradiol production by luteal cells seems to be regulated by mechanisms different from those of granulosa cells. Several evidences indicate that P450arom expression is maintained by cAMP-independent mechanisms in the CL. For instance, P450arom mRNA levels are not affected by forskolin treatment in luteinized granulosa cells (10). Moreover, in the CL, CREB phosphorylation does not correlate with levels of P450arom expression (10). In luteal cells, phospho-CREB resides in the cytoplasmic region, not in the nucleus (10), further suggesting that the cAMP-protein kinase A pathway is not involved in the regulation of luteal P450arom expression.

Participation of SF-1 in the regulation of the cyp19 proximal promoter in luteal is also not clear. Although SF-1 expression decreases during luteinization (8, 26), this factor is expressed in the CL of pregnant rats (28). Recently, a transcription factor called liver receptor homolog-1 (LRH-1), which is closely related to SF-1, has been shown to regulate P450arom (29, 30, 31) by interacting with the NRHS found in the proximal cyp19 promoter (28, 31). LRH-1 in expressed in granulosa cells and, like SF-1, decreases during luteinization (28). Prolactin, the main luteotropic hormone in rodents, restores LRH-1, but not SF-1, expression (28). LRH-1 has also been detected in the CL of pregnant rats (28, 32). An in situ hybridization study shows that luteal expression of LRH-1 and P450arom overlap at certain stages during pregnancy; however, this study also reveals that the expression of LRH-1 and P450arom does not change in a parallel manner (32). For instance, LRH-1 expression is low after d 18 of pregnancy but P450arom remains highly expressed until d 21 (32). Similar studies had not been conducted for SF-1. This evidence suggests that although LRH-1 may regulate P450arom expression in the CL, other factors seem to be involved. In this study, we have shown that GATA-4 is expressed in luteal cells of d 19 pregnant rats and binds the cyp19 promoter, suggesting that this transcription factor may also be implicated in the regulation of P450arom expression in the rat CL. Interestingly, GATA-4 binding is increased by treatment with PGF2{alpha}, which inhibits P450arom expression. These results do not agree with overexpression experiments, which suggests that GATA factors may up-regulate P450arom in Sertoli cells (33, 34). It is possible that the effect of GATA on P450arom expression is cell type specific. Because actinomycin D did not prevent the effect of PGF2{alpha} on P450arom expression, the increase in GATA-4 binding induced by PGF2{alpha} is apparently not due to stimulation of GATA-4 expression. Because GATA-4 has recently been shown to be phosphorylated through the ERK1/2 pathway (35, 36) and because PGF2{alpha} is known to increase ERK1/2 phosphorylation in rat luteal cells (37), we postulate that PGF2{alpha} activates GATA-4 binding activity throughout a ERK1/2-dependent pathway.

Of interest is the presence of a putative binding site for YY1 in the cyp19 proximal promoter. This factor has been implicated in the down-regulation of steroidogenic genes such as 3-hydroxy-3-methylglutaryl coenzyme A synthase, farnesyl diphosphate synthase, and low-density lipoprotein receptor (38, 39). In the rat ovary, YY1 protein levels increase after treatment of pseudopregnant rats with PGF2{alpha}. In this model, YY1 appears to mediate PGF2{alpha} inhibition of steroidogenic acute regulatory protein mRNA expression (40). Multiple mechanisms for YY1 inhibition of transcription have been proposed (41). One mechanism involves YY1 interference with the function of a transcriptional activator. Interestingly, we have found that in the rat and mouse, the putative YY1 binding site is placed immediately downstream of the NRHS (Fig. 6Go), which is recognized by SF-1 and LRH-1. It is possible to speculate that if YY1 binds to the cyp19 promoter, it may interfere with SF-1/LRH-1 activity.

The NRHS may also be directly involved in the inhibition of cyp19 expression. Thus, it has been shown that the chick ovalbumin upstream promoter factor (COUP-TF), an inhibitory orphan nuclear receptor, silences the cyp19 gene in eutopic endometrial stromal cells (42), where P450arom is almost undetectable (42, 43). P450arom, however, becomes expressed in a number of uterine tumors, such as endometrial cancer and endometriotic plaques (43), via the stimulatory action of the cAMP/CREB system (44, 45) and SF-1 (42). SF-1 displaces COUP-TF by directly competing for occupancy of the NRHS (42). Whether COUP-TF is involved in the inhibition of cyp19 expression by PGF2{alpha} in rat luteal cells is currently under investigation.

Finally, the CRE that mediates cyp19 stimulation on granulosa cells has been recently proposed to mediate the suppression of P450arom by LH during luteinization (46). It is known that the preovulatory surge of LH increases the expression of the cAMP early repressor (ICER) (47). ICER is an early response repressor that is rapidly expressed when needed (48). ICER binds CRE but is devoid of the kinase inducible and transactivation domains (49). This unique feature of ICER may possibly postulate that ICER displaces CREB from its binding site, decreasing cAMP-dependent transcription. However, P450arom expression is cAMP-independent in luteal cells, and considering that the effect of PGF2{alpha} does not require RNA synthesis, it is unlikely that ICER mediates PGF2{alpha} inhibition.

Our initial hypothesis suggesting that PGF2{alpha} may also induce luteal regression by inhibiting the production of luteal estradiol in rats at the end of pregnancy was mainly based on the fact that 17ß-estradiol stimulates both progesterone biosynthesis and luteal cell hypertrophy in pregnant rats (5). However, a decreased capacity of the CL to aromatize androgen could play an important role in the normal progress of luteolysis, not only by diminishing intraluteal levels of 17ß-estradiol, but also by increasing intraluteal levels of androstenedione. It has been demonstrated that administration of dihydrotestosterone, a nonaromatizable androgen, induces abortion by acting directly at the ovarian level (50). Interestingly, in rats, ovarian androgen concentration shows a sharp increase from d 21 to term, particularly androstenedione and testosterone levels, which increase by 49% and 87%, respectively (51). In addition, it has been shown that androstenedione reduces progesterone production in luteal cells (52, 53). Therefore, at the end of pregnancy, an increase in intraovarian levels of androgens along with a block in aromatization could facilitate the normal progress of luteolysis.

In conclusion, it is clear that PGF2{alpha} is accountable for the dramatic decrease in P450arom expression that takes place at the end of pregnancy in the CL of rats and mice. Because estrogens are not only critical regulators of reproductive processes, but also are involved in the development of several human pathologies including breast cancer and endometriosis, these results may contribute to an understanding of the mechanisms controlling P450arom expression in cancer cells, especially considering that the same cyp19 promoter is used in the CL, endometriotic plaque, and breast tumors.


    Acknowledgments
 
The author is grateful to Dr. Harold Behrman (Department of Obstetrics, Gynecology & Reproductive Science, Yale University School of Medicine) for his valuable criticisms and suggestions and to Dr. Yukihiko Sugimoto (Department of Physiological Chemistry, Faculty of Pharmaceutical Sciences, Kyoto University) for providing ovaries of PGF2{alpha}-R null mice.


    Footnotes
 
Abbreviations: CL, Corpus luteum; CRE, cAMP response element; CREB, CRE binding protein; COUP-TF, chick ovalbumin upstream promoter factor; 20{alpha}HSD, 20{alpha}-hydroxysteroid dehydrogenase; ICER, cAMP early repressor; LRH-1, liver receptor homolog-1; NRHS, nuclear receptor half-site; P450arom, P450aromatase; PG, prostaglandin; RT, reverse transcription; SDS, sodium dodecyl sulfate; SF-1, steroidogenic factor-1; UTP, uridine triphosphate; YY-1, Yin Yang 1.

Received May 17, 2004.

Accepted for publication July 12, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hickey GJ, Chen SA, Besman MJ, Shively JE, Hall PF, Gaddy-Kurten D, Richards JS 1988 Hormonal regulation, tissue distribution, and content of aromatase cytochrome P450 messenger ribonucleic acid and enzyme in rat ovarian follicles and corpora lutea: relationship to estradiol biosynthesis. Endocrinology 122:1426–1436[Abstract/Free Full Text]
  2. Akinola LA, Poutanen M, Vihko R, Vihko P 1997 Expression of 17ß-hydroxysteroid dehydrogenase type 1 and type 2, P450 aromatase, and 20{alpha}-hydroxysteroid dehydrogenase enzymes in immature, mature, and pregnant rats. Endocrinology 138:2886–2892[Abstract/Free Full Text]
  3. Stocco CO, Zhong L, Sugimoto Y, Ichikawa A, Lau LF, Gibori G 2000 Prostaglandin F2{alpha} induced expression of 20{alpha}-hydroxysteroid dehydrogenase involves the transcription factor NUR77. J Biol Chem 275:37202–37211[Abstract/Free Full Text]
  4. Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Aze Y, Nishimura T, Oida H, Yoshida N, Tanaka T, Katsuyama M, Hasumoto K, Murata T, Hirata M, Ushikubi F, Negishi M, Ichikawa A, Narumiya S 1997 Failure of parturition in mice lacking the prostaglandin F receptor. Science 277:681–683[Abstract/Free Full Text]
  5. Gibori G 1993 The corpus luteum of pregnancy. In: Adashi EY, Leung PCK, eds. The ovary. New York: Raven Press; 261–317
  6. Aten RF, Kolodecik TR, Behrman HR 1995 A cell adhesion receptor antiserum abolishes, whereas laminin and fibronectin glycoprotein components of extracellular matrix promote, luteinization of cultured rat granulosa cells. Endocrinology 136:1753–1758[Abstract]
  7. Patrone G, Puppo F, Cusano R, Scaranari M, Ceccherini I, Puliti A, Ravazzolo R 2000 Nuclear run-on assay using biotin labeling, magnetic bead capture and analysis by fluorescence-based RT-PCR. Biotechniques 29:1012–1014, 1016, 1017[Medline]
  8. Fitzpatrick SL, Carlone DL, Robker RL, Richards JS 1997 Expression of aromatase in the ovary: down-regulation of mRNA by the ovulatory luteinizing hormone surge. Steroids 62:197–206[CrossRef][Medline]
  9. Kato J, Yamada-Mouri N, Hirata S 1997 Structure of aromatase mRNA in the rat brain. J Steroid Biochem Mol Biol 61:381–385[CrossRef][Medline]
  10. Gonzalez-Robayna IJ, Alliston TN, Buse P, Firestone GL, Richards JS 1999 Functional and subcellular changes in the A-kinase-signaling pathway: relation to aromatase and Sgk expression during the transition of granulosa cells to luteal cells. Mol Endocrinol 13:1318–1337[Abstract/Free Full Text]
  11. Hickey GJ, Krasnow JS, Beattie WG, Richards JS 1990 Aromatase cytochrome P450 in rat ovarian granulosa cells before and after luteinization: adenosine 3',5'-monophosphate-dependent and independent regulation. Cloning and sequencing of rat aromatase cDNA and 5' genomic DNA. Mol Endocrinol 4:3–12[Abstract/Free Full Text]
  12. Kamat A, Hinshelwood MM, Murry BA, Mendelson CR 2002 Mechanisms in tissue-specific regulation of estrogen biosynthesis in humans. Trends Endocrinol Metab 13:122–128[CrossRef][Medline]
  13. Heinemeyer T, Chen X, Karas H, Kel AE, Kel OV, Liebich I, Meinhardt T, Reuter I, Schacherer F, Wingender E 1999 Expanding the TRANSFAC database towards an expert system of regulatory molecular mechanisms. Nucleic Acids Res 27:318–322[Abstract/Free Full Text]
  14. Zhou D, Chen S 1998 Characterization of a silencer element in the human aromatase gene. Arch Biochem Biophys 353:213–220[CrossRef][Medline]
  15. Zhou D, Chen S 1999 Identification and characterization of a cAMP-responsive element in the region upstream from promoter 1.3 of the human aromatase gene. Arch Biochem Biophys 371:179–190[CrossRef][Medline]
  16. Jin T, Zhang X, Li H, Goss PE 2000 Characterization of a novel silencer element in the human aromatase gene PII promoter. Breast Cancer Res Treat 62:151–159[CrossRef][Medline]
  17. Gillio-Meina C, Hui YY, LaVoie HA 2003 GATA-4 and GATA-6 transcription factors: expression, immunohistochemical localization, and possible function in the porcine ovary. Biol Reprod 68:412–422[Abstract/Free Full Text]
  18. Laitinen MP, Anttonen M, Ketola I, Wilson DB, Ritvos O, Butzow R, Heikinheimo M 2000 Transcription factors GATA-4 and GATA-6 and a GATA family cofactor, FOG-2, are expressed in human ovary and sex cord-derived ovarian tumors. J Clin Endocrinol Metab 85:3476–3483[Abstract/Free Full Text]
  19. Heikinheimo M, Ermolaeva M, Bielinska M, Rahman NA, Narita N, Huhtaniemi IT, Tapanainen JS, Wilson DB 1997 Expression and hormonal regulation of transcription factors GATA-4 and GATA-6 in the mouse ovary. Endocrinology 138:3505–3514[Abstract/Free Full Text]
  20. Behrman H, Sakkas D, Stocco C, Prostaglandin F2{alpha} increases aromatase expression in human luteal cells. Program of the 86th Annual Meeting of The Endocrine Society, New Orleans, LA, 2004, p 29 (Abstract P1-126)
  21. Diaz FJ, Wiltbank MC 2004 Acquisition of luteolytic capacity: changes in prostaglandin F2{alpha} regulation of steroid hormone receptors and estradiol biosynthesis in pig corpora lutea. Biol Reprod 70:1333–1339[Abstract/Free Full Text]
  22. Michael MD, Kilgore MW, Morohashi K, Simpson ER 1995 Ad4BP/SF-1 regulates cyclic AMP-induced transcription from the proximal promoter (PII) of the human aromatase P450 (cyp19) gene in the ovary. J Biol Chem 270:13561–13566[Abstract/Free Full Text]
  23. Golovine K, Schwerin M, Vanselow J 2003 Three different promoters control expression of the aromatase cytochrome p450 gene (cyp19) in mouse gonads and brain. Biol Reprod 68:978–984[Abstract/Free Full Text]
  24. Fitzpatrick SL, Richards JS 1993 cis-Acting elements of the rat aromatase promoter required for cyclic adenosine 3',5'-monophosphate induction in ovarian granulosa cells and constitutive expression in R2C Leydig cells. Mol Endocrinol 7:341–354[Abstract/Free Full Text]
  25. Fitzpatrick SL, Richards JS 1994 Identification of a cyclic adenosine 3',5'-monophosphate-response element in the rat aromatase promoter that is required for transcriptional activation in rat granulosa cells and R2C Leydig cells. Mol Endocrinol 8:1309–1319[Abstract/Free Full Text]
  26. Carlone DL, Richards JS 1997 Functional interactions, phosphorylation, and levels of 3',5'-cyclic adenosine monophosphate-regulatory element binding protein and steroidogenic factor-1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292–304[Abstract/Free Full Text]
  27. Carlone DL, Richards JS 1997 Evidence that functional interactions of CREB and SF-1 mediate hormone regulated expression of the aromatase gene in granulosa cells and constitutive expression in R2C cells. J Steroid Biochem Mol Biol 61:223–231[CrossRef][Medline]
  28. Falender AE, Lanz R, Malenfant D, Belanger L, Richards JS 2003 Differential expression of steroidogenic factor-1 and FTF/LRH-1 in the rodent ovary. Endocrinology 144:3598–3610[Abstract/Free Full Text]
  29. Clyne CD, Speed CJ, Zhou J, Simpson ER 2002 Liver receptor homologue-1 (LRH-1) regulates expression of aromatase in preadipocytes. J Biol Chem 277:20591–20597[Abstract/Free Full Text]
  30. Hinshelwood MM, Repa JJ, Shelton JM, Richardson JA, Mangelsdorf DJ, Mendelson CR 2003 Expression of LRH-1 and SF-1 in the mouse ovary: localization in different cell types correlates with differing function. Mol Cell Endocrinol 207:39–45[CrossRef][Medline]
  31. Pezzi V, Sirianni R, Chimento A, Maggiolini M, Bourguiba S, Delalande C, Carreau S, Ando S, Simpson ER, Clyne CD 2004 Differential expression of Sf-1/Ad4bp and Lrh-1/Ftf in the rat testis: Lrh-1 as a potential regulator of testicular aromatase expression. Endocrinology 145:2186–2196[Abstract/Free Full Text]
  32. Liu DL, Liu WZ, Li QL, Wang HM, Qian D, Treuter E, Zhu C 2003 Expression and functional analysis of liver receptor homologue 1 as a potential steroidogenic factor in rat ovary. Biol Reprod 69:508–517[Abstract/Free Full Text]
  33. Tremblay JJ, Robert NM, Viger RS 2001 Modulation of endogenous GATA-4 activity reveals its dual contribution to Mullerian inhibiting substance gene transcription in Sertoli cells. Mol Endocrinol 15:1636–1650[Abstract/Free Full Text]
  34. Robert NM, Tremblay JJ, Viger RS 2002 Friend of GATA (FOG)-1 and FOG-2 differentially repress the GATA-dependent activity of multiple gonadal promoters. Endocrinology 143:3963–3973[Abstract/Free Full Text]
  35. Suzuki YJ, Day RM, Tan CC, Sandven TH, Liang Q, Molkentin JD, Fanburg BL 2003 Activation of GATA-4 by serotonin in pulmonary artery smooth muscle cells. J Biol Chem 278:17525–17531[Abstract/Free Full Text]
  36. Kitta K, Day RM, Kim Y, Torregroza I, Evans T, Suzuki YJ 2003 Hepatocyte growth factor induces GATA-4 phosphorylation and cell survival in cardiac muscle cells. J Biol Chem 278:4705–4712[Abstract/Free Full Text]
  37. Stocco CO, Lau LF, Gibori G 2002 A calcium/calmodulin-dependent activation of ERK1/2 mediates JunD phosphorylation and induction of nur77 and 20{alpha}-hsd genes by prostaglandin F2{alpha} in ovarian cells. J Biol Chem 277:3293–3302[Abstract/Free Full Text]
  38. Ericsson J, Usheva A, Edwards PA 1999 YY1 is a negative regulator of transcription of three sterol regulatory element-binding protein-responsive genes. J Biol Chem 274:14508–14513[Abstract/Free Full Text]
  39. Bennett MK, Ngo TT, Athanikar JN, Rosenfeld JM, Osborne TF 1999 Co-stimulation of promoter for low density lipoprotein receptor gene by sterol regulatory element-binding protein and Sp1 is specifically disrupted by the yin yang 1 protein. J Biol Chem 274:13025–13032[Abstract/Free Full Text]
  40. Nackley AC, Shea-Eaton W, Lopez D, McLean MP 2002 Repression of the steroidogenic acute regulatory gene by the multifunctional transcription factor Yin Yang 1. Endocrinology 143:1085–1096[Abstract/Free Full Text]
  41. Shi Y, Lee JS, Galvin KM 1997 Everything you have ever wanted to know about Yin Yang 1. Biochim Biophys Acta 1332:F49–F66
  42. Zeitoun K, Takayama K, Michael MD, Bulun SE 1999 Stimulation of aromatase P450 promoter (II) activity in endometriosis and its inhibition in endometrium are regulated by competitive binding of steroidogenic factor-1 and chicken ovalbumin upstream promoter transcription factor to the same cis-acting element. Mol Endocrinol 13:239–253[Abstract/Free Full Text]
  43. Noble LS, Simpson ER, Johns A, Bulun SE 1996 Aromatase expression in endometriosis. J Clin Endocrinol Metab 81:174–179[Abstract]
  44. Zhao Y, Agarwal VR, Mendelson CR, Simpson ER 1996 Estrogen biosynthesis proximal to a breast tumor is stimulated by PGE2 via cyclic AMP, leading to activation of promoter II of the cyp19 (aromatase) gene. Endocrinology 137:5739–5742[Abstract]
  45. Noble LS, Takayama K, Zeitoun KM, Putman JM, Johns DA, Hinshelwood MM, Agarwal VR, Zhao Y, Carr BR, Bulun SE 1997 Prostaglandin E2 stimulates aromatase expression in endometriosis-derived stromal cells. J Clin Endocrinol Metab 82:600–606[Abstract/Free Full Text]
  46. Morales V, Gonzalez-Robayna I, Hernandez I, Quintana J, Santana P, Ruiz de Galarreta CM, Fanjul LF 2003 The inducible isoform of CREM (inducible cAMP early repressor, ICER) is a repressor of CYP19 rat ovarian promoter. J Endocrinol 179:417–425[Abstract]
  47. Mukherjee A, Urban J, Sassone-Corsi P, Mayo KE 1998 Gonadotropins regulate inducible cyclic adenosine 3',5'-monophosphate early repressor in the rat ovary: implications for inhibin {alpha} subunit gene expression. Mol Endocrinol 12:785–800[Abstract/Free Full Text]
  48. Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P 1993 Inducibility and negative autoregulation of CREM: an alternative promoter directs the expression of ICER, an early response repressor. Cell 75:875–886[CrossRef][Medline]
  49. Della Fazia MA, Servillo G, Sassone-Corsi P 1997 Cyclic AMP signalling and cellular proliferation: regulation of CREB and CREM. FEBS Lett 410:22–24[CrossRef][Medline]
  50. Sridaran R, Gibori G 1981 Induction of luteolysis by dihydrotestosterone in the pregnant rat. Am J Physiol 241:E444–E448
  51. Legrand C, Marie J, Maltier JP 1984 Testosterone, dihydrotestosterone, androstenedione and dehydroepiandrosterone concentrations in placentae, ovaries and plasma of the rat in late pregnancy. Acta Endocrinol (Copenh) 105:119–125[Abstract/Free Full Text]
  52. Greisen S, Ledet T, Ovesen P 2001 Effects of androstenedione, insulin and luteinizing hormone on steroidogenesis in human granulosa luteal cells. Hum Reprod 16:2061–2065[Abstract/Free Full Text]
  53. Telleria CM, Stocco CO, Stati AO, Rastrilla AM, Carrizo DG, Aguado LI, Deis RP 1995 Dual regulation of luteal progesterone production by androstenedione during spontaneous and RU486-induced luteolysis in pregnant rats. J Steroid Biochem Mol Biol 55:385–393[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
R. L. Bogan, M. J. Murphy, R. L. Stouffer, and J. D. Hennebold
Systematic Determination of Differential Gene Expression in the Primate Corpus Luteum during the Luteal Phase of the Menstrual Cycle
Mol. Endocrinol., May 1, 2008; 22(5): 1260 - 1273.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
C. Stocco, J. Kwintkiewicz, and Z. Cai
Identification of regulatory elements in the Cyp19 proximal promoter in rat luteal cells
J. Mol. Endocrinol., October 1, 2007; 39(4): 211 - 221.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Kwintkiewicz, Z. Cai, and C. Stocco
Follicle-Stimulating Hormone-Induced Activation of Gata4 Contributes in the Up-Regulation of Cyp19 Expression in Rat Granulosa Cells
Mol. Endocrinol., April 1, 2007; 21(4): 933 - 947.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Stocco, C. Telleria, and G. Gibori
The Molecular Control of Corpus Luteum Formation, Function, and Regression
Endocr. Rev., February 1, 2007; 28(1): 117 - 149.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
M. Bielinska, S. Kiiveri, H. Parviainen, S. Mannisto, M. Heikinheimo, and D. B. Wilson
Gonadectomy-induced Adrenocortical Neoplasia in the Domestic Ferret (Mustela putorius furo) and Laboratory Mouse.
Vet. Pathol., February 1, 2006; 43(2): 97 - 117.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. F. Couse, M. M. Yates, B. J. Deroo, and K. S. Korach
Estrogen Receptor-{beta} Is Critical to Granulosa Cell Differentiation and the Ovulatory Response to Gonadotropins
Endocrinology, August 1, 2005; 146(8): 3247 - 3262.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. Foyouzi, Z. Cai, Y. Sugimoto, and C. Stocco
Changes in the Expression of Steroidogenic and Antioxidant Genes in the Mouse Corpus Luteum During Luteolysis
Biol Reprod, May 1, 2005; 72(5): 1134 - 1141.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stocco, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stocco, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals