| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
in Murine Luteal Cells: Implication of GATA-4
Department of Obstetrics, Gynecology & Reproductive Science, Yale University School of Medicine, New Haven, Connecticut 06520
Address all correspondence and requests for reprints to: Carlos Stocco, Department of Obstetrics, Gynecology & Reproductive Science, Yale University School of Medicine, 333 Cedar Street, P.O. 208063, New Haven, Connecticut 06520. E-mail: carlos.stocco{at}yale.edu.
| Abstract |
|---|
|
|
|---|
plays a key role in the regulation of luteal function at the end of pregnancy, the purpose of this investigation was to determine whether PGF2
affect the expression of P450arom in the CL before parturition. PGF2
decreased luteal P450arom mRNA and protein levels in vivo and in vitro. A decrease in P450arom mRNA was also observed in mice CL just before parturition, but this change did not take place in PGF2
receptor knockout mice. The time course of the decrease in P450arom mRNA by PGF2
reflected the P450arom mRNA half-life determined by actinomycin D. Moreover, nuclear run-on assay showed that PGF2
attenuates P450arom gene transcription. Gel shift assays revealed that GATA-4 binds to the P450aromatase promoter, and that such binding is increased by PGF2
. It is concluded that PGF2
decreases luteal P450arom mRNA levels at the end of pregnancy in rodents by inhibiting cyp19 expression. | Introduction |
|---|
|
|
|---|
Along with the rapid decrease in P450arom expression in the rat CL at the end of pregnancy, a dramatic rise in 20
-hydroxysteroid dehydrogenase (20
HSD) expression takes place (2). 20
HSD catabolizes progesterone to the inactive metabolite 20
-dihydroprogesterone. In rodents, inactivation of progesterone by 20
HSD causes the decrease in serum progesterone necessary for parturition to occur (3). Using mice rendered deficient for the prostaglandin (PG) PGF2
receptor and in vivo administration of PGF2
to d 19 pregnant rats, it was demonstrated that PGF2
induces luteal 20
HSD expression at the end of pregnancy in rodents (3). Considering that PGF2
plays a key role in the initiation of parturition (4), that estradiol is luteotropic in rats (5), and that changes in luteal P450arom and 20
HSD mRNA levels before parturition are diametrically opposite (2), we hypothesized that PGF2
may also induce luteal regression by inhibiting cyp19 expression in rats at the end of pregnancy.
This communication presents evidence indicating that PGF2
rapidly decreases P450arom mRNA levels when administered to pregnant rats on d 19 of pregnancy. Participation of PGF2
in the physiological decrease of P450arom expression at the end of pregnancy in rodents was confirmed by using PGF2
receptor knockout mice. In these mutant animals, no decrease in P450arom expression was observed. A direct effect of PGF2
on luteal cells is supported by in vitro experiments. Nuclear run-on assays support the conclusion that the effect of PGF2
on P450arom mRNA levels is mediated by an attenuation of cyp19 gene transcription. It is also shown that GATA-4 is expressed in the CL at the end of pregnancy, that this transcription factor binds to the P450arom promoter and that such binding is increased by PGF2
treatment in vivo and in vitro.
| Materials and Methods |
|---|
|
|
|---|
receptor knockout mice with a mixed genetic background of 129/Ola and C57BL/6 strains were used (4). Wild-type and PGF2
receptor knockout mice were maintained at 23 C under a 12-h light cycle. Virgin females (912 wk of age) housed overnight with males were checked the following morning for vaginal plug. The day the plug was found was counted as d 1 of pregnancy. Animal care and handling conformed to the National Institutes of Health (NIH) guidelines for animal research. The experimental protocol was approved by the Yale University Animal Resources Center.
Cell culture
Granulosa cells were obtained from immature rats treated with FSH (15 IU/rat) for 48 h. At this time, ovaries were isolated and granulosa cells obtained by puncture of preovulatory follicles. Cells were then cultured in DMEM-Ham F-12 (DMEM/F-12, 1:1) plus Nutridoma NS (Roche Molecular Biochemicals, Indianapolis, IN) and 0.1% of BSA in laminin (Roche)-coated wells. Immediately after plating, granulosa cells were treated with LH (500 ng/ml) overnight. After luteinization, cells were cultured for 3 d before the initiation of the experiments (6). To harvest cells after treatments, each well was washed twice with ice-cold PBS.
EMSA
Nuclear extract from CL or luteinized granulosa cells were homogenized in solution A [10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol]. Nuclei were obtained by 30-sec centrifugation at 4 C in an Eppendorf centrifuge and resuspended in solution B, which was similar to solution A except that it contained 420 mM NaCl, 5% (vol/vol) glycerol, and no KCl. Nuclei were rocked for 30 min at 4 C and then centrifuged at 14000 x g at 4 C for 20 min. The supernatant was then divided into portions and stored at 80 C. Double-stranded DNA probes spanning the regions 137 to 107 of the rat promoter were end-labeled with 32P and incubated with 5 µg of nuclear proteins for 30 min at 25 C in the presence of 0.1 µg/µl of poly (deoxyinosine-deoxycytosine). Samples were then loaded in a 6% polyacrylamide nondenaturing gel; electrophoresis was carried out in 0.5x Tris-borate-EDTA buffer at 4 C for 90 min. Free and bound probes were identified by autoradiography of dried gels. For supershift assay, nuclear extracts were preincubated with GATA-4 or GATA-6 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) for 15 min before the addition of labeled probe.
RNA isolation and semiquantitative RT-PCR analysis
Total RNA from frozen rat CL or mouse ovary was isolated using Tri-Reagent following the manufacturers instructions. For mRNA analysis by RT-PCR, 1 µg of total RNA was reverse-transcribed at 42 C using Advantage RT-for-PCR kit (Promega, Madison, WI) and later diluted to a final volume of 100 µl. The PCR mixture, containing specific oligonucleotide primers (500 pmol), deoxynucleotide triphosphate (150 µM), Taq DNA polymerase (1 U), was added to each tube containing 5 µl of reverse transcription (RT) product. Each PCR included also primers ß-actin used as an internal control. Before proceeding with the semiquantitative PCR, conditions were established such that the amplification of the products was in the exponential phase, and the assay was linear with respect to the amount of input RNA. Band intensity was determined by using the Image software from NIH.
Quantitative real-time PCR
Total RNA isolation and RT was performed as described above. To generate standard curves, P450arom cDNA was cloned into pCR 2.1 vector (Invitrogen Life Technologies, Carlsbad, CA), sequenced, and excised by restriction enzyme. Purified cDNA was diluted to concentrations ranging from 103 to 109 copies/5 µl. Five-microliter aliquots of standard cDNA or sample cDNA were combined with Lightcycler Master SYBR Green I (Roche), specific primers for rat P450arom, and water to 10 µl final volume. The sequences of the rat P450arom primers used are: sense, ctgctgatcatgggcctcct; antisense, ctccacaggctcgggttgtt. Real-time quantification of the PCR product in each cycle was carried out in a LightCycler real-time PCR machine (Roche) with the following cycling conditions: preincubation at 95 C for 2 min, followed by 40 cycles of denaturation at 95 C for 5 sec, annealing at 60 C for 10 sec, extension at 72 C for 10 sec. The melting peak of each sample was routinely determined by melting curve analysis to ascertain that only the expected products had been generated. The minimal number of cycles sufficient to produce detectable levels of fluorescence (Cp) was calculated using the Roche LightCycler software. The amount of P450arom mRNA molecules present in each sample was calculated using a standard curve (Fig. 1A
, inset) and expressed as copies per microgram of total RNA.
|
-treated rats were homogenized in ice-cold lysis buffer [10 mM Tris-Cl (pH 8.0); 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 40 µM phenylmethylsulfonyl fluoride, 0.3 µM aprotinin, and 1 µM leupeptin]. This was followed by 30-min incubation on ice and centrifugation at 10,000 x g for 20 min at 4 C. The supernatant was transferred to new tubes, aliquoted and stored at 70 C until the time of electrophoresis. An aliquot of the supernatant was kept for protein measurement using BSA as a standard. Samples were denatured by adding sample buffer [62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 0.01% bromophenol blue], followed by boiling for 10 min. Thirty micrograms of protein were separated on 10% SDS-PAGE gels in Tris-glycine, 0.1% SDS buffer, and transferred to nitrocellulose paper in 25 mM Tris, 192 mM glycine, and 20% methanol buffer at 250 mA for 1.5 h. Blots were incubated for 2 h at RT in 5% nonfat dry milk to block unspecific binding. Blots were then washed and incubated over night at 4 C with anti-P450arom antibody (Serotech, Oxford, UK) at a 1/4000 dilution, and were washed and incubated with a secondary antibody conjugated to horseradish peroxidase (1/6000 dilution) for 2 h at room temperature. Protein-antibody complexes were visualized using Western blotting luminol reagent following manufacturers protocol (Santa Cruz Biotechnology).
Isolation of nuclei and transcription run-on assays
Luteinized granulosa cells were washed three times with PBS and scraped in lysis buffer containing 0.5% Nonidet P-40, 10 mM KCl, 10 mM MgCl2, 10 mM HEPES (pH 7.9), and 0.5 mM ß-mercaptoethanol. Nuclei were collected by centrifugation, washed once by centrifugation in a lysis buffer without Nonidet P-40, and stored in liquid nitrogen in 50 mM Tris-HCl (pH 7.9), 5 mM MgCl2, 0.5 mM ß-mercaptoethanol, and 40% glycerol. Run-on transcription was carried out at 30 C for 45 min in a reaction mixture containing 5 x 106 nuclei and 10 mM biotin-16-uridine triphosphate (UTP) (Roche) in a final volume of 60 µl. RNA was extracted with TRIzol, ethanol-precipitated, and resuspended in 50 µl of diethylpyrocarbonate water. Biotinylated RNA was purified by adding streptavidin magnetic particles (Roche), followed by 2 h of incubation at 25 C in a rocking platform. Beads were separated with a magnet and washed two times with 2x standard sodium citrate-15% formamide for 15 min and twice with 2x standard sodium citrate for 5 min. Biotinylated RNA was finally dissolved in 10 µl of diethylpyrocarbonate water and used to prepare cDNA using random hexamer, following the protocol described above. Amplification of P450arom and ß-actin run-on RNA was performed using semiquantitative and real-time PCR.
Statistical analysis
The statistical analysis of data was performed using the Prism software (GraphPad Software, Inc., San Diego, CA). The statistical test used in each particular experiment is depicted in figure legend. All case values were considered statistically significant at P < 0.05.
| Results |
|---|
|
|
|---|
PGF2
effect on P450arom expression
To determine whether PGF2
affects luteal P450arom expression, d 19 pregnant rats were injected with PGF2
(400 µg/rat) or vehicle. Corpora lutea were isolated at 1, 3, 6, or 10 h after PGF2
administration. Luteal P450arom mRNA levels were determined by using quantitative and semiquantitative RT-PCR (Fig. 2A
). This time course analysis revealed that PGF2
rapidly decreased luteal P450arom expression. As early as 3 h after PGF2
treatment, a 3-fold decrease (P < 0.05) in the number of P450arom mRNA molecules per microgram of total RNA was observed. Six hours after treatment, P450arom mRNA levels in PGF2
-treated animals were 10 times lower than in vehicle-treated rats (P < 0.01, ANOVA I).
|
on P450arom protein levels was examined by Western blot analysis in corpora lutea extracted at different times after treatment with PGF2
or vehicle on d 19 of pregnancy. As expected, high levels of P450arom protein were detected in vehicle-treated animal; P450arom protein levels were significantly decreased 10 h after PGF2
treatment (Fig. 2A
Finally, using an in vitro system, we examined whether PGF2
decreases P450arom expression by acting directly on luteal cells. Luteinized granulosa cells were treated with 0.5 µM of PGF2
for 0.5, 1, 2, and 4 h. As shown in Fig. 2B
(left panel), this treatment caused a time-dependent decrease in P450arom mRNA levels. A dose-response effect of PGF2
on P450arom expression was also observed (Fig. 2B
, right panel).
P450arom mRNA levels in wild-type and PGF2
receptor knockout mice
To examine whether PGF2
is responsible for the rapid decrease in P450arom expression observed at the end of pregnancy, P450arom mRNA levels were determined in ovaries of wild-type or PGF2
receptor knockout animals on d 1820 of pregnancy. As with rats, a decrease in luteal P450arom mRNA levels in wild-type mice was observed just before parturition (Fig. 3
). In contrast, in PGF2
receptor knockout mice, P450arom remained highly expressed until d 20 of pregnancy.
|
on P450arom mRNA stability and cyp19 genes transcription rate
. To determine whether changes in P450arom mRNA levels are due to alteration of the transcription rate of the cyp19 gene, nuclear run-on assay was performed following the protocol of Patrone et al. (7). Transcription of active genes in nuclei isolated from cells treated with vehicle or PGF2
(0.5 µM) for 4 h was completed by the addition of ATP, GTP, and thymidine triphosphate and biotin-16-UTP. Biotin-16-UTP-labeled transcripts were purified using streptavidin magnetic particles. Total cDNA was then synthesized by means of random hexamer primed RT of captured biotin-RNA. Transcript abundance in cDNA, from run-on RNA or total RNA, was determined by quantitative real-time PCR and by relative semiquantitative PCR. ß-Actin was used as an internal control because it is constitutively expressed and its transcriptional rate is relatively constant. To monitor undesired RNA capture to beads, a control reaction was performed in which UTP was added in place of biotin-16-UTP; no signal for P450arom or for ß-actin was observed in these conditions (data not shown). As shown in Fig. 4A
when compared with control samples, whereas no changes for run-on ß-actin transcripts were observed.
|
affects the half-life of the P450arom mRNA, an inhibitor of RNA synthesis was used. Luteinized granulosa cells were divided into four groups, two of which were treated with actinomycin D, and the other two were treated with dimethylsulfoxide for 30 min. After this pretreatment, either vehicle or PGF2
(0.5 µM) was added. Cells were incubated for 2, 4, 8, and 16 h. At the end of this incubation, total mRNA was isolated and expression levels of P450arom and ß-actin were quantified. As shown in Fig. 4B
treatment. As expected, inhibition of RNA synthesis caused a progressive decrease in P450arom mRNA levels (Fig. 4B
treatment of actinomycin D pretreated cells did not affect this progressive decrease (Fig. 4B
(slopes: actinomycin D: 6.4 ± 0.8; actinomycin D plus PGF2
: 6.3 ± 0.5). The calculated half-life of P450arom in luteinized granulosa cells in both groups is of approximately 5 h.
P450arom proximal promoter is used in the rat CL throughout pregnancy
In rats, two P450arom promoters have been described thus far: the proximal promoter region, which controls P450arom expression in granulosa cells of the follicle (ovarian promoter) (8) and a brain promoter, which drives P450arom expression in this tissue (9). Evidence also indicates that P450arom expression in the rat CL seems to be regulated by mechanisms different from those present in granulosa cells (10), suggesting that a switch in P450arom promoter usage may occur during differentiation of granulosa cells into luteal cells. To examine this possibility and to determine which promoter may be regulated by PGF2
, the presence of transcripts specific to ovarian or brain promoters was investigated in the CL of pregnant rats. PCR was performed by amplifying the 5' regions of transcript variants encoded by the first exon. Specific primers for the ovarian exon I (11), or the brain exon I (9) and the common exon II (11), were used. As shown in Fig. 5A
, a unique transcript was found in the brain, whereas in the CL both brain and ovarian transcripts were detected. In the CL, transcripts produced by brain promoter were only detectable after 35 cycles of PCR, whereas ovarian transcripts were detectable after 22 cycles of PCR. Developmental studies (Fig. 5B
) revealed that expression levels of the ovarian transcript, but not those of the brain transcript, correlate with changes in P450arom coding sequence.
|
in the CL, we aligned and compared the sequence of this promoter region in rats, mice and humans. These species are known to express P450arom in the CL and possess a single-copy of this gene (12). We also scanned these promoters for transcription factor binding sequences, using the Transfac database (13). As depicted by bold sequences in Fig. 6
|
This analysis also revealed the presence of a putative binding site for the Yin Yang 1 (YY1) transcription factor located immediately downstream from the SF-1 binding site in rats and mice, but separated from SF-1 by the inserted region B in humans.
GATA-4 binds to the proximal promoter of the cyp19 gene
Gel shift analysis was used to determine whether PGF2
affects protein binding to the conserved region S2, previously identified as a silencer element. For this experiment, nuclear extracts from CL of vehicle- or PGF2
-treated rats, and oligonucleotides containing the two GATA response elements found in the S2 region, were used (Fig. 7A
). As shown in Fig. 7B
two bandshifts were observed. Interestingly, an increase in the intensity of the top band occurred in PGF2
-treated samples, when compared with controls. This increase in protein binding was also observed in vitro after treatment of luteinized granulosa cells with PGF2
. Addition of unlabeled GATA probe in excess completely prevented the formation of the shifted bands (Fig. 7C
), whereas 100x excess of an unlabeled probe containing a mutation in the two GATA binding sites did not block their formation.
|
. | Discussion |
|---|
|
|
|---|
, a well-known luteolytic hormone, rapidly decreases P450arom mRNA and protein levels in rodents luteal cells. These results are further supported by the sustained levels of P450arom at the end of pregnancy observed in the PGF2
receptor null mice. In vitro experiments showing that PGF2
decreases P450arom expression in luteinized granulosa cells cultured in serum-free media, suggest a direct effect of PGF2
on these cells. Our results have also provided a quantification of the dramatic decrease (10-fold) in P450arom expression that takes place between d 21 and 22 of pregnancy in the rat CL.
It has been recently demonstrated that PGF2
increases P450arom expression in human (20) and pig (21) luteal cells, suggesting a species-specific effect of PGF2
. Because the proximal promoter drives P450arom expression in human luteal cells (22), it is possible that the inserted sequence found in the human P450arom promoter (regions A and B in Fig. 6
) may be responsible for the differential effect of PGF2
on the expression of P450arom among species. For instance, in rodents, a nuclear receptor half-site (NRHS) and an YY1 binding site are contiguous, but are separated by region B in humans. It is possible that YY1 interferes with NRHS activation in rodents but not in humans (see below).
Nuclear run-on experiments indicated that PGF2
attenuates the transcription rate of the cyp19 gene in rat luteal cells. P450aroms half-life was not affected by PGF2
, further indicating an effect in the activity of the cyp19 promoter. It is well known, at least in humans, that the usage of alternative promoters is the key mechanism conferring tissue-specific expression of the cyp19 gene. As mentioned before, two P450arom promoters have been described in rats: the proximal promoter region denoted ovarian promoter (8) and the brain promoter (9). In this communication, the specific untranslated first exon produced by the two alternative promoters of the cyp19 gene was determined in the rat CL during pregnancy. The results indicated that both promoters are active in luteal cells; however, brain transcripts are expressed at much lower levels than the ovarian transcripts. This result agrees with the expression levels for brain and ovary transcript previously found in the mouse ovary (23), and indicates that P450arom expression in the CL, as it is in the follicle, is attributable to the activation of the proximal promoter. Developmental studies revealed that expression levels of the ovarian promoter transcript, but not those of the brain promoter, correlate with changes in P450arom coding sequence. Transcription factors that control the cyp19 proximal promoter in rat luteal cells during pregnancy and the mechanism by which PGF2
decreases the activity of this promoter remain to be determined.
The activity of the proximal cyp19 promoter in granulosa cells is regulated by FSH, which by raising intracellular cAMP levels, stimulates P450arom expression by acting in two different cis elements (24, 25). The most proximal element, a NRHS, binds SF-l, whereas the distal element contains a cAMP response element (CRE) that binds the CRE binding protein (CREB) (Fig. 6
). Mutational analyses have demonstrated that SF-1 and CREB interact in an additive manner to increase cyp19 expression in granulosa cells (26, 27). However, estradiol production by luteal cells seems to be regulated by mechanisms different from those of granulosa cells. Several evidences indicate that P450arom expression is maintained by cAMP-independent mechanisms in the CL. For instance, P450arom mRNA levels are not affected by forskolin treatment in luteinized granulosa cells (10). Moreover, in the CL, CREB phosphorylation does not correlate with levels of P450arom expression (10). In luteal cells, phospho-CREB resides in the cytoplasmic region, not in the nucleus (10), further suggesting that the cAMP-protein kinase A pathway is not involved in the regulation of luteal P450arom expression.
Participation of SF-1 in the regulation of the cyp19 proximal promoter in luteal is also not clear. Although SF-1 expression decreases during luteinization (8, 26), this factor is expressed in the CL of pregnant rats (28). Recently, a transcription factor called liver receptor homolog-1 (LRH-1), which is closely related to SF-1, has been shown to regulate P450arom (29, 30, 31) by interacting with the NRHS found in the proximal cyp19 promoter (28, 31). LRH-1 in expressed in granulosa cells and, like SF-1, decreases during luteinization (28). Prolactin, the main luteotropic hormone in rodents, restores LRH-1, but not SF-1, expression (28). LRH-1 has also been detected in the CL of pregnant rats (28, 32). An in situ hybridization study shows that luteal expression of LRH-1 and P450arom overlap at certain stages during pregnancy; however, this study also reveals that the expression of LRH-1 and P450arom does not change in a parallel manner (32). For instance, LRH-1 expression is low after d 18 of pregnancy but P450arom remains highly expressed until d 21 (32). Similar studies had not been conducted for SF-1. This evidence suggests that although LRH-1 may regulate P450arom expression in the CL, other factors seem to be involved. In this study, we have shown that GATA-4 is expressed in luteal cells of d 19 pregnant rats and binds the cyp19 promoter, suggesting that this transcription factor may also be implicated in the regulation of P450arom expression in the rat CL. Interestingly, GATA-4 binding is increased by treatment with PGF2
, which inhibits P450arom expression. These results do not agree with overexpression experiments, which suggests that GATA factors may up-regulate P450arom in Sertoli cells (33, 34). It is possible that the effect of GATA on P450arom expression is cell type specific. Because actinomycin D did not prevent the effect of PGF2
on P450arom expression, the increase in GATA-4 binding induced by PGF2
is apparently not due to stimulation of GATA-4 expression. Because GATA-4 has recently been shown to be phosphorylated through the ERK1/2 pathway (35, 36) and because PGF2
is known to increase ERK1/2 phosphorylation in rat luteal cells (37), we postulate that PGF2
activates GATA-4 binding activity throughout a ERK1/2-dependent pathway.
Of interest is the presence of a putative binding site for YY1 in the cyp19 proximal promoter. This factor has been implicated in the down-regulation of steroidogenic genes such as 3-hydroxy-3-methylglutaryl coenzyme A synthase, farnesyl diphosphate synthase, and low-density lipoprotein receptor (38, 39). In the rat ovary, YY1 protein levels increase after treatment of pseudopregnant rats with PGF2
. In this model, YY1 appears to mediate PGF2
inhibition of steroidogenic acute regulatory protein mRNA expression (40). Multiple mechanisms for YY1 inhibition of transcription have been proposed (41). One mechanism involves YY1 interference with the function of a transcriptional activator. Interestingly, we have found that in the rat and mouse, the putative YY1 binding site is placed immediately downstream of the NRHS (Fig. 6
), which is recognized by SF-1 and LRH-1. It is possible to speculate that if YY1 binds to the cyp19 promoter, it may interfere with SF-1/LRH-1 activity.
The NRHS may also be directly involved in the inhibition of cyp19 expression. Thus, it has been shown that the chick ovalbumin upstream promoter factor (COUP-TF), an inhibitory orphan nuclear receptor, silences the cyp19 gene in eutopic endometrial stromal cells (42), where P450arom is almost undetectable (42, 43). P450arom, however, becomes expressed in a number of uterine tumors, such as endometrial cancer and endometriotic plaques (43), via the stimulatory action of the cAMP/CREB system (44, 45) and SF-1 (42). SF-1 displaces COUP-TF by directly competing for occupancy of the NRHS (42). Whether COUP-TF is involved in the inhibition of cyp19 expression by PGF2
in rat luteal cells is currently under investigation.
Finally, the CRE that mediates cyp19 stimulation on granulosa cells has been recently proposed to mediate the suppression of P450arom by LH during luteinization (46). It is known that the preovulatory surge of LH increases the expression of the cAMP early repressor (ICER) (47). ICER is an early response repressor that is rapidly expressed when needed (48). ICER binds CRE but is devoid of the kinase inducible and transactivation domains (49). This unique feature of ICER may possibly postulate that ICER displaces CREB from its binding site, decreasing cAMP-dependent transcription. However, P450arom expression is cAMP-independent in luteal cells, and considering that the effect of PGF2
does not require RNA synthesis, it is unlikely that ICER mediates PGF2
inhibition.
Our initial hypothesis suggesting that PGF2
may also induce luteal regression by inhibiting the production of luteal estradiol in rats at the end of pregnancy was mainly based on the fact that 17ß-estradiol stimulates both progesterone biosynthesis and luteal cell hypertrophy in pregnant rats (5). However, a decreased capacity of the CL to aromatize androgen could play an important role in the normal progress of luteolysis, not only by diminishing intraluteal levels of 17ß-estradiol, but also by increasing intraluteal levels of androstenedione. It has been demonstrated that administration of dihydrotestosterone, a nonaromatizable androgen, induces abortion by acting directly at the ovarian level (50). Interestingly, in rats, ovarian androgen concentration shows a sharp increase from d 21 to term, particularly androstenedione and testosterone levels, which increase by 49% and 87%, respectively (51). In addition, it has been shown that androstenedione reduces progesterone production in luteal cells (52, 53). Therefore, at the end of pregnancy, an increase in intraovarian levels of androgens along with a block in aromatization could facilitate the normal progress of luteolysis.
In conclusion, it is clear that PGF2
is accountable for the dramatic decrease in P450arom expression that takes place at the end of pregnancy in the CL of rats and mice. Because estrogens are not only critical regulators of reproductive processes, but also are involved in the development of several human pathologies including breast cancer and endometriosis, these results may contribute to an understanding of the mechanisms controlling P450arom expression in cancer cells, especially considering that the same cyp19 promoter is used in the CL, endometriotic plaque, and breast tumors.
| Acknowledgments |
|---|
-R null mice. | Footnotes |
|---|
HSD, 20
-hydroxysteroid dehydrogenase; ICER, cAMP early repressor; LRH-1, liver receptor homolog-1; NRHS, nuclear receptor half-site; P450arom, P450aromatase; PG, prostaglandin; RT, reverse transcription; SDS, sodium dodecyl sulfate; SF-1, steroidogenic factor-1; UTP, uridine triphosphate; YY-1, Yin Yang 1. Received May 17, 2004.
Accepted for publication July 12, 2004.
| References |
|---|
|
|
|---|
-hydroxysteroid dehydrogenase enzymes in immature, mature, and pregnant rats. Endocrinology 138:28862892
induced expression of 20
-hydroxysteroid dehydrogenase involves the transcription factor NUR77. J Biol Chem 275:3720237211
increases aromatase expression in human luteal cells. Program of the 86th Annual Meeting of The Endocrine Society, New Orleans, LA, 2004, p 29 (Abstract P1-126)
regulation of steroid hormone receptors and estradiol biosynthesis in pig corpora lutea. Biol Reprod 70:13331339
-hsd genes by prostaglandin F2
in ovarian cells. J Biol Chem 277:32933302
subunit gene expression. Mol Endocrinol 12:785800This article has been cited by other articles:
![]() |
R. L. Bogan, M. J. Murphy, R. L. Stouffer, and J. D. Hennebold Systematic Determination of Differential Gene Expression in the Primate Corpus Luteum during the Luteal Phase of the Menstrual Cycle Mol. Endocrinol., May 1, 2008; 22(5): 1260 - 1273. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Stocco, J. Kwintkiewicz, and Z. Cai Identification of regulatory elements in the Cyp19 proximal promoter in rat luteal cells J. Mol. Endocrinol., October 1, 2007; 39(4): 211 - 221. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kwintkiewicz, Z. Cai, and C. Stocco Follicle-Stimulating Hormone-Induced Activation of Gata4 Contributes in the Up-Regulation of Cyp19 Expression in Rat Granulosa Cells Mol. Endocrinol., April 1, 2007; 21(4): 933 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Stocco, C. Telleria, and G. Gibori The Molecular Control of Corpus Luteum Formation, Function, and Regression Endocr. Rev., February 1, 2007; 28(1): 117 - 149. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bielinska, S. Kiiveri, H. Parviainen, S. Mannisto, M. Heikinheimo, and D. B. Wilson Gonadectomy-induced Adrenocortical Neoplasia in the Domestic Ferret (Mustela putorius furo) and Laboratory Mouse. Vet. Pathol., February 1, 2006; 43(2): 97 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Couse, M. M. Yates, B. J. Deroo, and K. S. Korach Estrogen Receptor-{beta} Is Critical to Granulosa Cell Differentiation and the Ovulatory Response to Gonadotropins Endocrinology, August 1, 2005; 146(8): 3247 - 3262. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Foyouzi, Z. Cai, Y. Sugimoto, and C. Stocco Changes in the Expression of Steroidogenic and Antioxidant Genes in the Mouse Corpus Luteum During Luteolysis Biol Reprod, May 1, 2005; 72(5): 1134 - 1141. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |