| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
School of Biological Sciences, University of Manchester, Oxford Road M13 9PT, United Kingdom
Address all correspondence and requests for reprints to: Daniela Riccardi, Ph.D., Cardiff School of Biosciences, P.O. Box 911, Cardiff CF11 3US, Wales, United Kingdom. E-mail: RiccardiD{at}cardiff.ac.uk.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although UI is present in specific brain regions in both fish and mammals, a major source of UI in the circulation of fish is thought to be the caudal neurosecretory system (CNSS). This neuroendocrine structure, unique to fish, is located in the terminal vertebral segments, and comprises many large, peptide-synthesizing neurones, the Dahlgren cells. These combine to form nonmyelinated axonal tracts terminating in a discrete neurohemal organ (13), which functionally is reminiscent of that of the anterior neurohypophysis. Here the secretory products, UI and urotensin II (UII), are concentrated within axonal enlargements, the site of storage and subsequent secretion into the general circulation (14). CNSS peptides have been implied in osmoregulation, reproductive biology, and perhaps nutritional behavior (15). We have previously shown that UI stimulates cortisol secretion from the interrenal tissue (16) and proposed that the CNSS may afford stress specific activation of interrenal cortisol secretion, independently of the hypothalamic-pituitary (CRH/ACTH) pathway (13). It is therefore possible that, at the evolutionary level of fish, the separation of CRH (stress axis activation) and UI (nutrition, ionoregulation, and cardiovascular) functions, apparent in mammals, is less complete. Indeed, in view of the recent observation of high circulating CRH levels in tilapia in response to stress (12), which are unlikely to be of hypothalamic origin, in the current study we have examined whether the CNSS could be a potential neuroendocrine source of CRH. Accordingly, initial characterization of UI and CRH gene structures is essential to investigate the potential separate expression of these closely related peptides in the CNSS.
Here, we report the isolation and characterization of the cDNAs encoding CRH and UI, derived from the cluster of perikarya comprising the CNSS in the euryhaline European flounder. Gene analysis by genomic sequencing and Southern blotting is also reported. In addition, the tissue distribution and size of the CRH and UI transcripts is assessed by Northern blot analysis, together with quantitative RT-PCR (qPCR). Finally, the CNSS distributions for CRH and UI mRNAs have been characterized by in situ hybridization, and CRH and UI peptide localization throughout the CNSS is confirmed by immunocytochemistry.
| Materials and Methods |
|---|
|
|
|---|
RNA preparation
Fish were killed using a standard protocol detailed under UK home office license procedures. Fish tissues from 20 animals (optic nerve, brain, spinal cord, gill, head kidney, kidney, bladder, stomach, intestine, rectum, heart, spleen, liver, gonad) were rapidly dissected out, including the caudal 8 segments of the spinal cord and separate urophysis (CNSS). The brain was further dissected into five regions (forebrain, midbrain, hindbrain, hypothalamus, and pituitary). Tissues were homogenized in 4 M guanidium thiocyanate buffer (pH 7.5) containing 1% ß-mercaptoethanol. Total RNA was extracted by ultracentrifugation at 27,000 x g for 20 h on a bed of 5.7 M cesium trifluoroacetate (Amersham Pharmacia Biotech, Amersham, Buckinghamshire, UK). Before RT, RNA for both RT-PCR and library construction was treated with deoxyribonuclease (DNase) (Roche, East Sussex, UK), according to manufacturers instructions. mRNA was purified from 20 CNSS using a Dynabeads mRNA Direct kit (Dynal, Wirral, UK).
cDNA library construction
A full-length CNSS cDNA library was constructed into the phage vector
-TriplEx2 using SMART cDNA library construction kit (CLONTECH, Oxford, UK) and gigapack III gold packaging kit (Stratagene, Amsterdam, The Netherlands), following the protocols provided. The primary library contained two million plaque-forming units.
Cloning of the CRH and UI cDNAs
Partial cloning of the coding region.
From the conserved amino acid sequences of alignment of a range of vertebrate CRH, two degenerate primers were designed for use in PCR. The upstream sense primer sequence (ps-1) was: 5'-SARGGNAARGTNGGNAAYAT-3' and encoded for the peptide W/QGKVGN(I). The downstream antisense primer (pas-1) sequence was: 5'-TTNSWNTGNGCYTGYTGNGC-3', and encoded the peptide AQQAQ/HN/S(N). The CRH primers amplified the nucleotide (nt) region 493674 of the flounder CRH sequence (Fig. 1A
).
|
Using mRNA equivalent to one CNSS, the first-strand cDNA synthesis and PCR were performed as described in the SuperScript II cDNA kit (Invitrogen Life Technologies, Paisley, Scotland, UK) using oligo deoxythymidine (dT)1218. The reaction mixture was stored at 20 C (oligo dT-cDNA). Thirty-five cycles of PCR were performed using ps-1 and pas-1 degenerate primers with the following temperature profile: 95 C for 30 sec, 55 C for 30 sec, and 72 C for 2 min, using the step-cycle program on an ABI (Warrington, UK) 9700 DNA Thermal Cycler in 100 µl of 50 mM KCl, 10 mM Tris/HCl (pH 8.3), 1.5 mM MgCl2, 200 µM of each 5'-nucleotide triphosphate, containing 2 µl oligo dT-cDNA and 100 pmol each primer. After gel purification, approximately 20 ng of the PCR product were subcloned into pGEM T easy vector (Promega, Southampton, UK). Three clones were isolated, sequenced and found to be identical, containing an 182-bp fragment with an open reading frame (ORF) of 61 amino acids corresponding to CRH peptide and an 102-bp fragment with an ORF of 34 amino acids corresponding to UI peptide.
Cloning of full-length cDNAs
The full-length cDNA of CRH and UI were isolated by screening a CNSS cDNA library. A total of 1.0 x 105 plaques from the amplified library were plated out and transferred onto duplicate nitrocellulose membranes (PALL Life Sciences, Hampshire, UK). The membranes were hybridized at high stringency (described in colony and plaque hybridizations protocol, PALL Life Sciences) using specific CRH and UI probes obtained from degenerate RT-PCR. Positive plaques were isolated and two further rounds of screening were used to identify single positive plaques. The pTriplEx2 plasmid containing the positive insert was excised and circularized from the recombinant phage. Three isolates for each gene were sequenced.
Genomic organization
Southern blot analysis.
High molecular weight genomic DNA was isolated from muscle tissue of an individual flounder using established protocols (18). Ten-microgram samples of DNA were digested to completion with BamHI, HindIII, PvuII, or PstI, and the digested DNAs electrophoresed on a 0.7% agarose gel. The gel samples were partially hydrolyzed by acid depurination with 0.2 M HCl for 10 min, then denatured by soaking in 500 ml of 0.5 M NaOH, 1.5 M NaCl for 45 min at room temperature and neutralized in 500 ml of 1.0 M Tris-HCl (pH 7.4) containing 1.5 M NaCl for 45 min. The DNAs were then transferred to a Hybond N nylon membrane using 10x standard saline citrate (SSC) and cross-linked using UV radiation. Prehybridization was performed with QuickHyb solution (Stratagene) for 15 min at 68 C and hybridized with P. flesus CRH or UI cDNA probes at 68 C for 1 h. After hybridization, the blots were washed twice in 2x SSC, 0.1% sodium dodecyl sulfate (SDS) for 15 min at room temperature and then once in 0.1x SSC, 0.1% SDS at 55 C for 30 min. Autoradiographs were exposed at 70 C for 24 h.
Genomic DNA amplification
Twenty-five PCR cycles were performed using gene specific primers (CRHf21-CRHr518; CRHf509-CRHr959; CRHf866-CRHr1168; UIf2-UIr425; UIf258-UIr732; UIf711-UIr1168; UIf1150-UIr1585; for sequence, see Table 1
) with the following temperature profile: 95 C for 30 sec, 55 C for 30 sec, and 72 C for 2 min, using the step-cycle program on a ABI 9700 DNA Thermal Cycler in 50 µl of 50 mM KCl, 10 mM Tris/HCl (pH 8.3), 1.5 mM MgCl2, 200 µM of each 5'-nucleotide triphosphate, containing 100 ng genomic DNA and 10 pmol each primer. After gel purification, approximately 2050 ng of the PCR products were subcloned into pGEM T easy vector (Promega) for sequencing purposes. Three isolates were sequenced.
|
Distribution of CRH and UI mRNA
Northern blot analysis.
Ten micrograms of total RNA from 15 flounder tissues (optic nerve, brain, spinal cord, CNSS, gill, head kidney, kidney, bladder, stomach, intestine, rectum, heart, spleen, liver, gonad) were electrophoresed on a 1% agarose gel for 2.5 h at 150 V. The RNA was transferred onto Hybond N nylon membrane (Amersham Pharmacia Biotech), using 20x SSC prepared with diethylpyrocarbonate-treated water, and cross-linked to the membrane using UV radiation. The CRH and UI cDNA probes obtained from degenerate RT-PCR were prepared by random labeling with [32P]dCTP (Amersham Pharmacia Biotech). Hybridization was carried out in QuickHyb solution (Stratagene) at 68 C for 1 h. The blot was washed twice with 2x SSC containing 0.1% (wt/vol) SDS at room temperature for 15 min and once with 0.1x SSC containing 0.1% (wt/vol) SDS at 55 C for 30 min. Autoradiographs were exposed at 70 C overnight (longer exposure for a week was also applied for CRH and UI).
RT-PCR
Using 1 µg total RNA from the 15 fish tissues and five brain regions described above, the first strand cDNA was synthesized and PCR performed as described in the SuperScript II cDNA kit (Invitrogen Life Technologies) using oligo d(T)1218. The reaction mixture (oligo dT-cDNA) was stored at 20 C. Forty cycles of PCR were performed using cDNA-specific primers (CRHf21-CRHr241; UIf41-UIr124; ActinF-ActinR; for sequence, see Table 1
) with the following temperature profile: 95 C for 15 sec, 55 C for 15 sec, and 72 C for 1 min, using the step-cycle program on a ABI 9700 DNA Thermal Cycler in 25 µl of 50 mM KCl, 10 mM Tris/HCl (pH 8.3), 1.5 mM MgCl2, 200 µM of each 5'-nucleotide triphosphate, containing 1 µl oligo dT-cDNA and 10 pmol each primer.
In situ hybridization
Preparation of CNSS sections.
The terminal region of the spinal cord, approximately the final eight vertebrae, with the urophysis attached, was dissected and fixed in 4% paraformaldehyde. Tissues were dehydrated through graded concentrations of ethanol and embedded in paraffin wax. Longitudinal 4 µm-thick sections were cut, mounted on positively charged slides, and incubated at 60 C for 5 d.
Labeling of the probes
Gene expression in tissue sections was detected by in situ hybridization using 35S-labeled RNA probes. cDNA clones that contained 204 bp CRH (680883) and 278 bp UI (174451) were digested with single restriction enzyme NcoI or SpeI. In the presence of the T7 or SP6 RNA polymerase (Promega) and 35S-UTP and unlabeled nucleotides, single-stranded RNA probes (riboprobes) were synthesized; the coding (sense) probe was used as a negative control. Plasmid DNA template was removed with an ribonuclease (RNase)-free DNase (Promega) digestion.
Hybridization procedure
After dewaxing in three changes of xylene, the sections were rehydrated through a series of ethanols and finally into water. All samples were then permeabilized in 0.2 M HCl for 20 min at room temperature. The samples were then incubated for 1 h in 2.5 g/ml proteinase K at 37 C. All samples were then postfixed in 4% paraformaldehyde. After prehybridization in 50% formamide and 0.6 M NaCl at 50 C for 1 h, each sample was then hybridized in 50% formamide and 0.6 M NaCl at 50 C overnight. Approximately 1.0 x 105 counts of riboprobe were added to each sample.
After overnight hybridization, the samples were washed twice at room temperature for 5min in 2x SSC and 10 mM dithiothreitol, then transferred to fresh 2x SSC for 1 h and subsequently for 4 h in wash buffer (50% formamide, 0.3 M NaCl, 20 mM Tris-HCl, 0.1 mM EDTA, and 10 mM dithiothreitol) at 50 C. The slides were then washed once in NTE buffer (0.5 M NaCl, 10 mM Tris-HCl, 0.1 mM EDTA) for 5 min, followed by RNase treatment (RNase A 20 µg/ml and RNase T1 100 U/ml) in NTE for 30 min at 37 C. The slides were then washed in NTE for 30 min at 37 C, overnight in wash buffer at 50 C, 30 min in 2x SSC and finally 30 min at room temperature in 0.1x SSC. Slides were then dehydrated in 90% ethanol and air-dried. Autoradiography was performed with Ilford (Cheshire, UK) K5 emulsion diluted 1:1 with distilled water. The slides were exposed for 7 d at 4 C, then developed in Ilford phenisol developer for 5 min, rinsed, fixed for 5 min, and counterstained with hematoxylin and eosin.
Western blotting
A CRH peptide was synthesized commercially from the deduced amino acid sequence of flounder C terminus 2237 CRH, where CRH and UI show most difference. The peptide was used to raise antibodies in rabbits (Eurogentec, Seraing, Belgium). Partial UI peptide (flounder C terminus 2441aa UI) was synthesized commercially and used to raise antibodies in rabbits (Biocarta, San Diego, CA). The antisera were purified by affigel affinity purification (Bio-Rad, Hertfordshire, UK). Initial experiments were carried out to demonstrate the specificity of the two antibodies by western blotting and immunocytochemistry.
The CRH and UI antibody specificity were tested by Western blotting on pure peptides and on urophysial protein samples. The standard commercial synthesized CRH and UI peptides were dissolved in dimethylsulfoxide and run under reducing conditions on a 15% SDS gel.
The urophysial samples were prepared by using a glass-to-glass homogenizer in 1% SDS with cocktail proteinase inhibitor. The homogenate was centrifuged at 12,000 x g for 5 min, and the supernatant electrophoresed under reducing conditions on a 15% SDS gel. After the run, the gel was blotted onto a polyvinylidene difluoride membrane and blocked with 5% milk. CRH and UI immunoreactive species were detected using rabbit antiflounder CRH (Eurogentec) and UI (Biocarta) antisera at a 1:100 and 1:300 dilution, respectively, applied overnight. As a secondary antibody we used a swine antirabbit Ig-horseradish peroxidase (1:1000, 1 h; DakoCytomation, Cambridgeshire, UK). The antigen-antibody complex was detected by chemiluminescence (Amersham Pharmacia Biotech) and visualized using the hyperfilm (Amersham Pharmacia Biotech). As negative control experiments we performed Western blotting with omission of the primary antibody and preabsorption of the antibody with the antigenic peptide.
Immunocytochemistry
Immunocytochemistry was carried out based on the method of Santos (19) using swine antirabbit antiserum (DakoCytomation) as the linking reagent and diaminobenzidine as the chromogen. Control experiments were carried out by omitting the primary antibody.
After dewaxing and rehydration, samples were blocked with 4% normal swine serum in PBS (containing 1% BSA and 0.1% NaN3) for 30 min at room temperature. The samples were then incubated with 1:600 CRH or UI antibodies (primary) in PBS/BSA at 4 C overnight. The samples were then washed three times at room temperature in PBS, and then incubated with 1:100 swine antirabbit secondary IgG (DakoCytomation) in PBS/Triton X-100 for 30 min. The slides were then covered with 1:200 rabbit PAP serum (DakoCytomation) in PBS for 30 min, washed twice in PBS for 10 min, incubated in DAB for 5 min and washed twice in PBS for 10 min. The slides were then counterstained with hematoxylin.
Net restraint
We used an acute (30 min) net restraint model to study the CRH and UI responses in stressed fish. Fish (n = 4) were housed in identical tanks. On the day of the experiment, they were restrained for 30 min and sampled 3 h and 24 h later, together with control (i.e. not restrained) fish. Blood was collected by puncture of the caudal vessels using a heparinized needle. The fish was then humanely killed using a standard protocol detailed under UK home office license procedures, and CNSS, hypothalamus, and urophysis were removed for quantitative RT-PCR.
Plasma cortisol determination
Plasma hormone determination was performed following exactly the protocol described by Huising et al. (20). Briefly, the blood was collected in heparinized tubes and plasma cortisol levels were measured by RIA using a commercial antiserum (Bioclinical Services, Ltd., Cardiff, UK)
Quantitative RT-PCR
RNA from CNSS and hypothalamic samples from net-restrained fish was extracted as described above. The qPCR on was carried out in 96-well qPCR plates on ABI PRISM 7000 detector (Applied Biosystems, Foster City, CA). The primers and Taqman probe set were designed using Primer Express software (Applied Biosystems) and were synthesized commercially (Eurogentec). The primer sequences were as follows:
Flounder CRH (126 bp product)
Sense: CRH-163F
Sequence: CCTCTAAAGACTGAAGATTCCTGTTGA
Antisense: CRH-288R
Sequence: ACCGCCAGGGCTGTCA
TaqMan probe:CRH-216T
Sequence: TGGTACCACCGTGATTCTGCTTGTTGC
Flounder UI (75-bp product)
Sense: UI-50F
Sequence: CTGGACGGAACATCGACATG
Antisense: UI-124R
Sequence: GGAGGTGTGATGAGAGGAGGAC
TaqMan probe: UI-73T
Sequence: CCGGCCTCCTTGCTCCTGCTC
Flounder ß-actin (103-bp product)
Sense: actin-352F
Sequence: AAGATGACCCAGATCATGTTCGA
Antisense: actin-454R
Sequence: CGATACCAGTGGTACGACCAGA
TaqMan probe: actin-382T
Sequence: AACACCCCCGCCATGTACGTTGC
The total RNA was extracted from fish CNSS and hypothalamus tissues of stress experiment by Trizol (Invitrogen Life Technologies). One microgram of total RNA of each sample was treated with DNase I (Invitrogen Life Technologies) and the first-strand cDNA was synthesized as described in the SuperScript II cDNA kit (Invitrogen Life Technologies). The real-time PCR was performed in a final volume of 25 µl consisting of: 12.550 ng of reverse-transcribed cDNA mixed with optimal concentration of primers (300 nM), Taqman probe (100 nM), and qPCR Master mix plus kit (Eurogentec). A standard amplification profile was used (2 min at 50 C, 10 min at 95 C and then 40 cycles of the following: 15 sec at 95 C and 1 min at 60 C).
Flounder ß-actin was used as reference gene. Relative quantitation values were expressed using the 2 [(CTsample UI or CRH CTsample Actin) (CTcontrol UI or CRH CTcontrol Actin)] (2-
Ct) method as fold changes in the target gene normalized to the reference gene and related to the expression of control.
Statistical analysis
Results from measurements of plasma cortisol levels and of the cortisol receptor, CRH and UI relative mRNA levels are expressed as means ± SE. Differences between groups were analyzed by ANOVA. Significance levels were set at P < 0.05.
| Results |
|---|
|
|
|---|
Screening of the CNSS cDNA library using a partial preproUI cDNA probe identified three positive clones. Two clones (674 bp and 868 bp; EMBL accession no. AJ517171) contained identical sequences except that one of them was 194 bp shorter at 3'-end. Another clone (1648 bp; EMBL accession no. AJ517172, Fig. 1B
) contained an identical first 674-bp sequence and a different 3'-UTR. An ATG triplet at nt position 67 of preproUI cDNA corresponds to the predicted initiation codon. Both the UI-1 and -2 cDNA sequences contain a 444-bp ORF encoding a putative protein of 147 amino acids, a 357 bp that contains only modified (ATTAAA) polyadenylation signal and 1138 bp 3'-UTR, which contains both a common (AATAAA) and a modified (ATTAAA) polyadenylation signal upstream the poly(A) tail, respectively. The translation of the cDNA sequence showed the ORF to encode a 24-amino acid putative signal peptide, propeptide, and the 41 amino acid mature peptide sequences. The residues Lys-Arg adjacent to the N terminus UI indicate a potential enzymatic cleavage site. The Gly-Lys residues following the C terminus of UI are indicative of a proteolytic processing site and of C-terminal amidation.
Alignment of CRH and UI sequences and database searches
The deduced mature peptide sequence of flounder CRH precursor is closely related to that of catfish and tilapia CRH (Fig. 2
), with more variation compared with orthologous vertebrate and other teleost CRHs (flounder, tilapia, and catfish) CRH peptides differ by two Lys-Ala and Met-Leu substitutions at amino acid positions 24 and 27 (Fig. 2A
). The predicted flounder UI peptide shares a higher degree of sequence identity with other teleost UI than with the orthologous vertebrate urocortin peptides (Fig. 2B
). Overall, a multiple amino acid sequence alignment between flounder and other vertebrate CRH-related precursors and peptides revealed that flounder preproCRH and its mature peptide exhibit higher identities with CRH sequences than with other CRH-related peptides. Similarly, flounder UI precursor and peptide show a higher degree of identity with other UI sequences than with CRH. The deduced amino acid sequences of CRF and UI peptides from flounder exhibit a sequence identity of 51.2%.
|
|
Expression of CRH and UI genes
Tissue distribution of flounder CRH and UI mRNAs.
Northern blot analysis of a range of tissues using the CRH probe identified the CNSS as the major site of production of this peptide (Fig. 4
). One major gene transcript (
1350 nt) and three minor transcripts (2700, 4400, and 6800 nt) were identified (Fig. 4A
). The size of the major transcript is consistent with the predicted length, based on the cDNA clones obtained. After even longer exposure (1 wk), the gene transcripts were not detected in brain or other tissue samples by Northern blot analysis. Similarly, and consistent with previous findings, UI mRNA was only detected in CNSS RNA samples. The UI-specific probe detected one major band (
1650 nt) and four minor bands (900, 3500, 5500, and 7100 nt). This is consistent both with the predicted length (1650-nt major band and 900-nt minor band), based on the cDNA clones obtained, and expected tissue localization of the mRNA. The nature of the 2700-, 4400-, and 6800-nt transcripts is unknown and awaits further investigations.
|
CRH and UI in the caudal neurosecretory system
In situ hybridization of CNSS serial sections using 35S-labeled CRH and UI RNA probes (antisense) showed that about 70% of large Dahlgren cells (4065 µm) and all small Dahlgren cells (25 µm) contained abundant gene expression for both CRH and UI (Fig. 5
). CRH (Fig. 5A
) and UI (Fig. 5B
) mRNAs were not detected in nerve axons, urophysis, capillaries, or ependymal cells of the central canal. Figure 5
, C and D, shows the lack of hybridization of CRH and UI sense probes, respectively, indicating the specificity of the signal. Arrows indicate the multinucleated nature of a typical Dahlgren cell.
|
|
|
|
| Discussion |
|---|
|
|
|---|
Molecular identification and characterization of CRH and UI cDNAs
The molecular sequences of the CRH and UI genes were unknown for the European flounder. We therefore generated a CNSS library, from which precursors belonging to the CRH family peptides, CRH and UI could be isolated. Both precursor sequences contain a signal peptide, succeeded by a divergent cryptic region, and the mature peptide sequence near the C terminus with the cleavage and amidation sites (21). Moreover, similar to other CRH precursors, the cryptic region of flounder preproCRH contains a characteristic region of conserved amino acids (residues 5465; Fig. 1A
). It has previously been suggested that this region may have a functional role (5, 21). The same region was not found in flounder UI, whereas it has been previously described in gold fish (22).
Despite these structural similarities, a comparison of deduced amino acid sequences of the two cloned flounder peptides with other peptides from the CRH family shows that flounder CRH and UI are members of two discrete lineages within the CRF family, viz. those that are structurally more akin to CRH, and those more akin to UI. The flounder CRH is most closely related to that of tilapia and catfish (95100%), a new group in CRH division (23), whereas trout CRH only shares 79% identity with flounder and occupies a separate group. The other two groups consist of human, rat, and pig CRH with the rest of known teleosts, namely carp, goldfish, and white sucker (93100%, Fig. 2
), and a separate group which contains ovine and cow CRH (22, 24). Despite the differences between amino acid sequences (two residue differences with flounder CRH), the tilapia and rat CRH have equal potency in stimulating ACTH and
-MSH release by tilapia pituitaries in vitro (23). In mammals, CRH inhibits feeding induced by neuropeptide Y, and mediates part of the anorexigenic effects of bombesin, leptin, and possibly serotonin (25, 26, 27). Whether CRH is involved in the regulation of a specialized feeding behavior to accommodate the need for a specific diet or for other ecological challenges remains to be determined.
Urocortin is the human equivalent of flounder UI. Sequence analysis shows that the flounder UI is more closely related to teleost UI (common carp, goldfish, trout, and white sucker) than to the orthologous vertebrate (human, ovine, and rat) urocortin, indicating species divergence. Examination of the presence of UI and CRH isoforms in invertebrates suggests that only one of these lineages was inherited from their protovertebrate ancestors (16). This raises the possibility that CRH peptides may be derived from UI peptides by gene duplication and later function refinement in vertebrates.
Our studies revealed the presence of multiple CRH and UI gene transcripts in the CNSS. These results suggest the possibility of multiple polyadenylation signals in the 3'-UTR region of CRH and UI genes. In contrast, a similar analysis of CRH gene transcripts from goldfish and white sucker brains revealed a single 1.3-kb CRH mRNA in goldfish, and 1.3- and 1.8-kb mRNA white sucker (5, 22). The two versions of CRH mRNA in white sucker are apparently derived from the same primary transcript through different polyadenylation signals, and are differentially expressed according to the glucocorticoid status of the fish (5). In addition, UI multiple polyadenylation signals have been found in the CNSS of carp (28) and trout (29). Because some preproCRH and all preproUI cDNAs described to date contain multiple polyadenylation signals (5, 22, 28, 29), the varying sizes of CRH and UI mRNA found among teleost brain and CNSS are likely to be the result of differential processing of the CRH and UI transcripts. This suggests that CNSS-mediated cortisol release could be controlled by a feedback mechanism that is dependent on the glucocorticoid status of the animal, acting through regulation of the speed and the stability of the gene expression.
Analysis of the genomic organization shows that both CRH and UI genes contain two exons, and that their entire coding regions are located in the second exon. Southern blot results show a single copy of CRH and UI genes in the flounder, indicative that there is no alternative gene product for these peptides. Structurally, the flounder CRH and UI genomic organizations are very similar to those of the human and rat CRH and urocortin (30, 31, 32, 33). This further implies an evolutionary conservation in the CRH peptide family.
Tissue distribution of CRH and UI mRNA
Northern blot analysis of total RNA prepared from a range of flounder tissues revealed that the CNSS is a major site of expression of both CRH and UI genes. This is an important observation, as although high circulating levels of CRH have been measured in acutely stressed fish and cortisol production appears to be independent of the activation of the hypothalamic-pituitary-interrenal axis (34), its site of production has been thus far elusive. Peptide production by the CNSS has often been suggested to play pivotal roles in osmoregulation, reproductive biology and possibly nutritional behavior. In addition, we and others have previously demonstrated that UI stimulates cortisol secretion from flounder interrenal tissue in vitro (16) and administration of CRH and UI in vivo can also elicit an increase in plasma cortisol level in goldfish (35, 36). The demonstration that high levels of CRH and UI are present in the CNSS, together with the findings that glucocorticoid receptors are also expressed in Dahlgren cells (37), lend further credibility to our hypothesis that the CNSS also plays an important role in the regulation of stress-dependent cortisol production (13).
RT-PCR using intron-flanking specific primers indicated the presence of CRH and UI transcripts in tissues outside the CNSS, especially in the brain. The detection of both CRH and UI transcripts in the telencephalon-preoptic region, optic tectum-thalamus, posterior brain and hypothalamic region in flounder is consistent with results from goldfish (22). CRH gene expression is absent in the pituitary. Mammals lack the CNSS, and the brain is the major site expression of CRH and UI. However, whereas immunoreactivities for CRF and urocortin are distributed throughout the rat brain, the supraoptic nucleus and the lateral hypothalamus are the only sites where these peptides appear to colocalize (38). Furthermore, both peptides appear to have distinct functions through their effect on specific CRF1 and CRF2 receptors (15). Our observations show that, in contrast, in flounder brain CRH and UI mRNAs have a much greater degree of brain region colocalization. Differences in the colocalization between CRH and UI also occur in goldfish (22) and in rat brain (38). Whether these can be ascribed to the hormonal status of the animal is currently unknown. Finally, the expression of CRH and UI mRNAs in other fish tissue suggests that these peptides could be synthesized there and may be involved in tissue-specific paracrine roles (39, 40).
Coexpression of CRH and UI gene in the caudal neurosecretory system
Earlier work by us and others in which ovine CRF antibodies were employed to detect UI immunoreactive species in fish revealed an apparent widespread distribution of UI. However, because of the heterologous antibodies cross-reactivity with CRH, conclusive information about UI immunolocalization could not be achieved. In the current study, we employed specific antibodies for flounder UI and CRH and showed colocalization of the peptides in most of the Dahlgren cells of the CNSS. Axons of the Dahlgren cells also contain CRH, and the presence of CRH in the urophysis with concentration around the capillaries suggests that, similar to UI, CRH reaches the urophysis by axonal transport. Here, the secretory products of Dahlgren cells are concentrated into axonal enlargements, the site of storage and subsequent secretion into general circulation (14). Indeed, our preliminary studies at the ultrastructural level reveal colocalization of CRH and UI antibodies to the same nerve endings and, to some extent, to the same neurosecretory vesicles (our unpublished observations). It is interesting to note that we found CRH and UI peptides in the axons, both in the spinal cord and in the urophysis, whereas transcripts for both CRH and UI were only detected in the Dahlgren cells. This suggests that the mRNAs for CRH and UI are expressed in Dahlgren cells, and that the mature peptides are axonally transported to the urophysis. The differences in the number of cells positive for in situ hybridization (mRNA distribution) vs. immunocytochemistry (protein) suggests that functional subtypes of Dahlgren cells might be associated with differential peptide secretion for adding (recruiting) or removing (switching off) a subpopulation from the functional group. This correlates well with our recent electrophysiology studies of Dahlgren cells (41). The idea also has parallels with observations of recruitment/derecruitment within the population of oxytocin magnocellular neurons in mammals (42) and requires further study.
Overall, analysis of the distribution of these peptides in the CNSS confirmed that CRH and UI genes are predominantly coexpressed in Dahlgren cells and both of CRH and UI peptides are delivered to the urophysis by axonal transport, where they are secreted into the systemic circulation. Drainage of the urophysis into the caudal vein and renal-portal system ensures swift delivery of its secretory products to the bladder, gonad, kidney, interrenal (i.e. adrenal homolog), thyroid follicles (i.e. thyroid gland homolog), intestine, liver, and spleen.
In conclusion, our study demonstrates that, in fish, the CNSS represents a major site of production and release of CRH in the blood. Thus, in addition to its modulatory effects on osmoregulatory, reproductive and nutritional behaviors, the CNSS could also mediate the transduction of stress-specific regulation of cortisol production and therefore play a role in phenotypic plasticity, acting at the interface between organisms environment and its physiology (43). Furthermore, we have observed, for the first time, the colocalization of CRH and UI in a major neuroendocrine system of fish. Whether the absence/evolutionary loss of the CNSS in vertebrates beyond fish underscores the importance attributed to segregation of function and physical distribution of these closely related neuropeptides in tetrapods and mammals remains to be investigated.
| Footnotes |
|---|
Abbreviations: CNSS, Caudal neurosecretory system; DNase, deoxyribonuclease; dT, deoxythymidine; nt, nucleotide; ORF, open reading frame; qPCR, quantitative pas, downstream antisense primer; PCR; RNase, ribonuclease; ps, primer sequence; SDS, sodium dodecyl sulfate; SSC, standard saline citrate; UI, urotensin I; UII, urotensin II; UTR, untranslated region.
Received February 5, 2004.
Accepted for publication September 1, 2004.
| References |
|---|
|
|
|---|
-helical CRF(941) on feeding in goldfish: involvement of cortisol and catecholamines. Behav Neurosci 111:398403[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. P. Greenwood, G. Flik, G. F. Wagner, and R. J. Balment The Corpuscles of Stannius, Calcium-Sensing Receptor, and Stanniocalcin: Responses to Calcimimetics and Physiological Challenges Endocrinology, July 1, 2009; 150(7): 3002 - 3010. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J Bernier, S. L Alderman, and E. N Bristow Heads or tails? Stressor-specific expression of corticotropin-releasing factor and urotensin I in the preoptic area and caudal neurosecretory system of rainbow trout J. Endocrinol., March 1, 2008; 196(3): 637 - 648. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O Huising, L. M van der Aa, J. R Metz, A. de Fatima Mazon, B M L. V.-v. Kemenade, and G. Flik Corticotropin-releasing factor (CRF) and CRF-binding protein expression in and release from the head kidney of common carp: evolutionary conservation of the adrenal CRF system J. Endocrinol., June 1, 2007; 193(3): 349 - 357. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Lu, M. Greenwood, L. Dow, J. Yuill, J. Worthington, M. J. Brierley, C. R. McCrohan, D. Riccardi, and R. J. Balment Molecular Characterization and Expression of Urotensin II and its Receptor in the Flounder (Platichthys flesus): A Hormone System Supporting Body Fluid Homeostasis in Euryhaline Fish Endocrinology, August 1, 2006; 147(8): 3692 - 3708. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Mazon, B. M. L. Verburg-van Kemenade, G. Flik, and M. O. Huising Corticotropin-releasing hormone-receptor 1 (CRH-R1) and CRH-binding protein (CRH-BP) are expressed in the gills and skin of common carp Cyprinus carpio L. and respond to acute stress and infection J. Exp. Biol., February 1, 2006; 209(3): 510 - 517. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Craig, H. Al-Timimi, and N. J. Bernier Differential Increase in Forebrain and Caudal Neurosecretory System Corticotropin-Releasing Factor and Urotensin I Gene Expression Associated with Seawater Transfer in Rainbow Trout Endocrinology, September 1, 2005; 146(9): 3851 - 3860. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O. Huising and G. Flik The Remarkable Conservation of Corticotropin-Releasing Hormone (CRH)-Binding Protein in the Honeybee (Apis mellifera) Dates the CRH System to a Common Ancestor of Insects and Vertebrates Endocrinology, May 1, 2005; 146(5): 2165 - 2170. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |