help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2004-0907
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nanda, S. A.
Right arrow Articles by Kalin, N. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nanda, S. A.
Right arrow Articles by Kalin, N. H.
Endocrinology Vol. 145, No. 12 5605-5615
Copyright © 2004 by The Endocrine Society

Characterization of the Human Corticotropin-Releasing Factor2(a) Receptor Promoter: Regulation by Glucocorticoids and the Cyclic Adenosine 5'-Monophosphate Pathway

Steven A. Nanda1, Patrick H. Roseboom1, George A. Nash, James M. Speers and Ned H. Kalin

Departments of Psychiatry (S.A.N., P.H.R., G.A.N., J.M.S., N.H.K.), Pharmacology (P.H.R.), and Psychology (N.H.K.), University of Wisconsin-Madison, Madison, Wisconsin 53719

Address all correspondence and requests for reprints to: Dr. Patrick H. Roseboom, 6001 Research Park Boulevard, Madison, Wisconsin 53719-1176. E-mail: roseboom{at}wisc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Corticotropin-releasing factor (CRF) is a neurotransmitter and hormone believed to integrate responses to stress. Evidence suggests central CRF systems are overactive in some individuals suffering from depression and anxiety disorders. CRF receptor antagonism blocks stress-induced endocrine, autonomic, and behavioral effects in animal models, and studies have implicated the CRF2 receptor in anxiety-related behaviors. Greater understanding of the regulation of CRF2 expression may facilitate understanding mechanisms underlying anxiety. The present studies are the first to characterize the transcriptional regulation of the human CRF2(a), the predominant CRF2 isoform in brain. Four kilobase pairs of sequence immediately upstream of the first exon of CRF2(a) represented our full-length promoter region. Sequentially smaller fragments of the CRF2(a) promoter region were generated by PCR and cloned upstream of a luciferase reporter gene. Expression was monitored from these constructs within Chinese hamster ovary-K1 cells and within rat aortic A7R5 cells that express CRF2. Glucocorticoid treatment decreased expression and elevating intracellular cAMP increased expression from the human CRF2(a) promoter. The regions of the CRF2(a) promoter that regulate the inducible expression were determined, and the functional cAMP response element and glucocorticoid response element cis-regulatory elements within these regions were identified using a combination of site-directed mutagenesis and EMSAs. Given the possibility of species-specific differences in gene expression, interpretation of gene expression studies from rat and mouse model systems is difficult. Examination of expression from the human CRF2(a) promoter will provide insight into these model systems and may translate more readily to the development of therapeutics to treat human psychiatric illness.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CORTICOTROPIN-RELEASING FACTOR (CRF) is a neurotransmitter and hormone believed to integrate the various electrophysiological, immune, endocrine, autonomic, and behavioral responses associated with stress (1, 2, 3, 4, 5, 6). The CRF system consists of several components including four peptide ligands: CRF, urocortin (UCN) 1, UCN 2, and UCN 3. These peptides exhibit different receptor binding characteristics when interacting with the two known mammalian CRF receptors, CRF1 and CRF2 (7, 8). Several isoforms of each of these receptors have been cloned (9, 10). For example, there are at least three isoforms of the CRF2 receptor designated CRF2(a), CRF2(b), and CRF2(c) (11). Both CRF1 and CRF2 receptors are coupled through G proteins to the activation of adenylate cyclase. CRF also interacts with the CRF binding protein (CRF-BP) that binds CRF with an affinity similar to or greater than that of the CRF receptors (12). The CRF-BP is thought to act as a negative regulator of the effects of CRF by preventing it from activating CRF receptors and may be involved in CRF clearance or degradation (13).

Whereas much is known about the biology of CRF, considerably less is understood about the receptors. Antagonism of CRF receptors has been demonstrated to block the stress-induced behavioral effects in several animal models (14, 15). Data suggest that alterations in brain CRF systems are associated with certain psychopathologies such as depression and anxiety. In humans, CRF peptide levels are elevated in the brains of some depressed patients (16), and CRF receptor levels are decreased in the brains of suicide victims (17). Conversely in Alzheimer’s disease, CRF peptide levels are decreased and CRF receptor levels are elevated in the cerebral cortex (18). One current hypothesis regarding the linkage between stress and the development of psychopathology is that vulnerable individuals overexpress CRF agonists and/or their receptors. A greater understanding of the regulation of protein expression in the CRF system may prove beneficial in understanding the pathophysiology of psychiatric illness and guiding the development of novel treatment strategies.

The focus of the present study was the CRF2 receptor. The three known isoforms arise from a single CRF2 gene. Recent evidence indicates that the CRF2 gene contains multiple promoters that drive the expression of each of the three isoforms (19). In this report we present data that extends these studies by further characterizing the regulation of promoter activity for the CRF2(a).

Reporter gene expression was monitored in cell culture from DNA fragments of various lengths from the putative CRF2(a) receptor promoter cloned upstream of the firefly luciferase reporter gene. These studies determined both the maximal and minimal essential length of the promoter for basal expression. Additionally, inducible expression from the CRF2(a) receptor promoter was examined by treating the cultures with several compounds, including dexamethasone (DEX) and forskolin. These studies will help determine important regions of the promoter that influence its expression as well as provide insight into possible intracellular mechanisms involved with stimulus-dependent expression of CRF2(a).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents
Forskolin, 3-isobutyl-1-methylxanthine (IBMX), and DEX were from Sigma-Aldrich (St. Louis, MO); 0.25% trypsin (wt/vol) in 0.53 mM EDTA was from Invitrogen (Carlsbad, CA); BCA assay reagent was from Pierce Biotechnology (Rockford, IL); and all peptides were from Bachem (Torrance, CA).

Cell culture
Chinese hamster ovary (CHO)-K1 and rat aortic A7R5 cells were obtained from American Type Culture Collection (Manassas, VA). CHO-K1 cells were cultured in DMEM/F-12 media at 1:1 (Invitrogen), and A7R5 cells were cultured in DMEM with 4 mM L-glutamine, 1.5 g/liter sodium bicarbonate, and 4.5 g/liter glucose (Invitrogen). Culture media for both cell lines were supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin (Invitrogen). Media were renewed every 2 d. CHO-K1 cells were subcultured at a ratio of 1:8, whereas A7R5 cells were subcultured at a ratio of 1:3. Both cell lines were cultured at 37 C with 5% CO2.

Human and rat CRF2 gene clones
Rat CRF2 gene.
The rat CRF2 receptor gene was cloned from a Sprague Dawley rat genomic library constructed in {lambda}-FIX II obtained from Stratagene (La Jolla, CA). The library was prepared from a partial Sau3AI digest of kidney DNA obtained from male rats (16 months old). The library was probed with a 32P-labeled fragment of the rat CRF2(a) cDNA (20), which corresponded to bases 1 to 261 of the cDNA (GenBank accession no. U16253). The single positive clone that was obtained was plaque purified, the insert was excised by NotI digestion and subcloned into the pGEM-5Zf(+) vector (Promega, Madison, WI). The entire insert was sequenced using the GPS-1 genome priming system (New England Biolabs, Beverly, MA), which uses randomly interspersed primer binding sites.

Human CRF2 gene.
The P1-derived artificial chromosome (PAC) clone (RP5–1143H19) containing the entire gene for the human CRF2 receptor was obtained from Invitrogen and contained a 127,425-bp insert. A 4040-bp fragment of the human CRF2 gene corresponding to the promoter region of the CRF2(a) receptor was excised from the PAC clone with the restriction enzymes NarI and NdeI. This corresponded to base pairs 68177–72216 of the published sequence (GenBank accession no. AC004976). The fragment was subcloned into the vector pRL-null (Promega) that had been digested with the same two enzymes. The insert was removed from pRL-null with EcoICRI and SalI and inserted into pGL3-basic (Promega) that had been digested with SmaI and XhoI.

Using the 4040-bp fragment in pGL3-basic as a template, fragments of the human CRF2(a) promoter were generated using PCR with the high-fidelity Platinum Taq DNA polymerase (Invitrogen) and a common reverse (3') primer (5'-AGAGGAGCCGCCGAGTGCACG-3') that ended 17 bp downstream of the putative transcription start point (TSP). We generated sequentially smaller fragments of the CRF2(a) promoter region through PCR with several forward (5') primers (see Fig. 1Go). The constructs generated were from –3917 bp (5'-CAGCTCTTCTGCCAAGGTATC-3'), –3425 bp (5'-AGGTGGTCTCCATCTCAAGGG-3'), –2902 bp (5'-GCATCCTGTCCCTTTAAATCC-3'), –2365 bp (5'-GCTCTTCCCAATTTCTTCCTC-3'), –1925 bp (5'-GTGGTGGCTGCAGTAATGAAC-3'), –1394 bp (5'-CTAGTTCATGGTGGTTTCAGC-3'), –859 bp (5'-CCCCGCTACTGGTGTGGAAAC-3'), –365 bp (5'-CGCTCAGGGAGGGGAAGCTCA-3'), –224 bp (5'-GATCCCCGCACAGAGCAT-TC-3'), and –123 bp (5'-GTACTTTGGGCAGGGTGGAG-3') relative to the putative TSP through +17 bp (referred to as the –3917, –3425, –2902, –2365, –1925, –1394, –859, –365, –224, and –123 constructs, respectively). The PCR products were subcloned by T/A cloning into pCR2.1-TOPO (Invitrogen), and the inserts were digested out using SpeI and XhoI and subcloned into pGL-3 basic that had been digested with NheI and XhoI. The identity of each construct in pGL3-basic was confirmed by DNA sequencing using the RVprimer3 and GLprimer2 sequencing primers located within the pGL3-basic vector.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. Diagram of CRF2(a) promoter region and truncated fragments. Each of these promoter fragments was subcloned into the pGL3 basic vector and the resultant constructs were transiently transfected into either CHO-K1 or A7R5 cell lines. Luciferase reporter activity was measured as described in Materials and Methods. Arrows with tails indicate the location of the primers used to generate the fragments. Open boxes indicate the location of the consensus regulatory element sequences, and the arrowheads indicate the strand on which the consensus sequences lie (forward arrow, coding strand; reverse arrow, noncoding strand).

 
DNA sequence analysis
To identify potential transcription factor binding sites, analysis was performed on 3917 bp of sequence immediately upstream of the first CRF2(a) exon start site in both the rat and human sequences using MatInspector version 2.2 (21), public domain software with the Transfac 4.0 vertebrate matrices (22). The threshold levels were set at 0.75 for core similarity and 0.85 for matrix similarity. In addition to a large number of other putative transcription factor binding sites, this analysis identified three putative glucocorticoid response element (GRE) sites and two putative cAMP response element (CRE) sites in the human CRF2 gene sequence (Fig. 1Go).

Transient transfection assays
The constructs were transfected into various cell lines using Lipofectamine 2000 (Invitrogen). According to the manufacturer’s instructions, media were changed to OptiMem serum-free media (Invitrogen) immediately before transfection to improve efficiency. In addition, the change to serum-free media eliminates possible interference from glucocorticoids contained within serum. Cells were transfected in 6-well plates with 5 µg of construct DNA per well. To control for transfection efficiency, the cells were cotransfected with the pRL-TK vector (Promega) at 0.5 µg of construct DNA per well. The pRL-TK vector contains the Renilla luciferase gene downstream of the herpes simplex virus thymidine kinase promoter, a promoter that provides low to moderate levels of expression. Cells were lysed with passive lysis buffer (Promega) for 30 min. Lysates were spun at 10,000 x g for 5 min to pellet cellular debris. The supernatant was collected and assayed for total protein using the BCA assay (Pierce Biotechnology) to standardize for the protein extraction. The level of reporter gene expression from a standardized amount of cell extract was quantified by measuring luciferase activity using a luminometer (Berthold Technologies, Oak Ridge, TN) and the dual-luciferase reporter assay system (Promega). Firefly luciferase activity reflects CRF2(a) promoter activity, and Renilla luciferase activity can be used to normalize data. All data were expressed as a ratio of the firefly luciferase activity normalized to the Renilla luciferase activity. In experiments examining the effects of glucocorticoids, DEX was used at a concentration of 20 µM, which was based on a study of glucocorticoid regulation of CRF2(b) expression in the rat aortic A7R5 cell line (23). This dose produced the maximal decrease in CRF2(b) mRNA levels. In experiments in which cells were treated with 10 µM forskolin, the phosphodiesterase inhibitor IBMX (0.25 mM) was included in the media to prevent cAMP degradation. These concentrations of forskolin and IBMX have been used previously to study cAMP-dependent regulation of rat CRF-BP gene expression (24).

Two control transfections were used. The cultures referred to as pGL3 basic were transfected with a pGL3 firefly luciferase reporter construct that did not contain an experimental promoter and with the pRL-TK Renilla luciferase vector. These cultures demonstrate background levels of expression and are negative controls. The cultures referred to as unrelated were transfected with a construct containing 1916 bp of DNA sequence upstream of the firefly reporter gene and with the pRL-TK Renilla luciferase vector. The 1916 bp of this construct were random DNA sequence. These cultures were intended to demonstrate the specificity of our promoter constructs.

Site-directed mutagenesis
Site-directed mutagenesis was performed using the Quick Change XL kit (Stratagene) to alter the DNA sequence of two putative CRE and three putative GRE sites within the –3917 construct. Two base pairs of the CRE consensus core sequence were altered (TGAC -> TTCC) within the –2923 or –432 CREs independently to generate the –2923 and –432 constructs. Two base pairs of the GRE consensus core sequence were altered (TGTT -> TACT) within the –3848, –3743, or –2363 GREs independently to generate the –3848, –3743, and –2363 constructs. The following oligos and their reverse complements were used to generate the mutated constructs. The bold letters represent the bases that were changed from the wild-type sequence, and the consensus core sequence is underlined: –2923 CRE1, GTCCACTGCTGCTGCAGCTTCCATCAGAGGTGGGCCATGGG; –432 CRE1, GGAGAGCGTGGGCCTGGGGTTCCGGAATGCTCTGTGCGGGG; –3848 GRE1, GTTTCTGGTAGTGACACATTACTCTGGAGGGCCTTTCAAATG; –3743 GRE1, GTTCCCAGGAATGACATGTTACTCTGGAGGGCCTTTCAAATG; –2363 GRE1, CAGTGGCAGAGTCAAAGGCTACTCTGCATCCTGAATGAGCAG.

EMSAs
EMSAs were performed to further demonstrate that the GRE site is functional. The gel shift assay system (Promega) was used for all experiments. In the EMSA, radiolabeled oligonucleotides each containing one of the two CRE sites from the native CRF2(a) sequence were incubated with nuclear extract obtained as previously described (25) from CHO-K1 cultures treated with 10 µM forskolin for 22 h. Specificity was demonstrated by incubating the radiolabeled oligonucleotides with the nuclear extracts along with greater than 1000-fold molar excess of unlabeled native CRE, mutant CRE sequence (described in previous section), or an unrelated oligonucleotide containing an activator protein-1 (AP-1) sequence (5'-CGCTTGATGAGTCAGCCGGAA-3') obtained from the Promega assay kit. In addition, the same nuclear extracts were incubated with the radiolabeled mutated CRE oligonucleotides. To investigate binding to the three GRE sites, similar studies were done by incubating radiolabeled oligonucleotides, each containing one of the three sites from the native CRF2(a) sequence with nuclear extract from CHO-K1 cultures treated with 20 µM DEX for 22 h. The same specificity controls as those described for the CRE sites were performed for the GRE sites. The following wild-type oligos were radiolabeled for the EMSA, the consensus core sequences are underlined and in bold (the mutant oligos that were used based on these wild-type sequences are identified in the preceding section): –2923 CRE wild-type, GTCCACTGCTGCTGCAGCTGACATCAGAGGTGGGCCATGGG; –432 CRE wild-type, GGAGAGCGTGGGCCTGGGGTGACGGAATGCTCTGTGCGGGG; –3848 GRE wild-type, GTTTCTGGTAGTGACACATTGTTCTGGAGGGCCTTTCAAATG; –3743 GRE wild-type, GTTCCCAGGAATGACATGTTGTTCTGGAGGGCCTTTCAAATG; –2363 GRE wild-type, CAGTGGCAGAGTCAAAGGCTGTTCTGCATCCTGAATGAGCAG.

Statistics
The data were analyzed with one- or two-factor ANOVAs. Following significance in the ANOVAs, data were subjected to analysis with Bonferroni posttests in which the value necessary for significance (P < 0.05) is lowered by dividing by the number of comparisons that are made. Analysis was done using GraphPad Prism version 4.01 for Windows (GraphPad Software, San Diego, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Analysis of cloned human promoter sequence
Figure 2Go shows a comparison of the CRF2 gene structure between the rat and human clones. This human PAC clone (RP5–1143H19) contained a 127,425-bp insert, which included the first exons for the CRF2(a), CRF2(b), and CRF2(c) receptors and the remaining 11 exons that are common to all three isoforms. The clone contains approximately 42,000 bp upstream of exon 1 of the CRF2(a) and approximately 39,000 bp downstream of the final exon. Sequencing revealed that the rat clone was 14,894 bp long, and the intron/exon junctions were identified by comparison of the insert sequence to that of rat CRF2(a) (GenBank accession no. U16253), mouse CRF2(b) (GenBank accession no. U21729), and human CRF2(c) (GenBank accession no. AF019381) cDNAs. This revealed that the rat clone contained the first exons of the CRF2(a) and CRF2(c) and second exon (labeled 1b) of the CRF2(b) (Fig. 2Go). The clone also contained exon 2, which is common to each of the isoforms. In addition, the clone contained a region that corresponds to the first exon of the CRF2(c); however, it lacks the necessary consensus splice site sequences and ATG translation start site to function as an exon.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 2. Comparison of the CRF2 gene structure between the rat and human clones. Note that (a), (b), and (c) refer to the three different isoforms of the CRF2 receptor. Following the previously published nomenclature (19 ), (b)1a and (b)1b refer to the first two exons of the CRF2 receptor isoform; (a)1 and (c)1 refer to the first exons of the CRF2(a) and CRF2(c) isoforms. Exons 2–12 are in common with all three isoforms.

 
Transient transfection assays
Effects of activating the cAMP pathway on CRF(2a) promoter activity.
In these experiments, CHO-K1 cultures were transiently transfected with the CRF2(a) promoter constructs. At the time of transfection, the cultures were given either vehicle or 10 µM forskolin. Forskolin directly activates adenylate cyclase and dramatically increases the intracellular levels of cAMP. After 22 h, the cultures were harvested for the luciferase assay as described above. Two-way ANOVA (treatment by construct) revealed a significant main effect of treatment [F(1,197) = 103, P < 0.0001], construct [F(10,197) = 164, P < 0.0001], and treatment by construct interaction [F(10,197) = 3.72, P < 0.0001]. All constructs showed significantly greater expression than the promoterless control (pGL3-basic). The only exception was with cultures transfected with 1916 bp of unrelated DNA sequence, which, as expected, yielded no significant luciferase activity (data not shown). In general, the level of basal expression increased as the promoter was truncated (Fig. 3Go). Post hoc analysis with Bonferroni posttests revealed a significant forskolin-induced increase in expression when compared with the respective vehicle control cultures for five of the constructs (–3917, –3425, –1394, –859, and –365). The other constructs did not show a significant forskolin-induced change in expression compared with their respective vehicle controls (Fig. 3Go). These results suggest that a forskolin-induced increase in expression from the CRF2(a) promoter is mediated through regulatory element(s) located somewhere between –3917 and –2903 and between –1934 and –315 bp relative to the putative TSP. Analysis of this sequence with MatInspector version 2.2 revealed two putative CREs within the putative promoter region.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 3. Expression from CRF2(a) promoter fragments after treatment of CHO-K1 cultures with forskolin. Reporter constructs in which fragments of the human CRF2(a) promoter drive expression of the firefly luciferase gene were transiently transfected into the CHO-K1 cell line along with the pRL-TK internal control construct. After transfection, cultures were treated for 22 h with 10 µM forskolin, whereas control cultures received vehicle. These data represent the average of nine independent determinations ± SEM (*, P < 0.05 and ***, P < 0.001). These results suggest the putative CRE elements –2923 and –432 may be responsible for the forskolin-induced increases in expression.

 
To determine whether a similar expression pattern was seen in a cell line known to express CRF2 receptors, the same reporter constructs were transiently transfected into the A7R5 cell line along with the pRL-TK internal control construct. After transfection, experimental cultures were given 10 µM forskolin or vehicle. After 22 h, the cultures were lysed, normalized for total protein, and assayed for luciferase activity. Forskolin treatment tended to increase expression from all the constructs (Fig. 4Go). A two-way ANOVA (treatment by construct) showed a significant main effect for the treatment [F(1,194) = 22.7, P < 0.0001] and construct [F(10,194) = 120, P < 0.0001]. All constructs showed significantly greater expression than the promoterless control (pGL3-basic). In addition, the pattern of basal expression was very similar to that reported when these constructs were transfected into the CHO-K1 cell line. Bonferroni posttests demonstrated that forskolin treatment significantly increased expression (compared with vehicle-treated controls) from the –3917 and –3425 constructs. Increased cAMP is known to increase pCREB levels, which can then bind CRE cis-regulatory elements. As seen in Fig. 1Go, the locations of the putative CREs are –2923 and –432. The results suggest these two elements may be responsible for the forskolin-induced increases in expression.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 4. Expression from CRF2(a) promoter fragments after treatment of A7R5 cultures with forskolin. Reporter constructs in which fragments of the human CRF2(a) promoter drive expression of the firefly luciferase gene were transiently transfected into the A7R5 cell line along with the pRL-TK internal control construct. After transfection, experimental cultures were treated for 22 h with 10 µM forskolin; control cultures received the vehicle. These data represent the average of nine independent determinations ± SEM. Increasing cAMP levels tends to increase expression from all the constructs (*, P < 0.05 and **, P < 0.01). These results suggest the CRE elements at –2923 and –432 may be responsible for the forskolin-induced increases in expression.

 
Effects of activating glucocorticoid receptors on CRF2(a) promoter activity.
Reporter constructs in which fragments of the human CRF2(a) promoter drive expression of the firefly luciferase gene were transiently transfected into the CHO-K1 cell line along with the pRL-TK internal control construct. After transfection, experimental cultures were treated with 20 µM DEX, whereas control cultures received the vehicle. DEX binds glucocorticoid receptors, and this complex binds GRE cis-regulatory elements located in the promoter fragments. After 22 h, the cultures were lysed, normalized for total protein, and assayed for luciferase activity. DEX tended to decrease expression from all the constructs (Fig. 5Go). A two-way ANOVA (treatment by construct) indicated a significant main effect of treatment [F(1,274) = 14.3, P < 0.0005], construct [F(10,274) = 272, P < 0.0001], and treatment by construct interaction [F(10,274) = 4.92, P < 0.0001]. Bonferroni posttests demonstrated that the treatment significantly decreased expression (compared with vehicle-treated controls) from the –3917 construct. As seen in Fig. 1Go, the putative GREs are located at –3848, –3743, and –2363. Our results suggest the –3848, –3743, and –2363 elements may be responsible for the DEX-induced decreases in expression.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 5. Expression from the CRF2(a) promoter fragments after DEX treatment of CHO-K1 cells. Reporter constructs in which fragments of the human CRF2(a) promoter drive expression of the firefly luciferase gene were transiently transfected into the CHO-K1 cell line along with the pRL-TK internal control construct. After transfection, experimental cultures were treated with 20 µM DEX, whereas control cultures received vehicle. DEX binds glucocorticoid receptors and this complex binds GRE cis-regulatory elements. The data represent the average of 12 independent determinations ± SEM (***, P < 0.001). These results suggest the putative GREs at –3848, –3743, and –2363 may mediate the DEX-induced decrease in expression.

 
To determine whether the DEX response was similar in A7R5 cells, the same reporter constructs were transiently transfected into the A7R5 cell line [known to express CRF2(b) receptors] along with the pRL-TK internal control construct. After transfection, cultures were treated with either 20 µM DEX or vehicle. After 22 h, the cultures were lysed, normalized for total protein, and assayed for luciferase activity (Fig. 6Go). Analysis of the data by two-way ANOVA (treatment by construct) showed a significant main effect of treatment [F(1,200) = 4.05, P < 0.05], construct [F(10,200) = 264, P < 0.0001], and treatment by construct interaction [F(10,200) = 4.10, P < 0.0001]. Bonferroni posttests demonstrated that the DEX significantly decreased expression (compared with vehicle-treated controls) from the –3917 construct. As seen in Fig. 1Go, the locations of the putative GREs are –3848, –3743, and –2363. Our results suggest the –3848, –3743, and –2363 elements may be responsible for the DEX-induced decreases in expression. These results are similar to those from the CHO-K1 cells.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 6. Expression from the CRF2(a) promoter fragments after DEX treatment of A7R5 cells. Reporter constructs in which fragments of the human CRF2(a) promoter drive expression of the firefly luciferase gene were transiently transfected into the A7R5 cell line along with the pRL-TK internal control construct. After transfection, experimental cultures were given 20 µM DEX, whereas control cultures received the vehicle. DEX binds glucocorticoid receptors and this complex binds GRE cis-regulatory elements. These data represent the average of nine independent determinations ± SEM (**, P < 0.01). These results suggest that the putative GREs at –3848, –3743, and –2363 may be responsible for the DEX-induced decrease in expression.

 
Effects of CRF2 receptor activation on CRF2(a) promoter activity.
To determine whether CRF2 receptor activation may alter activity of the CRF2(a) promoter, A7R5 cultures, known to express CRF2(b) receptors (23), were treated with CRF2 receptor peptide agonists. In addition to treating the cultures with CRF and UCN 1 (1 µM each), A7R5 cultures also were treated with the antagonists D-Phe or DMP696 (1 µM each), CRF plus D-Phe (1 µM each), CRF plus DMP696 (1 µM each), UCN 1 plus D-Phe (1 µM each), or with UCN 1 plus DMP696 (1 µM each). D-Phe is a nonselective CRF receptor antagonist, blocking both CRF1 and CRF2 receptors, whereas DMP696 is specific to CRF1 receptors (26). As a positive control, cells were treated with forskolin (10 µM), at the same concentration used in Figs. 3Go and 4Go. This concentration has previously been shown to increase cAMP levels in A7R5 cells (27).

Analysis of the forskolin, CRF, and UCN 1 treatments with a one-factor ANOVA revealed significant effects of treatment [F(7,107) = 23.3, P < 0.0001]. Post hoc analysis with the Bonferroni multiple comparison test comparing all groups revealed that forskolin, CRF, and UCN 1 significantly increased expression from the –3917 construct, compared with the vehicle-treated controls (Fig. 7Go). Treatment with either D-Phe or DMP696 alone did not have a significant effect on promoter activity (data not shown). The addition of the nonselective CRF receptor antagonist, D-Phe, with either CRF or UCN 1 lowered expression to the levels seen in the vehicle-treated controls. However, the specific CRF1 receptor antagonist, DMP696, did not affect the CRF-induced increase in expression from the full-length promoter. Whereas UCN 1 in the presence of DMP696 did not significantly increase expression compared with vehicle, there was a trend for an increase. The lack of a significant difference between the UCN 1/DMP696 condition and the vehicle condition may result from the use of the Bonferroni posttest, which is highly rigorous and may miss significant differences. In a standard t test without the Bonferroni correction on the {alpha}-value, P = 0.039. This suggests the DMP696 may not have blocked the UCN 1 effect. Given this potential statistical caveat with the UCN 1 data, these results demonstrate that either CRF or UCN 1 can increase expression from the –3917 CRF2(a) receptor promoter construct within A7R5 cultures in a CRF2 receptor-dependent manner.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 7. Effects of CRF2 receptor activation on expression from the –3917 CRF2(a) promoter construct in A7R5 cells. These data represent the average of 12 independent determinations, except for vehicle, which represents the average of 24 independent determinations ± SEM. Similar to what was shown in Fig. 4Go, treatment with 10 µM forskolin significantly increased promoter activity. Similarly, compared with vehicle, 1 µM CRF increased expression from the full-length promoter. The nonselective CRF receptor antagonist D-Phe (1 µM) prevented the reduction, whereas the CRF1-specific receptor antagonist DMP696 did not alter the CRF response. This suggests that CRF influences the CRF2(a) receptor promoter activity via a CRF2 receptor activation (**, P < 0.01 and ***, P < 0.001, compared with vehicle). UCN 1 (1 µM) also significantly increased expression, compared with vehicle, and this effect was blocked by the nonselective CRF receptor antagonist D-Phe (1 µM). In contrast to the effects on the CRF response, promoter activity after treatment with UCN 1 and DMP696 (1 µM) was not significantly different from vehicle.

 
Site-directed mutagenesis
CRE sites.
To assess the relative importance of the –2923 and –432 CRE cis-regulatory elements in relation to the forskolin-induced increases in expression from the human CRF2(a) promoter, site-directed mutagenesis was used to alter the DNA sequence of the CREs within the full-length –3917 reporter construct. The two constructs with CRE mutations (termed –2923 and –432), along with the wild-type construct (–3917), were transiently transfected into the CHO-K1 cell line along with the pRL-TK internal control construct. After transfection, experimental cultures were treated with 10 µM forskolin; control cultures received vehicle treatment. As demonstrated in the prior experiments, increasing cAMP levels in cultures transfected with the wild-type promoter construct increased luciferase activity (Fig. 8AGo). Analysis of the data by two-way ANOVA (treatment by construct) showed a significant main effect of treatment [F(1, 82) = 100, P < 0.0001], construct [F(3, 82) = 389, P < 0.0001], and treatment by construct interaction [F(3, 82) = 22.7, P < 0.0001]. Bonferroni posttests demonstrated that the treatment significantly increased expression (compared with vehicle-treated controls) from the wild type and –432 constructs (* = P < 0.001). However, forskolin treatment did not significantly increase expression from the construct in which the –2923 CRE was mutated. Furthermore, expression from the vehicle-treated wild-type and mutated constructs was not significantly different, suggesting that the mutations did not adversely impact levels of basal expression. These results directly implicate the –2923 CRE as being important in the forskolin-induced increase in expression.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 8. Effects of site-directed mutagenesis of the CRE sites. A, Expression from CRF2(a) promoter constructs containing CRE mutations after forskolin treatment of CHO-K1 cultures. The two constructs with CRE mutations (termed –2923 and –432) and the wild-type construct (–3917) were transiently transfected into the CHO-K1 cell line along with the pRL-TK internal control construct. After transfection, cultures were treated with 10 µM forskolin or vehicle. The data represent the average of nine independent determinations ± SEM (***, P < 0.001). Forskolin treatment was unable to significantly increase expression from the construct in which the –2923 CRE was mutated. Expression from the wild-type and mutated constructs treated with the vehicle were not significantly different. This suggests that the mutations do not adversely impact basal levels of expression. B, To detect specific protein binding to the CRE consensus sites implicated in A, an EMSA was performed incubating each of the two radiolabeled CRE oligos (–2923 and –432) with nuclear extract from 10 µM forskolin-treated CHO-K1 cells. For the –2923 oligo, this resulted in shifted band(s) corresponding to protein bound to the promoter element. Other than the bands shown, no other protein-DNA bands were observed. The binding was specific because it was not present in the absence of nuclear extract (lane 1) and was blocked in the presence of excess unlabeled CRE oligo (lane 3) but not by an unlabeled AP-1 oligo (lane 4) or a mutated CRE-containing oligo (lane 5). In addition, no protein binding was seen when a radiolabeled mutant CRE oligo was incubated with nuclear extract (lane 6). These results strongly implicate the –2923 CRE as being important to the forskolin-induced increase in expression from the human CRF2(a) promoter. The EMSA results with the –432 oligo were not as clear cut (see Results).

 
EMSAs were performed to examine transcription factor binding to the putative cis-regulatory element. These assays use a radioactively labeled oligonucleotide that contains the CRE consensus sequence and additional flanking sequence found in the CRF2 gene promoter. If the nuclear extract contains a transcription factor capable of binding the oligonucleotide, a protein-DNA complex will form. Compared with the unbound oligonucleotide, this protein-DNA complex will migrate more slowly through a bis-acrylamide gel during electrophoresis. In these experiments nuclear extracts were obtained from CHO-K1 cells treated with 10 µM forskolin as described for the experiments in Figs. 3Go, 4Go, and 8aGo. As with the functional studies, the EMSA experiments gave different results for the two mutations. For the –2923 mutation, the wild-type CRE oligonucleotide bound protein, whereas oligonucleotide with a mutated, nonfunctional CRE site (see Materials and Methods) was not bound by protein (Fig. 8BGo). This indicates that a consensus CRE site is necessary for binding to occur. Furthermore, the addition of unlabeled wild-type oligonucleotides competed for the binding to the labeled wild-type CRE oligonucleotides, whereas unlabeled mutant oligonucleotides or unlabeled oligonucleotides containing an AP-1 regulatory element did not compete for protein binding. Therefore, the binding to the CRE site is highly specific, and the mutation that abolishes responsiveness to forskolin also abolishes protein binding to the cis-regulatory element at –2923. In contrast, the mutation at –432 gave different results because there was protein binding to the labeled wild-type oligonucleotide. However, this binding was not competed for in the presence of the unlabeled competitor. Likewise, the AP-1 oligonucleotide did not compete for binding. When the labeled mutated oligo was used in the assay, there was no discrete band but a nonspecific smear. Taken together, the EMSA data suggest that the binding to the –432 CRE, located on the noncoding strand (see Fig. 1Go), may be nonspecific. This is consistent with the observation in Fig. 8AGo that mutation of this CRE does not affect the response to forskolin.

GRE sites.
To assess the relative importance of the –3848, –3743, and –2363 GRE cis-regulatory elements to the DEX-induced decreases in expression from the human CRF2(a) promoter (Figs. 5Go and 6Go), site-directed mutagenesis was used to alter the DNA sequence of the GREs within the full-length –3917 reporter construct. The three constructs with GRE mutations (termed –3848, –3743, and –2363), or the wild-type construct (–3917), were transiently transfected into the CHO-K1 cell line along with the pRL-TK internal control construct. After transfection, experimental cultures were treated with 20 µM DEX, whereas control cultures received the vehicle. After 22 h, the cultures were lysed, normalized for total protein, and assayed for luciferase activity. As demonstrated in the prior experiments, glucocorticoid administration to cultures transfected with the wild-type promoter construct decreased luciferase activity (Fig. 9AGo). Analysis of the data by two-way ANOVA (treatment by construct) showed a significant main effect of treatment [F(1,278) = 317, P < 0.0001], construct [F(4,278) = 776, P < 0.0001], and treatment by construct interaction [F(4,278) = 58.3, P < 0.0001]. Bonferroni posttests demonstrated that the treatment significantly decreased expression (compared with vehicle-treated controls) from the wild-type, –3848, –3743, and –2363 constructs. Furthermore, expression from the –3743 and –2363 mutated constructs treated with vehicle was significantly lower than wild-type constructs treated with vehicle. This suggests that these two GREs are important for the basal levels of expression from the human CRF2(a) promoter. Mutation of the –3848 GRE does not appear to affect either basal expression or DEX-induced decreases in expression. Mutation of either the –3743 or –2363 GREs appears to greatly diminish, but not abolish, the DEX-induced changes in expression, which suggests these two GREs are important in mediating the effects of glucocorticoids on CRF2(a) promoter activity. Binding of glucocorticoid receptors to both the –3743 and –2363 GREs may be required to elicit the maximal glucocorticoid-induced decrease in expression. Therefore, it is reasonable that mutation of either GRE individually would not abolish the entire glucocorticoid-induced effect.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 9. Effects of site-directed mutagenesis of the GRE sites. A, Expression from CRF2(a) promoter constructs containing GRE mutations after DEX treatment of CHO-K1 cultures. The three constructs with GRE mutations (termed –3848, –3743, and –2363), along with the wild-type construct (–3917), were transiently transfected into CHO-K1 cells along with the pRL-TK internal control construct. The data represent the averages ± SEM; n = 48 for the wild-type construct, n = 12 for the –3848 mutation, n = 24 for the –3743 mutation, n = 12 for the –2363 mutation, and n = 48 for the pGL3-basic promoterless control. After transfection, cultures were treated for 22 h with 20 µM DEX or vehicle. DEX treatment significantly decreased expression (compared with the respective vehicle sample) from the wild-type, –3848, –3743, and –2363 constructs (*, P < 0.05 and ***, P < 0.001). Whereas the DEX-induced decrease in expression was not abolished by mutating the consensus GRE sequences in the –3743 and –2363 constructs, the magnitude of the DEX-induced decrease was greatly attenuated. Furthermore, expression from the –3743- and –2363-mutated constructs treated with vehicle was significantly lower than that for the wild-type constructs treated with vehicle (**, P < 0.01 and ***, P < 0.001). Mutation of the –3848 GRE did not appear to affect either basal or DEX-induced decreases in expression. B, To detect specific protein binding to the GRE consensus sites implicated in A, an EMSA was performed incubating each of the three radiolabeled GRE oligos (–3848, –3743, and –2363) with nuclear extract from 20 µM DEX-treated CHO-K1 cells. This resulted in shifted band(s) corresponding to protein bound to the promoter element (lane 2). Other than the band shown, no other protein-DNA bands were seen. The binding was not detected in the absence of nuclear extract (lane 1) and was blocked in the presence of excess unlabeled GRE oligo (lane 3) but not by an unlabeled AP-1 oligo (lane 4) or a mutated GRE-containing oligo (lane 5). In addition, no protein binding was seen when radiolabeled mutant GRE oligos were incubated with nuclear extract (lane 6). Taken together, these results indicate the GREs at –3743 and –2363 are important in regulating the basal expression and DEX-induced decrease in the CRF2(a) promoter activity.

 
Having demonstrated the importance of the putative GRE sites in the expression studies, an EMSA was performed to demonstrate specific protein binding to the three putative cis-regulatory elements. One way to demonstrate specificity is to show that mutation of 2 bp within the consensus core of the GREs prevents protein binding to the regulatory element. EMSA results similar to those seen with the CRE oligonucleotides were observed with the three oligonucleotides containing the putative GREs that are present in the promoter sequence (Fig. 9BGo). The EMSA experiments demonstrated that all three wild-type GRE oligonucleotides bound protein, whereas oligonucleotides with a mutated GRE site (see Materials and Methods) were not bound by protein (Fig. 9BGo). Furthermore, unlabeled wild-type oligonucleotides competed away the binding, whereas unlabeled mutant oligonucleotides or unlabeled oligonucleotides containing an AP-1 regulatory element did not compete for the binding protein. Therefore, the binding to the GRE site is highly specific, and mutations that diminished the responsiveness to DEX also greatly diminished protein binding to the cis-regulatory element.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The critical role of the CRF2(a) receptor in mediating the effects of CRF and CRF-like peptides on anxiety-like behaviors has been established in studies from several laboratories using peptide antagonists or antisense oligonucleotides (28, 29). Therefore, understanding the regulation of this receptor may lead to novel approaches and targets for the treatment of psychiatric illness. The promoter region of a gene is vital in determining where a gene is expressed, how much the gene is expressed, and when during development the gene is expressed. Therefore, understanding the factors that regulate the activity of the CRF2(a) promoter region can provide insight into its regulation as well as identifying important genomic regions in which inherited differences may have a significant impact on the functioning of the CRF system. In the present study, we demonstrate that a fragment starting 3917 bp upstream of the putative TSP of the CRF2(a) gene produces significant expression in two different cell lines, hamster CHO-K1 and rat A7R5. This suggests that this region of the gene serves as a functional promoter to control expression of the CRF2(a) receptor isoform. Analysis of the activity of 10 truncated fragments revealed a basic pattern of increased activity as the length of the promoter was truncated. It is very common for shorter fragments of a promoter to yield higher levels of transcriptional activity. As the size of the promoter fragment approaches 150–200 bp, the sequence will contain primarily the binding sites for the basal transcription machinery without any additional regulatory elements that may exercise inhibitory control.

In the present studies, we used cell lines derived from rodent tissue to study the human promoter. This is reasonable because many transcription factors are present in a variety of cell lines and are highly conserved between species. The hamster CHO-K1 cell line was chosen for a variety of reasons: it is commonly used for gene transfection studies because it efficiently transcribes extrachromosomal (plasmid) DNA; it is easy to culture due to its rapid growth rate; it has a high transfection efficiency with only limited cell death; and finally CHO-K1 cells have a stable karyotype, a trait that is not a common characteristic of many cell lines. We also used the rat aortic cell line A7R5 that is known to express CRF2 receptors. This has the distinct advantage of allowing for assessment of the effects of CRF2 receptor activation on the activity of the CRF2(a) promoter. Comparing results obtained from two cell lines derived from two different species and two different tissues strengthens the generalizability of our findings.

In addition to identifying the functionally active regions within the promoter, the present studies identified functional cis-regulatory elements. Forskolin significantly increases expression from the human CRF2(a) promoter. We also demonstrate that treatment of the CRF2(b) receptor-expressing cell line, A7R5, with CRF or UCN 1 increases CRF2(a) promoter activity. CRF receptor activation increases cAMP levels; therefore, these data are consistent with the forskolin results. The CRE located at –2923 on the coding strand most likely confers this effect because site-directed mutation of the consensus CRE sequence at this position abolishes the ability of forskolin to increase luciferase activity within the full-length promoter. In contrast, mutation of the putative CRE at –432 bp on the noncoding strand of the promoter was without a significant effect on the forskolin response within the full-length promoter. Although the –432 CRE does not appear to mediate the forskolin response within the full-length promoter, as additional regulatory elements are removed in the truncated constructs, the relative importance of the –432 CRE may increase. Furthermore, elevations of cAMP may lead to alterations in transcription factors that do not act through CREs. Finally, additional CREs may exist that we were unable to identify in our software-aided analysis. This can explain why forskolin can induce promoter activity from fragments that do not contain the –2923 CRE.

The EMSA results were consistent with the functional data described above in that specific protein binding was seen with an oligonucleotide containing the –2923 CRE but not the –432 CRE. Therefore, both the expression and EMSA data suggest that the –2923 CRE is important in mediating the effects of cAMP on CRF2(a) promoter activity within the full-length promoter.

A perplexing result was the apparent blockade of the UCN 1-induced increase in promoter activity by the CRF1 receptor selective antagonist DMP696. Because A7R5 cells lack CRF1 receptors (30), we would not expect DMP696 to inhibit the effects of CRF. Indeed, CRF with D-Phe treatment did not significantly alter expression compared with vehicle, whereas CRF with DMP696 treatment significantly increased expression compared with vehicle. This is consistent with a role for CRF2 receptors in mediating the effects of CRF. However, this was not the case with the effects of UCN 1. UCN 1 with either D-Phe or DMP696 treatment was not significantly different from vehicle. Our finding that UCN1 with DMP696 treatment was not significantly different from vehicle may be the result of the highly rigorous posttest that was employed (see Results). It is also possible that there is another receptor present on the A7R5 cells that binds UCN 1 but not CRF. This receptor may be antagonized by both D-Phe and DMP696.

In contrast to forskolin, DEX significantly decreases expression from the human CRF2(a) promoter. Mutation of the GREs at –3743 or –2363 significantly decreased the effects of DEX treatment on the expression of luciferase activity. This suggests both of these GREs play a role in mediating the response to glucocorticoids. In addition to the effects on the DEX response, the mutations of the GREs at –3474 and –2363 caused a significant decrease in the basal expression of the luciferase activity. This suggests that glucocorticoid receptor activation in the CHO-K1 cell line may also contribute to basal levels of CRF2(a) promoter activity. Similar to the results for the CRE oligonucleotides, EMSA studies show specific protein binding to all three of the oligonucleotides corresponding to the three consensus GRE sequences located in the CRF2(a) promoter. This is true despite the fact that the GRE at position –3848 does not appear to mediate the effects of glucocorticoids on the activity of the promoter. These data suggest the GRE at –3848 may be able to bind protein as an oligonucleotide, but that, in the context of the entire promoter sequence, either protein binding does not occur or, if it does, it is not functional in regulating promoter activity.

The observation of promoter activity from the region immediately upstream of the first exon of the CRF2(a) mRNA is in agreement with a previous report (19) showing that the three known isoforms CRF2(a), CRF2(b), and CRF2(c) are controlled by separate promoters as well as by alternate splicing. Before this published report, the various isoforms were thought to arise solely from alternative splicing of mRNA. It will also be important to thoroughly characterize the human CRF2(b) and CRF2(c) promoter regions to further understand the mechanisms responsible for the distinct patterns of distribution seen with the three different CRF2 receptor isoforms.

This is the first study to directly examine the effects of cAMP and glucocorticoids on the regulation of promoter activity for the CRF2 receptor gene. The relevance of our findings to in vivo regulation and possible pathological responses to short-term and long-term exposure to stress are currently unknown. However, the present in vitro studies indicate that glucocorticoids and cAMP can regulate transcription of the CRF2(a) gene, and it is possible that this regulation is related to stress-induced psychopathology. For example, exposure to stressful stimuli increases the release of CRF and related peptides (31, 32). This leads to activation of CRF receptors and subsequent elevation of intracellular cAMP. This may result in increased CRF2(a) receptor levels through the action of phosphorylated cAMP response element-binding protein on the CRE cis-regulatory element located in the promoter region at –2923 (Fig. 10Go). This increase in CRF2(a) receptor levels may increase sensitivity to the effects of exposure to subsequent stressors.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 10. Model depicting the proposed mechanism by which stress can affect the expression of the CRF2(a) receptor through the release of CRF. The (–) symbol refers to an inhibition of promoter activity, and the (+) symbol refers to stimulation of promoter activity. GR, Glucocorticoid receptor; PKA, protein kinase A; pCREB, phosphorylated cAMP-response element binding protein. Open boxes indicate the location of the consensus regulatory element sequences, and the arrowheads indicate the strand on which the consensus sequences lie (forward arrow, coding strand; reverse arrow, noncoding strand).

 
Additionally, increases in hypothalamic CRF release increase cortisol levels. Our data suggest that the GREs located at –3743 and –2363 are important in controlling the basal expression of the CRF2(a) isoform and mediating glucocorticoid-induced decreases in CRF2(a) promoter activity (Fig. 10Go). This decrease is the opposite of that seen with increases in cAMP and could serve as a negative feedback loop to offset the cAMP-mediated increase in CRF2 receptor levels. Of course, there are other transcription factor binding sites involved in the regulation of CRF2 gene expression. Additionally, there will be tissue-specific differences in the regulatory factors that are expressed and mediate regulation of gene expression.

The suppression of CRF2(a) gene expression in heart smooth muscle by glucocorticoids may be physiologically relevant. It has been hypothesized that the CRF system plays an important role in mediating the effects of stress on the heart. Activation of this system may result in an increased ionotropic effect and coronary artery vasodilatation that would allow an organism to meet the increased hemodynamic demands associated with the enhanced performance necessary in stressful situations. Studies of rat aorta cells demonstrate that UCN decreases expression of CRF2(b) mRNA and that this effect can also be achieved by exposure to glucocorticoids (23). It is possible that glucocorticoid-mediated modulation of CRF2 receptor expression in smooth muscle cells will decrease the sensitivity of these tissues to the effects of elevated UCN1 or CRF levels. This may protect the heart from further CRF-mediated stress-induced damage.

To conclude, this is the first study to identify functional regulatory elements within the promoter region of the human CRF2(a) gene. Future work will focus on identifying the importance of other putative cis-regulatory elements located in this region. In addition, it will be important to characterize the corresponding regions upstream of the TSPs for the CRF2(b) and CRF2(c). This will help provide insight into the regulation of the entire CRF system, specifically factors that determine the distribution of the different CRF2 receptor isoforms in the brain and periphery. Finally, an understanding of the regulatory elements that control expression, and the transcription factors that interact with them, can provide new targets for therapeutic intervention in the treatment of a variety of stress-related pathologies including depression, anxiety disorders, and irritable bowel syndrome.


    Acknowledgments
 
We thank Drs. Robert C. Zaczek and Paul J. Gilligan (Bristol-Myers Squibb, Wilmington, DE) for the gift of DMP696. We also thank Jeff R. Digre for technical assistance in preparing the promoter constructs.


    Footnotes
 
This work was supported by National Institute of Mental Health Grant MH40855 (to N.H.K.) and funds from the University of Wisconsin HealthEmotions Research Institute and Meriter Hospital (Madison, Wisconsin).

1 S.A.N. and P.H.R. contributed equally to this work. Back

Abbreviations: AP-1, Activator protein-1, CHO, Chinese hamster ovary; CRE, cAMP response element; CRF, corticotropin-releasing factor; CRF-BP, CRF binding protein; DEX, dexamethasone; GRE, glucocorticoid response element; IBMX, 3-isobutyl-1-methylxanthine; PAC, P1-derived artificial chromosome; TSP, transcription start point; UCN, urocortin.

Received July 14, 2004.

Accepted for publication August 18, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kalin NH, Shelton SE, Kraemer GW, McKinney WT 1983 Corticotropin-releasing factor administered intraventricularly to rhesus monkeys. Peptides 4:217–220[CrossRef][Medline]
  2. Kalin NH, Takahashi LK 1990 Fear-motivated behavior induced by prior shock experience is mediated by corticotropin-releasing hormone systems. Brain Res 509:80–84[CrossRef][Medline]
  3. Dunn AJ, Berridge CW 1990 Physiological and behavioral responses to corticotropin-releasing factor administration: is CRF a mediator of anxiety or stress responses? Brain Res Brain Res Rev 15:71–100[CrossRef][Medline]
  4. Owens MJ, Nemeroff CB 1991 Physiology and pharmacology of corticotropin-releasing factor. Pharmacol Rev 43:425–472[Medline]
  5. Vale W, Rivier C, Brown MR, Spiess J, Koob G, Swanson L, Bilezikjian L, Bloom F, Rivier J 1983 Chemical and biological characterization of corticotropin releasing factor. Recent Prog Horm Res 39:245–270
  6. Koob GF, Heinrichs SC, Pich EM, Menzaghi F, Baldwin H, Miczek K, Britton KT 1993 The role of corticotropin-releasing factor in behavioural responses to stress. Ciba Found Symp 172:277–289[Medline]
  7. Grigoriadis DE, Lovenberg TW, Chalmers DT, Liaw C, De Souza EB 1996 Characterization of corticotropin-releasing factor receptor subtypes. Ann NY Acad Sci 780:60–80[Medline]
  8. Vale W, Vaughan J, Perrin M 1997 Corticotropin-releasing factor family of ligands and their receptors. Endocrinologist 7:3S–9S
  9. Pisarchik A, Slominski AT 2001 Alternative splicing of CRH-R1 receptors in human and mouse skin: identification of new variants and their differential expression. FASEB J 15:2754–2756[Free Full Text]
  10. Kilpatrick GJ, Dautzenberg FM, Martin GR, Eglen RM 1999 7TM receptors: the splicing on the cake. Trends Pharmacol Sci 20:294–301[CrossRef][Medline]
  11. Hauger RL, Grigoriadis DE, Dallman MF, Plotsky PM, Vale WW, Dautzenberg FM 2003 International Union of Pharmacology. XXXVI. Current status of the nomenclature for receptors for corticotropin-releasing factor and their ligands. Pharmacol Rev 55:21–26[Abstract/Free Full Text]
  12. Potter E, Behan DP, Fischer WH, Linton EA, Lowry PJ, Vale WW 1991 Cloning and characterization of the cDNAs for human and rat corticotropin releasing factor-binding proteins. Nature 349:423–425[CrossRef][Medline]
  13. Behan DP, De Souza EB, Lowry PJ, Potter E, Sawchenko P, Vale WW 1995 Corticotropin releasing factor (CRF) binding protein: a novel regulator of CRF and related peptides. Front Neuroendocrinol 16:362–382[CrossRef][Medline]
  14. Koob GF, Heinrichs SC 1999 A role for corticotropin releasing factor and urocortin in behavioral responses to stressors. Brain Res 848:141–152[CrossRef][Medline]
  15. Kalin NH 1985 Behavioral effects of ovine corticotropin-releasing factor administered to rhesus monkeys. Fed Proc 44:249–253[Medline]
  16. Nemeroff CB, Widerlov E, Bissette G, Walleus H, Karlsson I, Eklund K, Kilts CD, Loosen PT, Vale W 1984 Elevated concentrations of CSF corticotropin-releasing factor-like immunoreactivity in depressed patients. Science 226:1342–1344[Abstract/Free Full Text]
  17. Nemeroff CB, Owens MJ, Bissette G, Andorn AC, Stanley M 1988 Reduced corticotropin releasing factor binding sites in the frontal cortex of suicide victims. Arch Gen Psychiatry 45:577–579[Abstract/Free Full Text]
  18. De Souza EB, Whitehouse PJ, Kuhar MJ, Price DL, Vale WW 1986 Reciprocal changes in corticotropin-releasing factor (CRF)-like immunoreactivity and CRF receptors in cerebral cortex of Alzheimer’s disease. Nature 319:593–595[CrossRef][Medline]
  19. Catalano RD, Kyriakou T, Chen J, Easton A, Hillhouse EW 2003 Regulation of corticotropin-releasing hormone type 2 receptors by multiple promoters and alternative splicing: identification of multiple splice variants. Mol Endocrinol 17:395–410[Abstract/Free Full Text]
  20. Lovenberg TW, Liaw CW, Grigoriadis DE, Clevenger W, Chalmers DT, De Souza EB, Oltersdorf T 1995 Cloning and characterization of a functionally distinct corticotropin-releasing factor receptor subtype from rat brain. Proc Natl Acad Sci USA 92:836–840[Abstract/Free Full Text]
  21. Quandt K, Frech K, Karas H, Wingender E, Werner T 1995 MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23:4878–4884[Abstract/Free Full Text]
  22. Heinemeyer T, Chen X, Karas H, Kel AE, Kel OV, Liebich I, Meinhardt T, Reuter I, Schacherer F, Wingender E 1999 Expanding the TRANSFAC database towards an expert system of regulatory molecular mechanisms. Nucleic Acids Res 27:318–322[Abstract/Free Full Text]
  23. Kageyama K, Gaudriault GE, Bradbury MJ, Vale WW 2000 Regulation of corticotropin-releasing factor receptor type 2ß messenger ribonucleic acid in the rat cardiovascular system by urocortin, glucocorticoids, and cytokines. Endocrinology 141:2285–2293[Abstract/Free Full Text]
  24. Cortright D, Goosens K, Lesh J, Seasholtz A 1997 Isolation and characterization of the rat corticotropin-releasing hormone (CRH) binding protein gene: transcriptional regulation by cyclic adenosine monophosphate and CRH. Endocrinology 138:2098–2108[Abstract/Free Full Text]
  25. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2499[Free Full Text]
  26. He L, Gilligan PJ, Zaczek R, Fitzgerald LW, McElroy J, Shen HS, Saye JA, Kalin NH, Shelton S, Christ D, Trainor G, Hartig P 2000 4-(1,3-Dimethoxyprop-2-ylamino)-2,7-dimethyl-8-(2, 4-dichlorophenyl)pyrazolo[1,5-a]-1,3,5-triazine: a potent, orally bioavailable CRF(1) receptor antagonist. J Med Chem 43:449–456[CrossRef][Medline]
  27. Kageyama K, Gaudriault GE, Suda T, Vale WW 2002 Regulation of corticotropin-releasing factor receptor type 2ß mRNA via cyclic AMP pathway in A7r5 aortic smooth muscle cells. Cell Signal 15:17–25
  28. Ho SP, Takahashi LK, Livanov V, Spencer K, Lesher T, Maciag C, Smith MA, Rohrbach KW, Hartig PR, Arneric SP 2001 Attenuation of fear conditioning by antisense inhibition of brain corticotropin releasing factor-2 receptor. Brain Res Mol Brain Res 89:29–40[Medline]
  29. Bakshi VP, Smith-Roe S, Newman SM, Grigoriadis DE, Kalin NH 2002 Reduction of stress-induced behavior by antagonism of corticotropin-releasing hormone 2 (CRH2) receptors in lateral septum or CRH1 receptors in amygdala. J Neurosci 22:2926–2935[Abstract/Free Full Text]
  30. Brar BK, Chen A, Perrin MH, Vale W 2004 Specificity and regulation of extracellularly regulated kinase1/2 phosphorylation through corticotropin-releasing factor (CRF) receptors 1 and 2ß by the CRF/urocortin family of peptides. Endocrinology 145:1718–1729[Abstract/Free Full Text]
  31. Schally AV, Andersen RN, Lipscomb HS, Long JM, Guillemin R 1960 Evidence for the existence of two corticotrophin-releasing factors, {alpha} and ß. Nature 188:192–193[Medline]
  32. Pich EM, Lorang M, Yeganeh M, Rodriguez de Fonseca F, Raber J, Koob GF, Weiss F 1995 Increase of extracellular corticotropin-releasing factor-like immunoreactivity levels in the amygdala of awake rats during restraint stress and ethanol withdrawal as measured by microdialysis. J Neurosci 15:5439–5447[Abstract]



This article has been cited by other articles:


Home page
EndocrinologyHome page
S. V. Wu, P.-q. Yuan, L. Wang, Y. L. Peng, C.-Y. Chen, and Y. Tache
Identification and Characterization of Multiple Corticotropin-Releasing Factor Type 2 Receptor Isoforms in the Rat Esophagus
Endocrinology, April 1, 2007; 148(4): 1675 - 1687.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nanda, S. A.
Right arrow Articles by Kalin, N. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nanda, S. A.
Right arrow Articles by Kalin, N. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals