help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2004-0159
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Papasani, M. R.
Right arrow Articles by Rubin, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Papasani, M. R.
Right arrow Articles by Rubin, D. A.
Endocrinology Vol. 145, No. 11 5294-5304
Copyright © 2004 by The Endocrine Society

Identification and Characterization of the Zebrafish and Fugu Genes Encoding Tuberoinfundibular Peptide 39

Madhusudhan R. Papasani, Robert C. Gensure, Yi-Lin Yan, Yasemin Gunes, John H. Postlethwait, Bhaskar Ponugoti, Markus R. John, Harald Jüppner and David A. Rubin

Department of Biological Sciences (M.R.P., B.P., D.A.R.), Illinois State University, Normal, Illinois 61790; Endocrine Unit (R.C.G., Y.G., H.J.), Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114; Institute of Neuroscience (Y.-L.Y., J.H.P.), University of Oregon, Eugene, Oregon 97403; and Novartis Institutes for BioMedical Research (M.R.J.), Bone Metabolism Research, CH-4002 Basel, Switzerland

Address all correspondence and requests for reprints to: David A. Rubin, Department of Biological Sciences, Illinois State University, Normal, Illinois 61790. E-mail: adavid{at}ilstu.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although the PTH type 2 receptor (PTH2R) has been isolated from mammals and zebrafish, only its mammalian agonist, tuberoinfundibular peptide 39 (TIP39), has been characterized thus far. To determine whether zebrafish TIP39 (zTIP39) functions similarly with the zebrafish PTHR (zPTH2R) and human PTH2Rs and to determine its tissue-specific expression, fugu (Takifugu rubripes) and zebrafish (Danio rerio) genomic databases were screened with human TIP39 (hTIP39) sequences. A single TIP39 gene was identified for each fish species, which showed significant homology to mammalian TIP39. Using standard molecular techniques, we isolated cDNA sequences encoding zTIP39. The fugu TIP39 precursor was encoded by a gene comprising at least three exons. It contained a hydrophobic signal sequence and a predicted prosequence with a dibasic cleavage site, similar to that found in mammalian TIP39 ligands. Phylogenetic analyses suggested that TIP39 forms the basal group from which PTH and PTHrP have been derived. Functionally, subtle differences in potency could be discerned between hTIP39 and zTIP39. The human PTH2R and zPTH2R were stimulated slightly better by both hTIP39 and zTIP39, whereas zTIP39 had a higher potency at a previously isolated zPTH2R splice variant. Whole-mount in situ hybridization of zebrafish revealed strong zTIP39 expression in the region of the hypothalamus and in the heart of 24- and 48-h-old embryos. Similarly, zPTH2R expression was highly expressed throughout the brain of 48- and 72-h-old embryos. Because the mammalian PTH2R was also most abundantly expressed in these tissues, the TIP39-PTH2R system may serve conserved physiological roles in mammals and fishes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN MAMMALS, PTH is the major regulator of calcium-phosphate homeostasis (1), whereas PTHrP serves multiple roles, including a regulatory role in chondrocyte differentiation and proliferation, breast development, tooth eruption, and cardiac development (2, 3). Recently mammalian tuberoinfundibular peptide 39 (TIP39), a peptide distantly related to PTH and PTHrP, was purified from bovine brain (4). Subsequently cDNAs encoding mouse and human TIP39 were isolated from brain mRNAs (4, 5, 6). Although PTH has the capability of stimulating the human PTH type 2 receptor (PTH2R) expressed in vitro in HEK293 or COS-7 cells (7, 8), it has limited ability to stimulate cAMP accumulation in cells expressing PTH2Rs from other species, including zebrafish (9, 10). In contrast, all known PTH2Rs are activated with high efficiency and efficacy by human TIP39 (hTIP39), indicating that this peptide is the primary ligand for PTH2Rs, including the zebrafish PTH2R (zPTH2R) (11).

Studies of mammalian TIP39 indicate that the PTH2R-TIP39 endocrine system is likely to have physiological roles that are distinct from those of PTH and PTHrP (12, 13, 14). Indeed, it has been hypothesized that the TIP39-PTH2R system may have physiological roles in the regulation of GH secretion (4, 15), pain perception (16), release of hypothalamic hormones (4, 12, 17), regulation of anxiety and depression (18), or cardiovascular and renal hemodynamics (13, 14, 19). Little is known about the biological function of TIP39 and its receptor in fishes. However, studies in nonmammalian vertebrates may help gain insights into its roles in mammals.

Human TIP39-PTH chimeras are potent antagonists at the human PTH1R (20), indicating that both peptides assume similar secondary structures. Furthermore, some human TIP39 analogs were shown to be potent antagonists at the human PTH1R (11). Study of nonmammalian TIP39 may further enhance development of potent agonists and antagonists at the PTH1R and PTH2R, and it is possible that such analogs may aid in improving treatments for diseases such as osteoporosis, hyperparathyroidism, and humoral hypercalcemia of malignancy.

Presently information regarding the potential role(s) of TIP39 and PTH2R during embryonic development are lacking, in part, due to difficulty of studying in utero development in mammals. In contrast, zebrafish transparency allows for monitoring of early development, thus allowing more readily than is possible in mammals studies to explore the biological roles of the TIP39-PTH2R system. Developmental studies in basal vertebrates, such as teleosts, may thus yield insights that are not readily apparent in the more derived mammals. To facilitate such studies, we identified genomic DNA sequences encoding TIP39 from two phylogenetically distant teleost fishes, the zebrafish (Danio rerio) and the pufferfish (Takifugu rubripes) and then isolated a full-length cDNA and a presumed splice variant, which both encode zebrafish TIP39 (zTIP39). We furthermore defined the putative organization of the fugu TIP39 (fTIP39) gene; used synthetic zTIP39 to stimulate cAMP accumulation in COS-7 cells expressing the zPTH2R and its human homolog, hPTH2R; and determined the tissue-specific expression of both zTIP39 and zPTH2R by performing whole-mount in situ hybridization on zebrafish embryos. The use of two distantly related fishes not only allowed for a more robust statement on the conservation of TIP39 in fishes but also provided the necessary sequences with which to determine the phylogenetic relationship among the known members of the PTH-PTHrP-TIP39 family of ligands.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of putative fTIP39 and zTIP39 transcripts
hTIP39 cDNA (5) was used as a probe to search the T. rubripes genome databases (http://www.fugu.hgmp.mrc.ac.uk/blast/, http://134.174.23.160/compGenomics/) for homologous sequences. A single genomic DNA sequence encoding fTIP39 (T004305 Scaffold_4305) was identified and translated (http://searchlauncher.bcm.tmc.edu/seq-util/seq-util.html). The deduced amino acid sequence showed similarity to hTIP39. Subsequently this sequence was used as a probe to further screen the zebrafish (D. rerio) genomic databases (http://www.sanger.ac.uk/Projects/d_rerio/; http://134.174.23.160/compGenomics/). Two genomic sequences (zfishB-a2455h01.p1c, zfishI-a211c03.q1c) were identified, which showed significant sequence identity to the genomic DNA sequence encoded by fTIP39. Further searches were performed using the fugu Scaffold_4305 of the Sanger zebrafish genome database (http://pre.ensembl.org/Danio_erio/) to identify sequences (ctg9592.2 and z06s017096) that contained a zTIP39-like gene. Gene-specific primers for zTIP39 were designed for RT-PCR and 5' and 3' rapid amplification of cDNA ends (RACE) reactions.

RNA isolation, RT-PCR, RACE, and DNA sequencing
Total zebrafish RNA was obtained using the microRNA isolation kit (Promega, Madison, WI) as previously described (9, 21). To identify the 5'end of the cDNA encoding zTIP39, approximately 1 µg of Dnase-treated total RNA from zebrafish was reverse transcribed using Omniscript II reverse transcriptase (Qiagen, Hilden, Germany) and a gene-specific reverse primer zTIP3ut#1 (5'TTTTCCCTATACCATACTTTATA). One tenth of the RT-PCR product was used for an initial PCR consisting of reverse zTIP3ut#2 (5'TTACAATTACTTTGAATTAACTAC), forward zTIP5ut#2 (5'GAGTGTTAGAGAGAAACTCTG), and Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), with the following reaction profile: initial denaturation at 94 C for 3 min and 35 cycles with denaturation at 94 C for 1 min, annealing at 54 C for 1 min, polymerization at 72 C for 2 min, and final extension at 72 C for 10 min. A nested PCR (nPCR) using 2 µl of the initial PCR product was performed using reverse zTIP3ut#2 (5'TTACAATTACTTTGAATTAACTAC) and forward zTIP5ut#3 (5'CATGGACGATTTGCGAATTAG) following the same reaction profile. The 5' RACE amplicons were electrophoresed through a 2% agarose gel containing ethidium bromide, purified, ligated to pGEM-Teasy (Promega), and named zTIP39–5RACE/pGEMT (21) and used to transform Escherichia coli TOP10 cells (Invitrogen). Bacterial colonies were screened by PCR using gene-specific primers. Plasmids containing zTIP39 DNAs were purified using Concert miniprep (Life Technologies, Grand Island, NY) and sequenced according to the manufacturer’s protocols (ABI, PerkinElmer Corp., Foster City, CA).

To identify the 3'end of the cDNA encoding zTIP39, total RNA was converted into cDNA using superscript II reverse transcriptase and an oligo-dTTP adapter-anchor primer (5'GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT) containing unique restriction endonuclease sequences (Invitrogen). cDNA amplicons were amplified by PCR using forward zTIP5ut#2 and an adapter primer [abridged universal amplification primer (AUAP), 5'GGCCACGCGTCGACTAGTAC] by following the same PCR profile described above except for an annealing temperature of 56 C for 1 min for 35 cycles. This reaction was followed by a nested amplification using forward zTIP5UT#3 and the AUAP adapter primer at an annealing temperature of 58 C for 40 cycles. Five microliters of the nPCR product was reamplified in a second nPCR using the above profile with the AUAP adapter primer and forward zTIPM (5'CGTGATTGGAGCATTCAGATG). The 3'-RACE cDNAs for zTIP39 were isolated, subcloned into pGEM-Teasy and named zTIP39–3RACE/pGEMT, screened, and sequenced as described above. The translated zTIP39 cDNA sequence yielded an orthologous TIP39 peptide.

Kyte-Doolittle hydrophobicity plots for zTIP39 and fTIP39 amino acid sequences were generated (http://bioinformatics.weizmann.ac.il/hydroph/cmp_hydph.html; http://us.expasy.org/cgi-bin/protscale.pl). Putative cleavage sites within the TIP39 precursors were predicted using SignalP V2.0b2 of the Center for Biological Sequence Analysis, BioCentrum-DTU, Technical University of Denmark (http://www.cbs.dtu.dk/services/SignalP-2.0/) (5). DNA sequence analyses and comparisons were performed using blast, translation, and alignment algorithms (http://www.ncbi.nlm.nih.gov/BLAST/, http://www.searchlauncher.bcm.tmc.edu/seq-util.html).

Determination of putative intron/exon boundaries
The intron/exon structure of the fTIP39 gene was determined using Grail Experimental Gene Discovery Suite (Baylor College of Medicine Human Genome Sequencing Center, http://www.searchlauncher.bcm.tmc.edu/seq-search/gene-search.html) to search for putative introns, and the Splice Site Prediction by Neural Networks (Berkeley Drosophila Genome Project, http://www.fruitfly.org/seq_tools/splice.html) to predict the locations of RNA splice sites.

Peptide synthesis
The peptides, zTIP(1–39) and hTIP(1–39) (5), were synthesized at the Biopolymers Core Facility at Massachusetts General Hospital (Boston, MA) by a solid-phase method on a PerkinElmer model 430A and 431A synthesizer. All peptides were purified to homogeneity by reversed-phase chromatography, and amino acid sequences were confirmed by analysis of amino acid composition and amino acid sequence and mass spectroscopy.

cAMP accumulation assays
COS-7 cells were transiently transfected with cDNAs encoding hPTH2R, zPTH2R, or zPTH2R #43–9 splice variant (zPTH2R SV) using Effectene reagent (Qiagen, Valencia, CA). After 72 h, cells were treated with 0–10–6 M of either zTIP39 or hTIP39 in HEPES-buffered DMEM (pH 7.4) containing 2 mM isobutyl methylxanthine and 0.1% BSA for 60 min at room temperature. After rinsing, intracellular cAMP accumulation was measured by RIA as previously described (9, 22). The number of wells for each data point in each experiment was two (six total for all experiments). Thus, the data presented are the mean ± SD of three combined experiments (as are the results shown in Table 2Go). The algorithm for curve fitting was a sigmoidal dose-response, and the analysis program used was GraphPad Prism (GraphPad, San Diego, CA).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Activation of COS-7 cells transiently expressing PTH2R by human and zebrafish TIP(1–39)

 
Zebrafish whole-mount in situ hybridization
TIP39 antisense RNA probe was produced by linearizing zTIP39–5'RACE/pGEMT with MfeI and then transcribing the cDNA using the digoxigenin (DIG) RNA labeling kit following the manufacturer’s instructions (Roche Applied Science, Indianapolis, IN). The zTIP39 probe was used for whole-mount in situ hybridization on 24 and 48 h post fertilization (hpf) zebrafish embryos as described (23). A similar protocol was used to generate antisense zebrafish sonic hedgehog (shh) RNA for in situ hybridization on 48-hpf zebrafish embryos. After obtaining electronic images of the zTIP39 in situ hybridization whole-mount embryos, the embryos were embedded and sectioned at 10 µM to determine the tissue-specific expression.

zPTH2R antisense RNA probe was produced by linearizing zPTH2R/pcrBlunt (#43–9) (9) with BamHI and then transcribing the cDNA using the DIG RNA labeling kit as described above. The zPTH2R probe was used for whole-mount in situ hybridization on 48 and 72 hpf zebrafish embryos following the methods described by Jowett (24) and Nüsslein-Volhard and Dahm (25). The following reagents were used to reduce background: 150 mM malic acid in a 2% blocking reagent (Roche Applied Science) (24), 2 mM 1-phenyl-2-thiourea at 24-hpf (25, 26), and 1 mM levamisole added to the staining buffer (26). Following in situ hybridization, electronic images were taken on a Retiga (Burnaby, British Columbia, Canada) 1300 cooled CCD camera mounted on an SZX12 stereomicroscope (Olympus, Tokyo, Japan) using QCapture software on a G4 Power Mac (http://www.Qimaging.com).

Sequence alignment and phylogenetic analyses
To examine the relationships between TIP39 and the family of PTH and PTHrP ligands, phylogenetic analyses were performed using all currently available species of these three peptides as previously described (5, 27). With the exception of equine PTH and bovine TIP39 for which precursor sequences were not available, complete amino acid sequences, which included the full-length prepro peptides, were used for alignment by T-Coffee and Dialign algorithms (28, 29, 30). T-Coffee and Dialign algorithms were used because they allow for a more accurate alignment, compared with ClustalW for sequences with less than 30% identity (28, 29, 30). The aligned amino acid sequences were subsequently entered into MacClade 4.0 (31) with manual adjustments as described (32) and analyzed using distance as the criteria by Neighbor-Joining and heuristic algorithms with PAUP version 4.0b10 (33). For each analysis, 10,000 bootstrap and jackknife replicates were performed in which the human gastrointestinal-inhibitory peptide (GIP) was used as the outgroup, whereas secretin (human, pig, and mouse) and all known homologs of PTH, PTHrP, and TIP39 formed the ingroups.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of clones encoding zTIP39 and fTIP39
The cDNA sequence encoding hTIP39 was used as a probe to search fugu genome databases for similar sequences. A single gDNA sequence (T004305 Scaffold_4305) was identified which showed significant homology to exon 2 of the mammalian TIP39 gene and was therefore considered to represent a putative fTIP39 exon 2 (5, 6, 16). The fTIP39 exon 2 sequence was predicted to encode the prosequence and the mature secreted fTIP(1–39) (Figs. 1Go and 2Go). Although a comparison between the teleost and mammalian signal peptide and leader sequences could not be performed due to a lack of sequence conservation, sequences beginning at the conserved Trp–11 through the Ser+38 or Ala+38 residues showed, in comparison with hTIP39, an amino acid identity of 48% (24/49) and a similarity of 78% (39/49) (Figs. 1Go and 2Go, and Table 1Go).



View larger version (76K):
[in this window]
[in a new window]
 
FIG. 1. Nucleotide sequence of the fTIP39 gene. The putative mature mRNA encoding fTIP39 was deduced from zTIP39 cDNA sequences. Exonic regions are capitalized, nucleotides in flanking intervening DNA sequences are lowercased. The initiator ATG, with an upstream in-frame stop codon (tag), is shown in bold and represents the putative initial methionine and thus the start of the signal peptide. The splice donor and acceptor sites, with an intervening vertical bar (|), are bold. The stop codon has an * below its corresponding nucleotide sequence, and the polyadenylation sequence is shown in underlined lowercase letters. Residues found in the putative preproprotein of fTIP39 are capitalized and indicated below their corresponding nucleotide sequence. Based on the cDNA sequence encoding zTIP39, the first residue of the translated mature TIP39 sequence is designated as +1 (N).

 


View larger version (14K):
[in this window]
[in a new window]
 
FIG. 2. Comparison of the structures for the human and fTIP39 genes. Boxed areas represent exons, and their names are shown underneath. The box representing exon U1 is open on the left side because the 5' end of this exon is currently unknown. White boxes denote presequences, black boxes denote the putative prosequences, stippled boxes denote the mature sequences, and noncoding regions are shown as striped boxes. The small striped box preceding the white boxes denote presumed untranslated exonic sequences. The positions of the initiator methionine based on the secreted peptide and the positions at which prosequences are interrupted by an intron are noted above the graphs. Intron sizes are noted below the //; and +1 denotes the relative position of the beginning of the secreted peptide.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. TIP39 nucleotide and amino acid sequence comparisons

 
The fTIP39 gene structure was initially determined using Grail Experimental Gene Discovery Suite to search for putative introns, and the Splice Site Prediction program (Neural Networks) was used to predict the locations of RNA splice sites. Based on these analyses, the fTIP39 gene was predicted to have three exons (a presumed 5'-untranslated exon, and the coding exons 1 and 2), which would be similar to the organization of the murine and the human TIP39 genes (5, 6, 16) (Figs. 1Go and 2Go). Differences between fTIP39 and mammalian TIP39 genes were restricted to the size of the introns and the length of the presumed fTIP39 exon 1 (Fig. 2Go). Once it was determined that fTIP39 and hTIP39 genes were homologous, genomic DNA encoding fTIP39 was used as a probe to tblastn search zebrafish genome databases for homologous sequences.

Two zebrafish genomic DNA sequences (zfishB-a2455h01.p1c, zfishI-a211c03.q1c) were identified, which showed 81% nucleotide sequence identity (100 of 122 nucleotides were identical despite two gaps encoding the peptide sequence Val–3 through Ser+38) to the putative fTIP39 exon 2 sequence (Fig. 1Go). Further tblastn analyses were performed on the Sanger zebrafish genome database (http://pre.ensembl.org/Danio_rerio/) identifying contig genomic DNA sequences (ctg9592.2 and z06s017096) containing a zTIP39-like gene with homology to fTIP39 and mammalian TIP39 (5, 6, 16). The presumed zTIP39 gene, although having a complete exon 2 and a 5' untranslated region sequence with limited homology to the 5' untranslated region of the fTIP39 gene (Figs. 1Go and 2Go), did not appear to have an exon 1 sequence encoding a putative signal peptide. To determine whether the TIP39-like zebrafish gene is expressed and to confirm the predicted intron-exon structure, zTIP39-specific primers for zTIP39 were designed for amplification by RT-PCR.

Teleost cDNAs encoding TIP39 and further definition of the gene structure
RT-PCR on total zebrafish RNA using zTIP39-specific primers amplified a 505-bp cDNA fragment, which corresponded to a 301-bp sequence of the presumptive fTIP39 exon 2 (T004305 Scaffold_4305, Fig. 1Go). Subsequently, replicated and independent 5'-RACE and 3'-RACE reactions were performed to generate overlapping sequences, leading to the isolation of a cDNA clone encoding a full-length zTIP39 (773 bp, Fig. 3Go). The 3'-RACE nPCR amplified nucleotides 305–773 (Fig. 3Go), including the 3'-noncoding regions of zTIP39 containing an imperfect polyadenylation signal, which was 19 bases upstream of the poly(A)n tail and 130 bases downstream of the termination codon in comparison with 116 bases downstream of the termination codon for the fTIP39 sequence (Figs. 1Go and 3Go). Several independent 5'-RACE nPCR using a 3'-reverse primer at the zTIP39 stop codon (nucleotide 580–604, Fig. 3Go) and a forward primer (nucleotides 1–21, Fig. 3Go) generated two PCR products, a 5'-RACE#14 (nucleotides 1–604) and the putative splice variant 5'-RACE#02 (zTIP39 SV) encoded by nucleotides (1–124)-(188–604) (approximately 14% of all 5'-RACE products). Both cDNAs contained imperfect Kozak sequences (ACCAUGG) and differed in the lengths of their putative precursor sequences by 21 amino acid residues (nucleotides 125–187 encoding the signal peptide and mature peptide, Fig. 3Go) (6).



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 3. Zebrafish cDNA and encoded TIP39 sequence. The amino acid sequence of the zTIP39 preprosequence is indicated below the corresponding nucleotide sequence. The putative secreted peptide is in bold. Nucleotides found in the putative preproTIP39 sequence are capitalized, nucleotides in the flanking 5' and 3' untranslated regions are lowercased. The ATG in bold represents the putative initial methionine and start of the signal peptide (accession no. AY306196), whereas the boxed ATG represents the putative initial methionine of a splice variant lacking nucleotides 125–187 (underlined, accession no. AY307076). The first residue of the translated mature zTIP(1–39) sequence tested in expression studies is N, the stop codon has an * below its corresponding nucleotide sequence, and the putative signal for polyadenylation is underlined.

 
The results of these experiments suggested that there could be alternately expressed prepro-zTIP39 sequences, which are initiated at the third Met instead of the first Met and thus lack 63 nucleotides within the region encoding the poorly conserved signal peptide (Fig 3Go). Although the putative splice variant is not missing any amino acids of the secreted peptide, we have not been able to identify typical splice donor and acceptor sites, which one would expect if this were a true splice variant, and it is thus conceivable that the putative splice variant is an artifact. The zTIP39 SV cDNA (accession no. AY307076) was 21 codons shorter than the full-length zTIP39 (accession no. AY306196), resulting in a putative precursor sequence of 97 amino acid residues instead of the 118 amino acid residues (Figs. 3Go and 4Go). The putative secreted teleost TIP(1–39) peptides showed approximately 57% sequence identity with the mammalian TIP39 homologs, whereas the overall sequence similarity of the N-terminal precursor sequences showed little homology (Table 1Go). Although it appears that teleosts have maintained the inclusion of a mature peptide in the precursor sequence (amino acid residues –91 through –1, Fig. 4Go), the mature peptide is poorly conserved, as is the signal peptide (amino acid residues –92 through –121). In addition, the mature peptide is much longer in teleosts (fTIP39: 72 amino acid residues; zTIP39: 91 amino acid residues) than the comparable sequence observed in mammals (human and murine TIP39: 31 amino acid residues) (6) (Table 1Go and Fig. 4Go). Due to the lack of sequence conservation in the putative precursor (Fig. 4Go), compared with the presumed coding region of fTIP39 (123 amino acid residues) (Fig. 1Go), the zTIP39 SV of 136 amino acid residues showed a slightly higher nucleotide identity (49%), compared with the full-length zTIP39 of 157 amino acid residues (46%). In contrast, the zTIP(1–39) showed an 81% nucleotide sequence identity and 99% amino acid sequence similarity with the presumed fTIP(1–39) (Figs. 3Go and 4Go, respectively).



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 4. Alignment of TIP39 amino acid sequences from zebrafish, fugu, human, and mouse. T-Coffee and Dialign algorithms were used to align all available TIP39 sequences. Only uppercase letters are considered to be aligned (29 ). Presumed cleavage sites at amino acid residues –91 and –1 are indicated with arrows ({Downarrow}). The underlined bold M in zebrafish (position –97) is the putative initial methionine of the splice variant (zTIP39 SV). The thick black bar depicts the secreted 39 amino acid polypeptide with the first residue denoted as +1 (bold N or S); the lengths of each prepro amino acid sequence are displayed after the 39th residue of the secreted peptide. *, Identical residues;:, conservative substitutions.

 
The similarity among the coding regions for the mouse and fugu (Fig. 5AGo) and the two teleost (zebrafish and fugu) TIP39 sequences (Fig. 5BGo) is shown graphically in a hydrophobicity plot. Because of the size differences between the mouse and teleost TIP39 sequences, as well as a lack of conservation of the prepro sequence (Table 1Go), fTIP39 (amino acid residues –13 to +39) was aligned with amino acid residues –13 through +39 of mTIP39 (Fig. 5AGo), whereas the full length of fTIP39 (123 amino acid residues) was aligned with the full-length zTIP39 (157 amino acid residues) (Fig. 5BGo). Thus, in Fig. 5BGo, fTIP39 is presented 34 amino acid residues to the right. The hydrophobicity plots for the available sequence indicated no hydrophobic leader sequence for fTIP39, which is comparable with that of mouse TIP(1–39) and zTIP39 SV. The remainder of the TIP(1–39) sequences showed nearly identical plots. In contrast to the other peptides, the full-length zTIP39 shows an initial hydrophobic leader sequence.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 5. A, Kyte/Doolittle hydropathy plots of residues corresponding to –13 through +39 of fTIP39({circ}) and murine TIP39({Delta}). B, Kyte/Doolittle hydropathy plots of residues corresponding to full-length sequences of fTIP39 (123 residues; {circ}) and zebrafish TIP39 (157 residues; {bullet}). The relative position of the first residue of the putative secreted 39-amino acid polypeptide is denoted as +1. The ordinate indicates hydrophobicity, with more positive values corresponding to increased hydrophobicity (5 ). B, fTIP39 begins at a relative start of residue 34 (on the abscissa), compared with zTIP39.

 
In vitro functional analysis of zTIP39 with the cognate zPTH2R
To compare the efficacy of zTIP39 with that of hTIP39, cAMP accumulation studies were performed on COS-7 cells transiently expressing the hPTH2R, zPTH2R, or zPTH2R SV #43–9 (Fig. 6Go, A–C, and Table 2Go). Synthetic hTIP(1–39) and zTIP(1–39) showed higher potencies with COS-7 cells transiently expressing the hPTH2R [EC50: 0.11 ± 0.04 nM hTIP(1–39) and 0.31 ± 0.07 nM zTIP(1–39)] than with cells expressing the zPTH2R [EC50: 4.2 ± 0.3 nM hTIP(1–39) and 7.8 ± 2.0 nM zTIP(1–39)]. However, cells expressing the zPTH2R SV were significantly better activated by zTIP(1–39) (EC50: 1.3 ± 0.3 nM) than by hTIP(1–39) (EC50: 3.8 ± 0.7 nM) (Fig. 6Go, A, B, and C, respectively, and Table 2Go). Although zTIP(1–39) and hTIP(1–39) showed similar efficacy in stimulating the hPTH2R (Fig. 6AGo and Table 2Go), zTIP(1–39) showed an approximate 3-fold enhanced potency in stimulating the zPTH2R SV, and a slightly enhanced efficacy (23 and 16%) in stimulating the zPTH2R and zPTH2R SV, respectively (Fig. 6Go, B and C and Table 2Go). The in vitro cAMP stimulation results thus suggested that, in addition to the significant structural conservation observed in the secreted TIP(1–39) (Fig. 3Go), there has been functional conservation of the ligand in vertebrates, at least when tested in vitro using a mammalian expression system.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 6. cAMP accumulation induced by hTIP(1–39) and zTIP(1–39). COS-7 cells transiently expressing hPTH2R (A), zPTH2R (B), or zPTH2R SV (C) were evaluated for agonist-stimulated cAMP production ({blacksquare}, hTIP(1–39); {square}, zTIP(1–39). Data are expressed as cAMP accumulation in picomoles/well and are shown as the mean ± SD of three independent transfections; EC50s were based on the data from three independent transfections.

 
Expression analysis of zTIP39 and zPTH2R in zebrafish embryos
Following established zebrafish protocols for whole-mount in situ hybridization using DIG-labeled RNA probes (23, 34), 24 and 48 hpf zebrafish embryos were used to assess TIP39 expression during development. At 24 hpf, zTIP39 was expressed at low levels generally in the central nervous system (CNS), but by 48 hpf zTIP39 was expressed at high levels in tissues surrounding the hypothalamus (Fig. 7Go) as well as the developing heart (Fig. 8Go). To more specifically visualize structures in the central nervous system (Fig. 7Go), we performed double in situ hybridization experiments with the shh gene, which encodes a developmental signaling molecule and is expressed in the hypothalamus (35, 36). Whereas shh was expressed in the midline, which is consistent with its expression in the mammalian and fish hypothalamus, zTIP39 expression was detected in two lateral spots rostral and dorsal to the hypothalamus at a midbrain-forebrain border. Although our whole-mount in situ hybridization results indicated that zebrafish express high levels of TIP39 mRNA during cardiac development (Fig. 8Go), previous studies indicated TIP39 to be expressed at low levels in the murine heart (5, 6).



View larger version (104K):
[in this window]
[in a new window]
 
FIG. 7. Colocalization of zebrafish shh and zTIP39 assessed by whole-mount in situ hybridization double labeling. Whole-mount in situ hybridization of zebrafish embryos at 48 hpf using antisense cRNA encoding zTIP39 (left top and bottom, blunt arrow) and zshh (right top and bottom) with CNS locations indicated. The mRNA encoding zebrafish shh was expressed in the midbrain (mb), forebrain (fb), and hypothalamus midline, and the mRNA encoding zTIP39 in two lateral spots rostral and dorsal to the hypothalamus corresponding to a mb-fb border. Top two panels of lateral view, Rostral to the left, caudal to the right, dorsal above, and ventral below. Lower two panels of dorsal view, Rostral left and caudal right. fp, Floorplate; hy, hypothalamus; olf, olfactory pit; pem, posterior ectodermal membrane; pha, pharyngeal arch. All scale bars, 100 µm.

 


View larger version (78K):
[in this window]
[in a new window]
 
FIG. 8. Expression of mRNA encoding zTIP39 in developing cardiac tissues assessed by whole-mount in situ hybridization. Whole-mount in situ hybridization of zebrafish embryos at 48 hpf using antisense cRNA encoding zTIP39 as a probe; TIP39 mRNA expression was observed throughout the developing cardiac tissue.

 
The zPTH2R (#43–9) showed intense transcript expression by whole-mount in situ hybridization in the developing zebrafish CNS at 48 and 72 hpf (Fig. 9Go, A and B) as well as low level expression in the vascular tissue. These data are similar to those in mammals (13, 37, 38).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 9. Distribution of mRNA encoding zPTH2R in neuronal tissue assessed by whole-mount in situ hybridization. Whole-mount in situ hybridization of zebrafish embryos at 48 (A) and 72 hpf (B) using an antisense cRNA probe encoding zPTH2R (#43–9). PTH2R expression was observed throughout the developing zebrafish brain at 48 and 72 hpf.

 
Phylogenetic relationships of teleost and tetrapod TIP39, PTH, and PTHrP
Full-length prepro amino acid sequences of PTH, PTHrP, and TIP39 were aligned and analyzed by distance methods (39) using human GIP as the outgroup as previously described (5). In addition, several secretin species were included in the analyses to determine and evaluate the relationships among TIP39, PTH, and PTHrP. Although the terminal branches showed minor variations (Fig. 10Go), depending on whether heuristic or Neighbor-Joining distance analyses were performed, all trees showed the same topology of groups, i.e. distinct clades for PTH, PTHrP, TIP39, and secretin. The current theory indicates that nodes showing bootstrap/jackknife (BS/JK) values above 95% are to be considered strongly supportive (40, 41). Thus, the BS/JK values supported the distinctiveness of a PTH-PTHrP clade (with PTH and PTHrP being sister groups), a TIP39 clade that is basal to the PTH-PTHrP clade, and a secretin clade.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 10. Phylogentic analysis indicating the evolutionary relationship among full-length prepro sequences of the TIP39, PTH, PTHrP, and secretin families of peptides. The phylogenetic tree is rooted with human GIP (5 ). The BS/JK values from 10,000 replicates indicate support of a given node in which 95% is considered to be significant (5 40 41 ). Using distance as the criteria, heuristic and Neighbor-joining phylogenetic analyses were performed. The overall topology of the trees were retained, although there were subtle variations in the terminal branches and minor variations in the tree statistics of the heuristic BS/JK phylogenetic analyses (tree length, 1099, consistency index, 0.850, and 166 parsimony-informative characters) and Neighbor-joining BS/JK phylogenetic analyses (tree length, 1101, consistency index, 0.848, and 166 parsimony-informative characters). All accession numbers used for the phylogenetic analysis have been previously listed (5 ), except for zTIP39 (AY306196), zTIP39 splice variant (AY307076), fTIP39, zPTH1 (AY275669), zPTH2 (AY275670), fPTH1 (59 ), fPTH2 (AY302221), and catfish PTH2 (BQ096842).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
zTIP(1–39) and hTIP(1–39) are similarly efficacious and potent at the hPTH2R, zPTH2R, and zPTH2R SV (see Fig. 6Go). As such, a comparison of their amino acid sequences, as well as those of fugu and murine TIP39, may provide insights in identifying critical regions for receptor binding and activation. The TIP39 peptides are distantly related to PTH and PTHrP. Alignment of TIP39, with PTH and PTHrP, indicates the presence of two additional amino acids in the amino-terminal portion. Because PTH is a potent agonist, at least at the human PTH2R (42), it would have been surprising if these residues were critical for receptor activation. Whereas human and mouse TIP39 have identical residues at these first two positions, zebrafish and pufferfish have nonconservative substitutions.

Structure-activity studies with PTH and PTHrP-based peptides have suggested that ligand residue 5 is critical for activation of the hPTH2R and that residue 23 is critical for binding to this receptor (8, 43). The TIP39 peptides from all four species do show conservation at these residues; however, as has been previously noted, the amino acid residue at position 7 in TIP39 (Asp) is different from that of PTH (Ile). Cross-linking studies with PTH-based peptides suggested that interactions in the activation domain occur at similar locations for hPTH1R and hPTH2R (44). Our own studies in the binding region of PTHrP suggest there are differences in the interaction site between PTHrP(1–36) analogs and the hPTH2R (45). The residues in the binding region of PTH and PTHrP, which were previously identified as intolerant to substitution (i.e. residues23 , 24 , 28 , and 31) (Ref. 46) are conserved between mammalian PTH and all of the currently isolated TIP39 ligands, suggesting that a similar mechanism of interaction occurs between these two peptides and the PTH1R. Indeed, chimeras between TIP39 and PTH indicate that hTIP39 binds to hPTH1R but does not activate this receptor, thus making it a potent antagonist (20). Furthermore, the arginine at residue 20, present in PTH and PTHrP in all known species, is also found in TIP39. Residues in positions 11 and 12, an important region for antagonist (47) and inverse agonist activity (48), are not conserved between TIP39 and PTH nor are they conserved in TIP39 across the species isolate thus far.

Overall, however, some critical regions for binding in PTH and PTHrP appear to be partially conserved in TIP39, whereas the activation domain showed less conservation between TIP39 and PTH. Furthermore, the results suggested that, even though the secreted forms of TIP39 appear to be highly conserved (Fig. 4Go), zebrafish PTH2Rs are capable of discriminating between teleost (zebrafish) and a tetrapod (human) TIP(1–39) ligands when tested in a mammalian COS-7 expression system. Because it is known that teleosts express two PTH-like peptides (27) and three receptors (9, 21), it appears that the teleost PTH- and TIP39-systems are more complex. This may be due to the evolutionary adaptability of teleosts in divergent environments when compared with mammals. Thus, to assess the physiological implications of TIP39 in teleosts and avoid potential confounding results, in vivo experiments may require species-specific (i.e. homologous) ligands.

Expression of zTIP39 mRNA was detected in a region that evolutionarily corresponds to the dorsal hypothalamic region (Fig. 7Go) (49, 50). Our whole-mount in situ hybridization results therefore suggested that teleost TIP39 may have similar roles as a neuropeptide as was postulated for mammals (5, 12, 17, 49, 51). The early expression of the zTIP39-PTH2R mRNA by whole-mount in situ hybridization suggested that the teleost system may have multiple roles in the developing brain (52, 53) and heart (54, 55, 56). Although it is unlikely that there is a direct developmental association between TIP39 and shh, by shh organizing the whole brain, of which TIP39 expressing cells are a part, it is conceivable that shh could influence where the TIP39 expressing cells will be localized (35, 49, 50, 57, 58).

The phylogenetic analysis indicated that TIP39 appears to be basal to PTH and PTHrP, thus indicating that TIP39 may be ancestral to PTH and PTHrP (Fig. 10Go). However, to confirm this statement, PTH-like sequences must be obtained from additional basal species. In addition, the PTHrP sequences showed a higher percentage of supportive BS/JK values when compared with PTH or TIP39 sequences. This would indicate that the PTHrP sequences retained many more invariant (i.e. conserved) residues that are necessary for function than PTH or TIP39, which showed much more sequence variation and thus the lower BS/JK values. This hypothesis is consistent with the recent finding of pairs of PTH expressed in zebrafish and fugu, which showed considerable divergence (27).

In summary, we have characterized the genes encoding zTIP39 and fTIP39 and isolated cDNAs comprising 157 and 136 amino acid residues encoding the full-length zTIP39 and a zTIP39 splice variant, respectively. Because the putative splice variant lacks a hydrophobic leader sequence, it is unlikely to be secreted. The zTIP(1–39) ligand activated the zPTH2R SV (#43–9) and zPTH2R expressed in COS-7 cells slightly better than the hPTH2R. However, it is presently unclear whether there is an associated in vivo conservation of physiological function(s). Phylogenetic analysis suggested that the TIP39 clade is basal to PTH and PTHrP, thus suggesting that TIP39 is ancestral to PTH and PTHrP. Finally, whole-mount in situ hybridization studies using probes encoding the zPTH2R and zTIP39 suggested that there are strong parallels in the neuroendocrine and cardiovascular expression of this system for mammals and fishes. Thus, zebrafish could make an excellent model to further investigate developmental roles of the TIP39-PTH2R system.


    Acknowledgments
 
We thank Ashok Khatri for the synthesis of TIP39 peptides and Ben Marquardt, Justin Shoemaker, and Drs. Tak Cheung and John Sedbrook for assistance in the preparation of this manuscript.


    Footnotes
 
This work was supported by National Institutes of Health Grants DK11794 (to H.J.), RO1RR10715 and PO1HD22486 (to J.H.P.), and DK60513 (to D.A.R.) and a grant from Illinois State University (to D.A.R.). This work was covered by Institutional Animal Care and Use Committee protocols 14-2002 (to D.A.R.) and 03-07A (to J.H.P.).

Abbreviations: AUAP, Abridged universal amplification primer; BS/JK, bootstrap/jackknife; CNS, central nervous system; DIG, digoxigenin; fTIP39, fugu TIP39; GIP, gastrointestinal-inhibitory peptide; hpf, hours post fertilization; hPTH2R, human PTH2R; hTIP39, human TIP39; nPCR, nested PCR; PTH2R, PTH type 2 receptor; RACE, rapid amplification of cDNA ends; shh, sonic hedgehog; TIP39, tuberoinfundibular peptide 39; zPTH2R, zebrafish PTHR; zTIP39, zebrafish TIP39; zTIP39 SV, zTIP39 putative splice variant.

Received February 9, 2004.

Accepted for publication July 29, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jüppner H, Kronenberg H 2003 Parathyroid hormone. In: Favus M, ed. Primer on the metabolic bone diseases and disorders of mineral metabolism. Washington, DC: American Society of Bone Mineral Research; 117–124
  2. Strewler G, Nissenson R 2003 Parathyroid hormone-related protein. In: Favus M, ed. Primer on the metabolic bone diseases and disorders of mineral metabolism. Washington, DC: American Society of Bone Mineral Research; 125–129
  3. Kronenberg H 2003 Developmental regulation of the growth plate. Nature 423:332–336[CrossRef][Medline]
  4. Usdin T, Hoare S, Wang T, Mezey E, Kowalak J 1999 TIP39: a new neuropeptide and PTH2-receptor agonist from hypothalamus. Nat Neurosci 2:941–943[CrossRef][Medline]
  5. John M, Arai M, Rubin D, Jonsson K, Jüppner H 2002 Identification and characterization of the murine and human gene encoding the tuberoinfundibular peptide of 39 residues (TIP39). Endocrinology 143:1047–1057[Abstract/Free Full Text]
  6. Hansen I, Jakob O, Wortmann S, Arzberger T, Allolio B, Blind E 2002 Characterization of the human and mouse genes encoding the tuberoinfundibular peptide of 39 residues, a ligand of the parathyroid hormone receptor family. J Endocrinol 174:95–102[Abstract]
  7. Usdin TB, Gruber C, Bonner TI 1995 Identification and functional expression of a receptor selectively recognizing parathyroid hormone, the PTH2 receptor. J Biol Chem 270:15455–15458[Abstract/Free Full Text]
  8. Gardella T, Luck M, Jensen G, Usdin T, Jüppner H 1996 Converting parathyroid hormone-related peptide (PTHrP) into a potent PTH-2 receptor agonist. J Biol Chem 271:19888–19893[Abstract/Free Full Text]
  9. Rubin DA, Hellman P, Zon LI, Lobb CJ, Bergwitz C, Jüppner H 1999 A G protein-coupled receptor from zebrafish is activated by human parathyroid hormone and not by human or teleost parathyroid hormone-related peptide: implications for the evolutionary conservation of calcium-regulating peptide hormones. J Biol Chem 274:23035–23042[Abstract/Free Full Text]
  10. Hoare SRJ, Rubin DA, Jüppner H, Usdin TB 2000 Evaluating the ligand specificity of zebrafish parathyroid hormone (PTH) receptors: comparison of PTH, PTH-related protein, and tuberoinfundibular peptide of 39 residues. Endocrinology 141:3080–3086[Abstract/Free Full Text]
  11. Hoare SRJ, Usdin TB 2000 Tuberoinfundibular peptide (7–39) [TIP(7–39)], a novel, selective, high-affinity antagonist for the parathyroid hormone-1 receptor with no detectable agonist activity. J Pharmacol Exp Ther 295:761–770[Abstract/Free Full Text]
  12. Ward H, Small C, Murphy K, Kennedy A, Ghatei M, Bloom S 2001 The actions of tuberoinfundibular peptide on the hypothalamo-pituitary axes. Endocrinology 142:3451–3456[Abstract/Free Full Text]
  13. Eichinger A, Fiaschi-Taesch N, Massfelder T, Fritsch S, Barthelmebs M, Helwig J-J 2002 Transcript expression of the tuberoinfundibular peptide (TIP)39/PTH2 receptor system and Non-PTH1 receptor-mediated tonic effects of TIP39 and other PTH2 receptor ligands in renal vessels. Endocrinology 143:3036–3043[Abstract/Free Full Text]
  14. Sugimura Y, Murase T, Ishizaki S, Tachikawa K, Arima H, Miura Y, Usdin T, Oiso Y 2003 Centrally administered tuberoinfundibular peptide of 39 residues inhibits arginine vasopressin release in conscious rats. Endocrinology 144:2791–2796[Abstract/Free Full Text]
  15. Wang T, Edwards G, Lange G, Parlow A, Usdin T 2002 Brain administration of tuberoinfundibular peptide of 39 residues inhibits growth hormone secretion. In: Recent research developments in endocrinology. Vol 3. Kerala, India: Transworld Research Network; 317–321
  16. Penna KD, Kinose F, Sun H, Koblan K, Wang H 2003 Tuberoinfundibular peptide of 39 residues (TIP39): molecular structure and activity for parathyroid hormone 2 receptor. Neuropharmacology 44:141–153[CrossRef][Medline]
  17. Usdin T, Dobolyi A, Ueda H, Palkovits M 2003 Emerging functions for tuberoinfundibular peptide of 39 residues. Trends Endocrinol Metab 14:14–19[CrossRef][Medline]
  18. LaBuda C, Dobolyi A, Usdin T 2004 Tuberoinfundibular peptide of 39 residues produces anxiolytic and antidepressant actions. Neuroreport 15:881–885[CrossRef][Medline]
  19. Ross G, Schlueter K 2003 Tuberoinfundibular peptide (TIP39): a new neurotransmitter of the heart with a negative inotropic effect? In: German Physiological Society Congress Abstracts. Vol 2003. Available at: http://www.dpg-congress.de/abstracts/2003/11229.pdf (Abstract 11229)
  20. Jonsson K, John M, Gensure R, Gardella T, Jüppner H 2001 Tuberoinfundibular peptide 39 binds to the parathyroid hormone (PTH)/PTH-related peptide receptor, but functions as an antagonist. Endocrinology 142:704–709[Abstract/Free Full Text]
  21. Rubin DA, Jüppner H 1999 Zebrafish express the common PTH/PTHrP receptor (PTH1R) and a novel receptor (PTH3R) that is preferentially activated by mammalian and fugufish parathyroid hormone-related peptide (PTHrP). J Biol Chem 274:28185–28190[Abstract/Free Full Text]
  22. Bergwitz C, Jusseaume SA, Luck MD, Jüppner H, Gardella TJ 1997 Residues in the membrane-spanning and extracellular regions of the parathyroid hormone (PTH)-2 receptor determine signaling selectivity for PTH and PTH-related peptide. J Biol Chem 272:28861–28868[Abstract/Free Full Text]
  23. Yan Y-L, Miller C, Nissen R, Singer A, Liu D, Kirn A, Draper B, Willoughby J, Morcos P, Amsterdam A, Chung B-C, Westerfield M, Haffter P, Hopkins N, Kimmel C, Postlethwait J 2002 A zebrafish sox9 gene required for cartilage morphogenesis. Development 129:5065–5079[Abstract/Free Full Text]
  24. Jowett T 1999 Analysis of protein and gene expression. In: Detrich IHW, Westerfield M, Zon LI, eds. The zebrafish: biology. Vol 59. New York: Academic Press; 63–85
  25. Nüsslein-Volhard C, Dahm R 2002 Zebrafish: a practical approach. Oxford, UK: Oxford University Press
  26. Westerfield M 2000 The zebrafish book: a guide for the laboratory use of zebrafish (Danio rerio). Eugene, OR: University of Oregon Press
  27. Gensure R, Ponugoti B, Gunes Y, Papasani M, Lanske B, Bastepe M, Rubin D, Jüppner H 2004 Identification and characterization of two parathyroid hormone-like molecules in zebrafish. Endocrinology 145:1634–1639[Abstract/Free Full Text]
  28. Lassmann T, Sonnhammer E 2002 Minireview: quality assessment of multiple alignment programs. FEBS Lett 529:126–130[CrossRef][Medline]
  29. Morgenstern B 1999 Dialign 2: improvement of the segment-to-segment approach to multiple sequence alignment. Bioinformatics 15:211–218[Abstract/Free Full Text]
  30. Notredame C, Higgins D, Heringa J 2000 T-Coffee: a novel method for fast and accurate multiple sequence alignment. J Mol Biol 302:205–217[CrossRef][Medline]
  31. Maddison D, Maddison W 2000 MacClade 4.0. Analysis of phylogeny and character evolution. Sunderland, MA: Sinauer Associates
  32. Dores R, Rubin D, Quinn T 1996 Is it possible to construct phylogenetic trees using polypeptide hormone sequences? Gen Comp Endocrinol 103:1–12[CrossRef][Medline]
  33. Swofford D 2000 PAUP*: phylogenetic analysis using parsimony (*and other methods). Sunderland, MA: Sinauer Associates
  34. Jowett T, Yan Y 1996 Double fluorescent in situ hybridization to zebrafish embryos. Trends Genet 12:387–389[CrossRef][Medline]
  35. Herzog W, Zeng Z, Lele Z, Sonntag C, Ting J-W, Chang C-Y, Hammerschmidt M 2003 Adenohypophysis formation in the zebrafish and its dependence on Sonic hedgehog. Dev Biol 254:36–49[CrossRef][Medline]
  36. Varga Z, Amores A, Lewis K, Yan Y, Postlethwait J, Eisen J, Westerfield M 2001 Zebrafish smoothened functions in ventral neural tube specification and axon tract formation. Development 128:3497–3509
  37. Usdin TB, Hilton J, Vertesi T, Harta G, Segre G, Mezey E 1999 Distribution of the parathyroid hormone 2 receptor in rat: immunolocalization reveals expression by several endocrine cells. Endocrinology 140:3363–3371[Abstract/Free Full Text]
  38. Wang T, Palkovits M, Rusnak M, Mezey E, Usdin TB 2000 Distribution of parathyroid hormone-2 receptor-like immunoreactivity and messenger RNA in the rat nervous system. Neuroscience 100:629–649[CrossRef][Medline]
  39. Swofford D, Olsen G, Waddell P, Hillis D 1996 Phylogenetic inference. In: Molecular systematics. Hillis D, Moritz C, Mable B, eds. Sunderland, MA: Sinauer Associates Inc.; 407–514
  40. Page RDM, Holmes EC 1998 Molecular evolution: a phylogenetic approach. Oxford, UK: Blackwell Science Ltd.
  41. Felsenstein J, Kishino H 1993 Is there something wrong with the bootstrap on phylogenies? A reply to Hillis and Bull. Syst Biol 42:193–200[CrossRef]
  42. Hoare SJ, Bonner T, Usdin T 1999 Comparison of rat and human parathyroid hormone 2 (PTH2) receptor activation: PTH is a low potency partial agonist at the rat PTH2 receptor. Endocrinology 140:4419–4425[Abstract/Free Full Text]
  43. Behar V, Nakamoto C, Greenberg Z, Bisello A, Suva L, Rosenblatt M, Chorev M 1996 Histidine at position 5 is the specificity "switch" between two parathyroid hormone receptor subtypes. Endocrinology 137:4217–4224[Abstract]
  44. Behar V, Bisello A, Rosenblatt M, Chorev M 1999 Direct identification of two contact sites for parathyroid hormone (PTH) in the novel PTH-2 receptor using photoaffinity cross-linking. Endocrinology 140:4251–4261[Abstract/Free Full Text]
  45. Gensure R, Jüppner H, PTHrP binds to different regions in human PTH/PTHrP receptor and PTH-2 receptor based on photoaffinity cross-linking. Proc Joint Meeting of the Pediatric Academic Societies and American Academy of Pediatrics, Boston, MA, 2000 (Abstract 752571)
  46. Gardella T, Wilson A, Keutmann H, Oberstein R, Potts JT, Kronenberg H, Nussbaum S 1993 Analysis of parathyroid hormone’s principal receptor-binding region by site directed mutagenesis and analog design. Endocrinology 132:2024–2030[Abstract/Free Full Text]
  47. Goldman M, McKee R, Caulfield M, Reagan J, Levy J, Gay C, DeHaven P, Rosenblatt M, Chorev M 1988 A new highly potent parathyroid hormone antagonist: [D-Trp12,Tyr34]bPTH-(7–34)NH2. Endocrinology 123:2597–2599[Abstract/Free Full Text]
  48. Carter P, Petroni B, Gensure R, Schipani E, Potts JT, Gardella T 2001 Selective and nonselective inverse agonists for constitutively active type-1 parathyroid hormone receptors: evidence for altered receptor conformation. Endocrinology 142:1534–1545[Abstract/Free Full Text]
  49. Dobolyi A, Palkovits M, Usdin T 2003 Expression and distribution of tuberoinfundibular peptide of 39 residues in the rat central nervous system. J Comp Neurol 455:547–566[CrossRef][Medline]
  50. Dobolyi A, Palkovits M, Bodnar I, Usdin T 2003 Neurons containing tuberoinfundibular peptide of 39 residues project to limbic, endocrine, auditory and spinal areas in rat. Neuroscience 122:1093–1105[CrossRef][Medline]
  51. Dobolyi A, Ueda H, Uchida H, Palkovits M, Usdin T 2002 Anatomical and physiological evidence for the involvement of tuberoinfundibular peptide of 39 residues in nociception. Proc Natl Acad Sci USA 99:1651–1656[Abstract/Free Full Text]
  52. Blind E, Wortmann S, Hansen I, Meyer S, Neuner C, Winkler C 2003 Tuberoinfundibular peptide of 39 residues (TIP39), a ligand of the PTH receptor family may be involved in early brain development in zebrafish. J Bone Miner Res 18:S100–S101
  53. Wortmann S, Hansen I, Meyer S, Neuner C, Winkler C, Allolio B, Blind E 2003 The tuberoinfundibular peptide of 39 residues, a natural ligand of the PTH receptor family, affects early brain development in zebrafish. In: Thieme G, Verlag KG. Exp Clin Endocrinol Diabetes. Available at: www.thieme.de/eced/abstracts2003/daten/106.html
  54. Yelon D 2001 Cardiac patterning and morphogenesis in zebrafish. Dev Dyn 222:552–563[CrossRef][Medline]
  55. Yelon D, Weinstein B, Fishman M 2002 Aspects of organogenesis: cardiovascular system. In: Solnica-Krezel L, ed. Pattern formation in zebrafish. Vol 40. Berlin: Springer-Verlag; 298–321
  56. Glickman N, Yelon D 2002 Cardiac development in zebrafish: coordination of form and function. Cell Dev Biol 13:507–513
  57. Ungos J, Karlstrom R, Raible D 2003 Hedgehog signaling is directly required for the development of zebrafish dorsal root ganglia neurons. Development 130:5351–5362[Abstract/Free Full Text]
  58. Sbrogna J, Barresi M, Karlstrom R 2003 Multiple roles for hedgehog signaling in zebrafish pituitary development. Dev Biol 254:19–35[CrossRef][Medline]
  59. Danks J, Ho P, Notini A, Katsis F, Hoffmann P, Kemp B, Martin T, Zajac J 2003 Identification of a parathyroid hormone in the fish, Fugu rubripes. J Bone Miner Res 18:1326–1331[CrossRef][Medline]
  60. Sokal R, Rohlf F 1981 Biometry: the principles and practice of statistics in biological research. San Francisco: W. H. Freeman and Co.



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Fuentes, P. M. Guerreiro, T. Modesto, J. Rotllant, A. V. M. Canario, and D. M. Power
A PTH/PTHrP receptor antagonist blocks the hypercalcemic response to estradiol-17beta
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2007; 293(2): R956 - R960.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
B Elo, C M Villano, D Govorko, and L A White
Larval zebrafish as a model for glucose metabolism: expression of phosphoenolpyruvate carboxykinase as a marker for exposure to anti-diabetic compounds
J. Mol. Endocrinol., April 1, 2007; 38(4): 433 - 440.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. M. Guerreiro, J. L. Renfro, D. M. Power, and A. V. M. Canario
The parathyroid hormone family of peptides: structure, tissue distribution, regulation, and potential functional roles in calcium and phosphate balance in fish
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2007; 292(2): R679 - R696.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. E. Wever, R. Masereeuw, D. S. Miller, X. M. Hang, and G. Flik
Endothelin and calciotropic hormones share regulatory pathways in multidrug resistance protein 2-mediated transport
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F38 - F46.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Gensure and H. Juppner
Parathyroid Hormone without Parathyroid Glands
Endocrinology, February 1, 2005; 146(2): 544 - 546.
[Full Text] [PDF]


Home page
EndocrinologyHome page
B. M. Hogan, J. A. Danks, J. E. Layton, N. E. Hall, J. K. Heath, and G. J. Lieschke
Duplicate Zebrafish pth Genes Are Expressed along the Lateral Line and in the Central Nervous System during Embryogenesis
Endocrinology, February 1, 2005; 146(2): 547 - 551.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Papasani, M. R.
Right arrow Articles by Rubin, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Papasani, M. R.
Right arrow Articles by Rubin, D. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals