help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0963
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sriraman, V.
Right arrow Articles by Richards, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sriraman, V.
Right arrow Articles by Richards, J. S.
Endocrinology Vol. 145, No. 2 582-591
Copyright © 2004 by The Endocrine Society

Cathepsin L Gene Expression and Promoter Activation in Rodent Granulosa Cells

Venkataraman Sriraman and JoAnne S. Richards

Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030

Address all correspondence and requests for reprints to: JoAnne S. Richards, M.D., Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Place, Houston, Texas 77030. E-mail: joanner{at}bcm.tmc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The cysteine protease cathepsin L exhibits hormone-regulated expression during ovulation. In situ hybridization analyses of immature and pregnant mare serum gonadotropin-treated mouse and rat ovaries showed that cathepsin L expression in granulosa cells of small, growing follicles increased in periovulatory follicles after human chorionic gonadotropin stimulation. In the rat ovary, cathepsin L was also expressed in follicles with signs of atresia. To determine the molecular mechanisms that mediate the diverse regulation of this gene in granulosa cells, rat cathepsin L promoter-reporter constructs were analyzed by transient transfection assays in rat granulosa cells and EMSAs. A construct containing the transcriptional start site and -244 bp of upstream promoter sequence (-244/+33 bp) exhibited inducibility by forskolin, the phorbol ester phorbol myristate acetate, and an additive effect of both. Within this region, three functional specificity protein 1 (Sp1) sites, an overlapping early growth response protein-1 site, and a cAMP regulatory element-binding protein site were identified. Single or double mutants of the above-mentioned sites did not alter forskolin/phorbol myristate acetate inducibility of the promoter. Mutation of all three Sp1/specificity protein 3 (Sp3) sites, which also mutated the early growth response protein-1 site, reduced the promoter activation. Mutation of the cAMP regulatory element-binding protein site in the triple Sp1 mutant construct completely blocked the inducibility of the promoter. When these same constructs were transfected into MCF-7 human breast cancer cells or were cotransfected with an Sp1 expression vector in Drosophila SL2 cells, similar results were obtained. Collectively, the data document that three Sp1/specificity protein 3 binding GC-rich regions and a functional cAMP regulatory element constitute an important transcriptional regulatory complex for expression of the cathepsin L gene in rat granulosa cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CATHEPSIN L IS A lysosomal cysteine protease that belongs to the papain family of enzymes (1). However, in certain endocrine cells like Sertoli cells of the testis and placental trophoblasts as well as certain tumors, cathepsin L is secreted (2), indicating that this protease functions at both intracellular and extracellular sites. There is also increasing evidence that cathepsins secreted by macrophages, osteoclasts, fibroblasts, and transformed cells exert functions that impact angiogenesis and tumor progression (3) (4). Recently, cathepsin L has been identified as an IL-8 convertase (5) and thus may be important in the migration of immune cells.

In the ovary, cathepsin L is expressed in granulosa cells of follicles at different stages of growth (6), suggesting that this protease may play diverse roles in this tissue. During ovulation, a process that resembles an inflammatory reaction, cathepsin L (along with other proteases) may impact the extensive remodeling of the extracellular matrix that occurs before follicle rupture. Specifically, because cathepsin L is activated when complexed with glycosaminaglycans, such as those present in the follicular fluid, and because it can degrade collagen (I and IV), elastin, and fibronectin, it is highly likely that cathepsin L is a modifier of extracellular matrices in preovulatory follicles (7). In addition, cathepsin L may play a role in apoptosis or in recruiting immune cells.

The expression of cathepsin L appears to be regulated by many factors. In NIH3T3 cells, the cathepsin L gene is activated by platelet-derived growth factor, epidermal growth factor, and cAMP and inhibited by TGF-ß (2). In the ovary, cathepsin L is expressed in the granulosa cells of preovulatory follicles after the surge of LH, and this response is altered in follicles of progesterone receptor (PR) null mice (PRKO) that fail to ovulate (6, 8, 9). Cathepsin L expression is also regulated by progesterone in the cat uterus where high levels of the protease are secreted by the endometrium (10). However, a functional link between PR and the expression of cathepsin L in either the ovary or the uterus has not been fully documented. Thus, analyses of the hormones and molecular mechanisms by which this protease is induced in the ovary are highly relevant to our understanding of several endocrine functions, including ovulation.

The 5'-flanking region of the rat cathepsin L gene has been cloned recently (11). Like the mouse and human, the 5'-upstream region of this gene lacks the classical TATA-binding motif (12). Although the absence of a TATA box might indicate that cathepsin L belongs to a class of housekeeping genes, this description is too simplistic because cathepsin L is regulated by a diverse set of hormones and growth regulatory molecules in many different cell types. Moreover, the expression of cathepsin L is increased in ovulatory follicles of wild-type mice and misregulated in mice null for PR (5). However, because the message for this protease is also present in small follicles, PR is not the only regulator of cathepsin L expression in the granulosa cells of the rodent ovary. Recent studies using reporter constructs of cathepsin L in Sertoli cells demonstrated that a 120-bp region (-87/+33) that spans the transcription start site is sufficient to activate basal transcription in Sertoli cells isolated from sexually mature rats (13). A GC box in this region binds specificity protein 3 (Sp3), but not specificity protein 1 (Sp1) in Sertoli cell nuclear extracts, and is critical for transactivation of this gene in Sertoli cells (13). Studies with 3Y1 cells suggested that Sp1 could regulate the transcription of the cathepsin L gene, whereas in v-src transformed 3Y1 cells, the early growth response protein-1 (Egr-1) was found to regulate its expression (12). Collectively, these results suggest that members of the Sp and Egr transcription factor families impact expression of cathepsin L. Because Sp1/Sp3 are present in the granulosa cells (15, 16), and Egr-1 is induced in the granulosa cells of preovulatory follicles after the LH surge (17, 18), these factors as well as PR are potential regulators of cathepsin L in ovary. Using transient transfections and EMSAs, our studies document that three Sp1/Sp3 binding sites with one overlapping Egr-1 binding site and a cAMP response element-binding protein (CREB) site within -244/+33 bp of promoter region are critical for transactivation of cathepsin L in ovarian granulosa cells. This contrasts with the previous studies in Sertoli cells in which Sp3 and the proximal GC box comprise the basal regulatory element (11). In situ hybridization analyses indicate further that cathepsin L is expressed in the granulosa cells of growing and ovulating follicles as well as in atretic follicles.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents
Media and cell culture reagents and materials were purchased from Life Technologies, Inc. (Grand Island, NY), Sigma Chemical Co. (St. Louis, MO), Research Organics (Cleveland, OH), Fisher Scientific (Fairlawn, NJ), Corning, Inc. (Corning, NY), and Hyclone Laboratories, Inc. (Logan, UT). Trypsin, soybean trypsin inhibitor, deoxyribonuclease, phorbol 12-myristate 13-acetate (PMA), ATP, dithiothreitol, 17-ß estradiol (E), and propylene glycol were purchased from Sigma Chemical Co. Electrophoresis and molecular biology grade reagents were procured from Sigma Chemical Co., Bio-Rad Laboratories, Inc. (Richmond, CA), and Roche Molecular Biochemicals (Indianapolis, IN). Oligonucleotides were purchased from Genosys (The Woodlands, TX). Reagents for luciferase assays, beetle luciferin protein, and coenzyme A were obtained from Promega Corp. (Madison, WI) and Roche Molecular Biochemicals, respectively. Antibodies to Sp1, Sp3, and Egr-1 were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Animals
Immature (d 23 of age) Sprague Dawley female rats and immature C57/Bl6 mice were obtained from (Harlan Sprague Dawley, Inc., Indianapolis, IN), were housed under a 16-h light, 8-h dark schedule in the Center for Comparative Medicine at Baylor College of Medicine (Houston, TX) and provided food and water ad libitum. Animals were treated in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, as approved by the Animal Care and Use Committee at Baylor College of Medicine.

In situ hybridization
In situ hybridization was performed as described previously by Wilkensen (20) and as previously shown in our laboratory (21). The riboprobe in vitro transcription systems kit (Promega Corp.) was used to make [S35]uridine 5'-triphosphate-labeled antisense and sense probes from the mouse and rat cathepsin L cDNA. The cDNA probes for mouse (6) and rat cathepsin L were generated by RT-PCR amplification and thymidine/adenine cloning (Invitrogen) and verified by sequencing and BLAST analyses (NCBI, Bethesda, MD). Ovaries were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 7 µm onto Fisher Superfrost Plus microscope slides (Fisher Scientific, Pittsburgh, PA). Tissue sections were rehydrated, treated with 20 µg/ml proteinase K and 0.1 M triethanolamine/acetic anhydride, dehydrated, and incubated with radiolabeled riboprobe overnight at 55 C. The next day slides were washed at high stringency, dried, and exposed to X-OMAT film (Kodak, Rochester, NY) overnight to determine the specificity and intensity of the probe. Slides were dipped in photographic NTB-2 emulsion, exposed at 4 C for an appropriate length of time, developed with D-19 developer and fixer (Kodak), and stained with hematoxylin. Tissue histology was observed by light-field illumination, and dark-field illumination was used to visualize the regions of hybridization.

Cathepsin L promoter deletion and mutation constructs
Cloning of the rat cathepsin L promoter in pGL2 luciferase reporter plasmid and generation of deletion constructs has been described previously (11). The original construct used contains 2069 bp upstream and 33 bp downstream of the transcription start site of the cathepsin L promoter (AF025476), whereas the deletion construct contains -244/+33 region of the proximal promoter.

Site-specific mutations in the cathepsin L promoter were generated using the Gene Editor Site-Directed Mutagenesis Kit from Promega Corp. Oligonucleotides with site-specific mutations at the critical nucleotides necessary for transcription factor binding to the GC boxes [Sp1 (A), (B), and (C)] and the CREB site used for creating mutants are listed in Table 1Go. Constructs that contain two transcription factor-binding site mutations were made using a single oligo that contained both the mutations. For generating constructs with three or four mutations, two separate oligos that contained the mutations were used. The mutants obtained were confirmed by sequencing.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Oligonucleotides to the Sp1 sites, CREB site, and their respective mutants

 
Granulosa cell culture and transfections
Granulosa cells were harvested by needle puncture from immature rats (d 26) or from immature rats treated with E (1.5 mg E/ 0.2 ml in propylene glycol) on d 23–25 of age as described previously (22, 23). Briefly, cells were cultured in 12-well culture plates at a density of 0.5 x 106 cells per 1.5 ml in 1% serum containing medium (DMEM:F12 containing penicillin and streptomycin). Two hours after plating, cells were transiently transfected with 500 ng of the respective constructs with Fugene 6 (Roche Molecular Biochemicals) overnight. On the next day, cells were washed and cultured in fresh, serum-free medium containing FSH (50 ng/ml), forskolin (Fo; 10 µM), PMA (20 nM), or both and harvested after 4 h with lysis buffer [0.2 M Tris (pH 8.0) containing 0.1% Triton X-100]. Fo and PMA have previously been used to mimic the effects of the LH surge for optimal induction of COX-2 and PR in cultured rat granulosa cells (15, 24). The protein concentrations were determined by mini-Bradford assay (Bio-Rad Laboratories, Inc.). Luciferase activity in the extracts was analyzed according to a standard protocol (25). In brief, a 40-µl aliquot of the cell lysate was mixed automatically with 100 µl luciferase assay reagent [20 mM Tris (pH 8.0) containing 4 mM MgSO4, 0.1 mM EDTA, 30 mM dithiothreitol, 0.5 mM ATP, 0.5 mM luciferin, and 0.25 mM coenzyme A], and each reaction was monitored 20 sec in a luminometer. Data are expressed based on the amount of protein in each sample: light-specific units (LSUs) per microgram of protein (mean ± SD). Transfection of empty pGL2 vector in granulosa cells showed basal values that were less than unstimulated wild-type pGL2 -2080/+33 construct. The inducibility of pGL2 by Fo/PMA was never more than 1.5-fold in each experiment. Transfections of MCF-7 human breast cancer cells were carried out using a protocol similar to that adopted for granulosa cells (15). MCF-7 cells (3 x 105) were cultured in six-well culture plates with DMEM-F12 containing 1% serum and transfected with various luciferase constructs (1 µg) using Fugene 6 overnight. On the next day, Fo and PMA treatment were carried out in serum-free medium.

Transfections of Drosophila SL 2 cells were also carried out using Fugene 6 (15). SL2 cells (8 x 105) were cultured in Schneider medium containing 10% fetal bovine serum at 25 C in six-well culture plates. On the next day, the cells were transfected with 1 µg of reporter plasmid (-244/+30 and the Sp1 mutant constructs) with increasing concentrations of pPac-Sp1 expression vector (0 and 1000 ng) adjusted by the addition of pPac vector to equalize the total DNA transfected. After 24 h of transfection, the cells were harvested and assayed for luciferase activity as described above and expressed as LSUs per microgram of protein.

EMSA
Oligonucleotides to the Sp1 sites (A), (B), and (C), the CREB site, and their respective mutants (Table 1Go) were annealed, labeled, and used in EMSAs as described previously (25). P32-labeled oligonucleotides were incubated with whole-cell extracts (WCEs) prepared from the granulosa cells of hypophysectomized (H) rats treated sequentially with E, FSH (F), and human chorionic gonadotropin (hCG) (HEF, hCG) for 4 h as described previously (25). After incubation on ice for 30 min, the binding reactions were subjected to nondenaturing electrophoresis (0.5% Tris-borate EDTA) at 150 V and autoradiographed after drying the gel. Where indicated, specific antibodies against Sp1, Sp3, Egr-1, CREB, and phosho-CREB were added to the reactions for 30 min on ice before the addition of the labeled probe.

Statistics
The values are represented as mean ± SD for at least three different experiments. The data were analyzed by ANOVA followed by the Neuman-Keuls test to identify significant differences in the group using Graphpad Prism software (San Diego, CA), and a P value less than 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of cathepsin L
Previous studies showed that cathepsin L is expressed in the granulosa cells of small follicles present in ovaries of pregnant mare’s serum gonadotropin (PMSG)-primed mice and was increased after 12 h of hCG treatment (6). Herein, we have compared the expression of cathepsin L in the mouse ovary with that in the rat ovary. In the immature mouse, cathepsin L is expressed in the granulosa cells of small growing follicles as well as in the granulosa cells of preovulatory follicles of PMSG-treated mice (Fig. 1AGo). The amount of cathepsin L increased after stimulation with hCG and with intense staining observed in ovulating follicles (Fig. 1AGo, 12 and 16 h after hCG). The spatiotemporal expression of cathepsin L in the ovaries of intact immature rats treated with PMSG and hCG as well as in hypophysectomized (H) rats primed with E (HE), FSH (F; HEF), and hCG (HEF-hCG) was similar to, but also distinct from, that observed in the mouse. Cathepsin L message was detected in the granulosa cells of small follicles present in PMSG-treated rats but was expressed most dramatically in antral follicles 2 h after stimulation with hCG (Fig. 1BGo). Unlike the mouse, cathepsin L was induced in the thecal and interstitial compartments of the PMSG-primed rat ovary 8–12 h after hCG treatment. In these same follicles, the expression of cathepsin L in granulosa cells was less. In the H rat ovary, cathepsin L was expressed in the granulosa cells of some but not all small follicles, and those positive for cathepsin L exhibited signs of atresia (Fig. 1BGo, hypox, 5x and 20x). Cathepsin L was also induced in granulosa cells but not in theca cells of preovulatory follicles after hCG stimulation, with the most dramatic increase observed at 8 h (Fig. 1BGo; HEF, hCG, 8 h). That cathepsin L is detected in the granulosa cells of follicles at many stages of development suggests that the pituitary gonadotropins as well as other factors impact its expression in the ovary. That cathepsin L might be expressed in atretic follicles also indicates that diverse mechanisms impact expression of this gene in the ovary of the mouse and the rat.




View larger version (269K):
[in this window]
[in a new window]
 
FIG. 1. Spatiotemporal expression of cathepsin L in the mouse and rat ovary. A, In situ hybridization analyses of cathepsin L in ovarian sections from immature mice as well as from PMSG-primed mice that were treated with hCG to stimulate follicular growth and luteinization, respectively. Using a probe generated to mouse cathepsin, cathepsin L mRNA was detected in the granulosa cells of growing and ovulating follicles. B, In situ hybridization analysis of cathepsin L expression in ovarian sections of PMSG-hCG primed rats as well as in hypophysectomized (H; Hypox) rats treated with estrogen and FSH (HEF) followed by hCG (HEF, hCG) using a rat cathepsin L probe. In these ovaries, cathepsin L message was observed not only in the granulosa cells of preovulatory follicles but also in granulosa cell and theca of follicles stimulated by hCG for 2 and 8 h, respectively. An, Antral follicle; S An, small antral follicle; Ov, ovulatory follicle; Cl, corpus luteum; At, atretic follicle; LF, luteinizing follicle; PO, preovulatory.

 
Characterization of cathepsin L promoter
The rat cathepsin L promoter was recently cloned, and sequence analysis by BLAST search revealed extensive homology (92%) with the mouse promoter (Fig. 2Go). Considering the sequence similarity between these two species, we analyzed the rat cathepsin L promoter to understand the transcription factors that regulate the expression of cathepsin L in rat granulosa cells.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 2. Nucleotide sequences of the rat cathepsin L promoter CREB and Sp1/Sp3 binding sites aligned to homologous regions of the mouse and human cathepsin L genes.

 
Transactivation of rat cathepsin L promoter.
To determine cathepsin L promoter activity in rat granulosa cells, two rat cathepsin L promoter fragments (-2080/+33 and - 244/+33 bp) ligated to the luciferase reporter gene were analyzed by transient transfection assays. Immature granulosa cells were harvested and cultured overnight in defined medium, transfected, and stimulated with Fo (10 µM) to increase cAMP, PMA (20 nM) as a substitute for diacylglycerol, or Fo and PMA that mimic LH action as described in Materials and Methods. Fo alone induced a 6-fold increase in activity of the -2080/+33-luciferase construct (Fig. 3Go; ***, P < 0.001) whereas PMA was less effective (*, P < 0.05). When both Fo and PMA were added, luciferase activity increased 8- to 10-fold (***, P < 0.001), demonstrating an additive effect of PMA on Fo inducibility of the promoter (Fig. 3Go). FSH activated cathepsin L promoter-reporter constructs as well as Fo (data not shown), and addition of H-89 reduced the Fo/PMA inducibility of the promoter suggesting the involvement of phosphorylation mechanisms in promoter activation (data not shown). Expression of the 5' deletion construct (-244/+33) containing the proximal promoter region was greater than that of the longer construct (-2080/+33; ***, P < 0.001) but showed similar responses to Fo and PMA (***, P < 0.001; Fig. 3Go). Previous studies by Charron et al. (13) in which rat Sertoli cells were transfected with these same constructs also showed that the shorter promoter construct exhibited high basal activity, suggesting that the regions upstream of -244 bp repress transactivation of the promoter. To focus on regions necessary for induction for cathepsin L, subsequent analyses were done with the -244/+33 cathepsin L reporter construct.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 3. The -244/+33 region of the cathepsin L promoter is sufficient to confer Fo and PMA responsiveness in granulosa cells. Granulosa cells obtained from E-primed rats were plated in DMEM-F12 containing 1% serum overnight. The cultures were transiently transfected overnight with 500 ng of cathepsin L promoter-luciferase construct using Fugene 6 as described in Materials and Methods. The cells were treated with Fo (10 µM), PMA (20 nM), and Fo + PMA for 4 h and harvested for luciferase assays. Data are represented as LSUs per microgram of protein. Values represent mean ± SD for three separate experiments in which transfections were carried out in triplicate. In this and subsequent figures, the schematic represents the putative functional elements in rat cathepsin L promoter that are being analyzed. [P < 0.05, control pGL2 basic vs. control pGL2 -2080/+33 cathepsin L; P < 0.001, pGL2 basic vs. pGL2 -244/+33 control and pGL2 -2080/+33 control vs. pGL2 -244/+33 control (not shown in figure). pGL2 -2080/+33; *, P < 0.05 control vs. PMA; ***, P < 0.001 for comparisons of all other treatments to each other within this group. pGL2 -244/+33; **, P < 0.01 PMA vs. Fo; ***, P < 0.001 for comparisons of all other treatments to each other within this group.]

 
Functional analysis of the rat cathepsin promoter.
To assess the functional activity of specific cathepsin L promoter regions, potential transcription factor-binding elements within the -244/+33-bp region of the promoter were identified by a computer-based search (TFsearch, Tokyo, Japan). This approach did not reveal any consensus PR response elements but did identify three GC-rich putative Sp1 binding sites designated (A), (B), and (C) [A, (-105/-94) CCGCCCCGAG; B and C, TGACGGGGCGGGGGCGGGCC (-77/-66; -69/-60)] with an overlapping Egr-1 site at B and C (-77/-60); a CREB site [CGGCGTCACG (-134/-124); and a CCAAT motif (CAGCCAATGACGG (-87/-74)] (Fig. 4AGo). To analyze these binding sites, EMSAs were performed with WCEs prepared from granulosa cells (HEF, hCG 4 h) and specific oligonucleotides to the transcription factor motifs. When the CREB site was used as a labeled probe, two major protein/DNA protein complexes (I and II) were observed (Fig. 4AGo). Competition with a 100-fold excess of wild-type cold competitor DNA prevented the complex formation with the labeled probe, whereas a probe with a mutated CREB site failed to compete. The upper band (complex I) supershifted with CREB antibody identifying CREB as one factor binding to the rat cathepsin L promoter (Fig. 4AGo). No detectable supershift was observed with phospho-CREB antibody, and the identity of the other protein/DNA complex is not yet known and may represent a nonspecific component as observed in CRE of other promoters (26).



View larger version (71K):
[in this window]
[in a new window]
 
FIG. 4. CREB and Sp1/Sp3 bind to the proximal region of the cathepsin L promoter. WCEs were prepared from granulosa cells obtained from immature hypophysectomized treated with E, FSH, and hCG for 2 h (HEF, hCG 2 h). EMSAs were carried out using 3 µg of protein and labeled (A) CREB, (B) Sp1 (A) and Sp1 (B and C) oligonucleotide as described in Materials and Methods. Wherever indicated, the extracts were preincubated with 100-fold excess self-cold competitor or mutant probe or 1 µg of antibody before the addition of labeled oligonucleotide [CREB* or Sp1(A)* or Sp1(B and C)*]. Protein/DNA complexes were resolved by PAGE in 0.5 x Tris-borate EDTA and exposed to autoradiographic film. The complexes formed are indicated by arrows, and the supershifted complexes are depicted by brackets. The EMSAs are representative of three separate experiments. The asterisk (*) denotes the labeled probe used in EMSAs.

 
When the Sp1 (A) site was used as a probe, two major protein/DNA complexes (I and II) were observed. Competition with the excess wild-type cold competitor prevented the complex formation, whereas Sp1(A)-specific mutant failed to compete (Fig. 4BGo). The upper band (I) supershifted in part after the addition of an Sp1 antibody, whereas the lower band (II) was reduced with an Sp3 antibody. When both antibodies were used, complexes I and II were shifted, indicating both Sp1 and Sp3 bind to Sp1 (A) site (Fig. 4BGo). The Sp1 (B and C) site contains two putative Sp1/Sp3 sites that overlap an Egr-1 binding site (Fig. 2Go). When this region was used as a probe, three protein/DNA complexes were observed, and these were competed with excess cold competitor DNA (Fig. 4BGo). Supershift analyses with the Sp1 and Sp3 antibodies documented that bands I and II contained these factors, whereas band III shifted with an Egr-1 antibody. When mutants of site (B) alone, site (C) alone, or sites (B and C) were used as cold competitor DNA, only the double mutant failed to compete for complex formation (Fig. 4BGo). When the putative CCAAT motif was used as a labeled probe, no major protein/DNA complex could be detected (data not shown).

Transfection assays with wild-type and site-specific mutants of the cathepsin L promoter were done to determine the relative function of each site. Mutation of the CREB site alone did not alter the inducibility by Fo/PMA (Fig. 5AGo). Mutation of Sp1 (A), Sp1 (B), and Sp1 (C) did not alter promoter activity. Double mutants of CREB and Sp1 A or Sp1 B and Sp1 C also failed to modify promoter inducibility (Fig. 5BGo). However, mutation of all three Sp1 (A, B, and C) sites significantly reduced basal and Fo/PMA inducibility (***, P < 0.001) of the promoter (Fig. 5BGo). Introduction of a CREB mutation into Sp1/Sp3 triple mutant further reduced the activity of the promoter (***, P < 0.001; Fig. 5BGo). These results indicate that Sp1 binding to the promoter at multiple sites is critical for transactivation of the promoter and that CREB synergistically interacts with the Sp1 to augment the Fo/PMA response.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 5. Combinatorial mutation analyses demonstrate that synergistic interactions between Sp1/Sp3 and CREB sites are critical for Fo and PMA activation of cathepsin L promoter. The relative importance of the CREB site and the 3 Sp1 sites designated A, B, and C in the cathepsin L promoter were assessed by transfection of site directed mutants to (A) individual binding sites or (B) multiple mutations in the cathepsin L promoter-reporter constructs. Mutants were generated using the Gene Editor site-directed mutagenesis kit from Promega Corp. Transient transfections were carried out using Fugene 6 as described in Materials and Methods. Data are represented as LSU per microgram of protein. Values represent mean ± SD of three experiments in which transfections were carried out in triplicate. ***, P < 0.001, wild-type vs. mutants [Sp1(A, B, and C) and CREB and Sp1 (A, B, and C)] in both basal and Fo/PMA-treated conditions. *, P < 0.05; **, P < 0.01; Sp1(A, B, and C) mutant vs. CREB and Sp1 A, B, and C mutant in basal and Fo/PMA-treated conditions. The wild-type and mutant constructs are schematically represented.

 
Transfection analysis in SL2 cells and MCF-7 cells
The importance of Sp1 and CREB binding in cathepsin L promoter was also assessed in MCF-7 cells that express endogenous Sp1/Sp3 and cathepsin L as well as in Drosophila SL2 cells that lack these Sp proteins (27). MCF-7 cells were transfected overnight in a defined medium with 1% serum and stimulated with agonist for 4 h the next day. In transfected MCF-7 cells, the relative activity and inducibility of the various cathepsin L promoter-reporter constructs by Fo/PMA was similar to that observed in granulosa cells. The intact proximal promoter as well as single mutants of the individual Sp1 sites or the CREB site exhibited robust responses to Fo/PMA (Fig. 6AGo). Likewise, cathepsin L promoter constructs containing two mutant Sp1 sites did not alter the functional activity of the promoter construct. Mutation of all the Sp1 sites and the CREB site reduced the activity of construct significantly (***, P < 0.001; Fig. 6AGo).



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 6. Sp1/Sp3 and CREB sites are essential for functional activation of cathepsin L promoter-reporter constructs in MCF-7 and SL2 cells. The functional importance of the CREB site and the designated Sp1 A, B, and C sites in the cathepsin L promoter were also investigated in (A) MCF-7 and (B) SL2 cells. Transient transfection was carried out in MCF-7 cells after culturing overnight in defined medium containing 1% serum using Fugene 6 as described in Materials and Methods. [***, P < 0.001; wild-type vs. mutants [Sp1 (A, B, and C) and CREB and Sp1 (A, B, and C)] in both basal and Fo/PMA-treated conditions, Sp1 (A, B, and C) mutant vs. CREB and Sp1 (A, B, and C) mutant in both basal and Fo/PMA-treated conditions]. SL2 cells were cultured in Schneider Drosophila medium containing 5% serum and transfected overnight using Fugene 6 with 1 µg cathepsin L promoter along with 0 and 1000 ng of Sp1 expression plasmid pPac-Sp1 or the empty vector pPac-0. Luciferase activity was assayed after 24 h and expressed as LSU per microgram of protein. Similar transfections were carried out with mutant constructs. [***, P < 0.001 between wild-type vs. mutants [Sp1 (B and C), Sp1(A, B, and C) and CREB and Sp1 (A, B, and C)] cotransfected with pPac-Sp1 expression vector]. Values represent mean ± SD of three experiments in which the transfections were done in triplicate.

 
In Drosophila SL2 cells, the wild-type or mutant constructs were cotransfected with increasing concentrations (0 and 1000 ng) of an Sp1 expression plasmid. Little or no luciferase activity was observed when the various cathepsin L promoter-reporter constructs were transfected alone (Fig. 6BGo). Coexpression with Sp1 increased luciferase activity dramatically in the wild-type construct. Double and triple mutations of Sp1 sites in the cathepsin L promoter caused a progressive decrease in reporter activity (***, P < 0.001; Fig. 6BGo). Mutation at the three Sp1 sites along with the CREB site further reduced the activity of the promoter (***, P < 0.001) but did not completely block the response, in contrast to the results in mammalian cells. These results confirm that endogenous as well as exogenous Sp1 is critical for transactivation of cathepsin L promoter in mammalian and insect cells, respectively (Fig. 7Go).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 7. Schematic representation of CREB-, Sp1/Sp3- and Egr-1-mediated transactivation of the cathepsin L promoter. The model depicts the possible interactions between the CREB site and GC boxes that mediate transactivation of the cathepsin L promoter in response to gonadotropins (Fo and PMA) in granulosa cells. Presumptive coactivators and coregulators that may interact with these regions of cathepsin L promoter to confer cAMP-mediated induction of the endogenous gene are indicated.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cathepsin L is a cysteine protease expressed in many endocrine and nonendocrine tissues and cell types (2, 11, 13), including the testis where it is expressed in Sertoli cells in a manner that is tightly coupled to specific stages of spermatogenesis that occurs along seminiferous epithelium (11). Specifically, cathepsin L transcripts are expressed at high levels in mature Sertoli cells in tubules associated at stages VI–VIII and at low or undetectable levels at all other stages (11). Herein, we show that cathepsin L is also expressed and hormonally regulated in granulosa cells as well as theca cells of the rodent ovary. Specifically, cathepsin L is expressed in the granulosa cells of follicles at several stages of development with greater levels of message observed in ovulatory follicles of mouse and rat (Fig. 1Go). The latter induction is dependent on LH and, at least in part, on LH induction of PR (6). The factors controlling expression of the cathepsin L gene in small follicles of the mouse and rat are less clear. However, the levels of cathepsin L message were not markedly increased by E or FSH, two factors that stimulate preovulatory follicular growth. In the rat ovary, cathepsin L message was abundant in theca cells of ovulatory follicles as well as in small follicles that exhibited signs of atresia (pycnotic nuclei; Fig. 1BGo). Because cathepsin L is known to be expressed in macrophages (28), this may account for some of the cathepsin L expression in these follicles. Although the precise function of cathepsin L is not yet known, the expression of the endogenous gene in the granulosa cells of the mouse and rat occurs in follicles at several different stages of development, indicating that this protease may exert different functions in small vs. ovulatory follicles. For example, in ovulatory follicles cathepsin L may be secreted and hence may be more important as a factor in remodeling the extracellular matrix that is critical for ovulation. It is also possible that cathepsin L acts as a critical intracellular lysosomal enzyme in the granulosa cells of atretic follicles. Finally, cathepsin L likely acts in concert with other proteases at these defined times of granulosa cell differentiation.

The specific factors that regulate the transactivation of the cathepsin L gene in granulosa cells at different stages of follicular growth have not been previously defined. Herein, we have analyzed specific regulatory elements within the rat cathepsin L promoter that confer inducibility by Fo and PMA, agonists that mimic the ovulatory LH signaling cascade (15, 24). We document the presence and functional relevance of a CRE that binds CREB as well as three Sp1/Sp3 binding sites, one of which also binds Egr-1. These sites that confer transactivation in granulosa cells are similar but also distinct from those documented for expression in other cells, including Sertoli cells (13), 3Y1 and 3T3 cells (2). As with Sertoli cells, a proximal GC-rich region binds Sp3. In contrast to Sertoli cells, this site also binds Sp1 and Egr-1 present in WCE prepared from granulosa cells of preovulatory follicles exposed to hCG for 2–4 h. In addition, another Sp1/Sp3 site and a CREB binding site all contribute to Fo/PMA activation in granulosa cells. Because mutation of the CREB site alone did not reduce the responses to agonist stimulation, the results suggest that CREB and its interacting partner CREB-binding protein are not the only downstream factors regulated by phosphorylation that impact the cathepsin L promoter. Although Sp1/Sp3 have been reported to be phosphorylated in other systems (29), phosphorylation of Sp1 in granulosa cells has not yet been documented. Our results show that Egr-1, which is induced by hCG administration in the granulosa cells of preovulatory follicles (18), binds to this GC-rich promoter region that is highly conserved between rat and mouse and may enhance expression in preovulatory follicles after hCG. Although binding competition between Sp1 and Egr-1 is common in GC-rich elements that exhibit overlapping Sp1 and Egr-1 binding motif (18, 30), this site in cathepsin L gene appears to bind both in a noncompetitive manner. Similar regions can also be identified in the human promoter but at more distal regions (Fig. 2Go). A computer-based search indicated that a functional CCAAT site was present; however, no transcription factor binding to this site was observed.

Although cathepsin L mRNA expression is reduced in the granulosa cells of hCG-stimulated preovulatory follicles of PRKO mice (6), the role of PR in the regulated expression of cathepsin L is unclear. No consensus PR response elements in the proximal promoter region were identified by computer-based searches, and treatment of cells with the PR agonist R-5020 did not have any effect on basal or inducible expression of the promoter by Fo/PMA. Furthermore, coexpression of PR-A (isoform of PR) (at 5 and 10 ng) with the cathepsin L promoter-reporter constructs did not alter transcriptional activity of the cathepsin L promoter but did activate a PR-responsive GRE promoter-reporter construct in the absence or presence of Fo and PMA (data not shown). Thus, PR does not appear to be interacting with the Sp1/Sp3 or CREB sites (31, 32) but may act at more distal sites within the cathepsin L promoter in vivo. Alternatively, PR may act by regulating the expression of other factors that impact cathepsin L activation. The importance of the GC-rich regions for the transactivation of the cathepsin L promoter allows us to add this gene to a growing number of genes in which GC boxes impact activation, including PR, ADAMTS-1, Sgk, Egr-1, p21CIP, StAR, and P450scc (15, 16, 18, 33, 34, 35, 36). Transactivation of the PR promoter, in particular, is dependent on a single critical Sp1/Sp3 binding site within its proximal region (15) that maps to a hypersensitive site (37). Thus, in the granulosa cells of ovulating follicles, Sp1/Sp3 and associated coregulatory factors appear to constitute a critical transcriptional regulatory complex (Fig. 7Go).


    Acknowledgments
 
We thank Dr. W. W. Wright, Bloomberg School of Public Health, the Johns Hopkins University (Baltimore, MD), for providing the original cathepsin L promoter-reporter constructs.


    Footnotes
 
This work was supported in part by National Institutes of Health Grant HD-07495 (to J.S.R.) and by the Lalor Foundation (to V.S.).

Abbreviations: CREB, cAMP response element-binding protein; E, estradiol; Egr-1, early growth response protein-1; Fo, forskolin; H, hypophysectomized; hCG, human chorionic gonadotropin; HE, hypophysectomized rats treated sequentially with E; HEF hCG, hypophysectomized rats treated sequentially with E, FSH, and hCG; LSU, light-specific unit; PMA, phorbol 12-myristate 13-acetate; PMSG, pregnant mare serum gonadotropin; PR, progesterone receptor; Sp1, specificity protein 1; Sp3, specificity protein 3; WCE, whole-cell extract; MCF-7, Michigan Cancer Foundation.

Received July 30, 2003.

Accepted for publication October 7, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kirschke H, Barrett AJ, Rawlings ND 1998 Lysosomal cysteine proteases. 2nd ed. New York: Oxford University Press; 13–18
  2. Ishidoh K, Kominami E 1998 Gene regulation and extracellular functions of procathepsin L. Biol Chem 379:131–135[Medline]
  3. Jean D, Guillaume N, Frade R 2002 Characterization of human cathepsin L promoter and identification of binding sites for NF-Y, Sp1 and Sp3 that are essential for its activity. Biochem J 361:173–184[CrossRef][Medline]
  4. Oksjoki S, Soderstrom M, Vuorio E, Anttila L 2001 Differential expression patterns of cathepsins B, H, K, L and S in the mouse ovary. Mol Hum Reprod 7:27–34[Abstract/Free Full Text]
  5. Ohashi K, Naruto M, Nakaki T, Sano E 2003 Identification of interleukin-8 converting enzyme as cathepsin L. Biochem Biophys Acta 1649:30–39[Medline]
  6. Robker RL, Russell DL, Espey LL, Lydon JP, O’Malley BW, Richards JS 2000 Progesterone-regulated genes in the ovulation process: ADAMTS-1 and cathepsin L proteases. Proc Natl Acad Sci USA 97:4689–4694[Abstract/Free Full Text]
  7. Salustri A, Camaioni A, Di Giacomo M, Fulop C, Hascall VC 1999 Hyaluronan and proteoglycans in ovarian follicles. Hum Reprod Update 5:293–301[Abstract/Free Full Text]
  8. Lydon JP, DeMayo F, Funk CR, Mani SK, Hughes AR, Montgomery CA, Shyamala G, Conneely OM, O’Malley BW 1995 Mice lacking progesterone receptor exhibit reproductive abnormalities. Genes Dev 9:2266–2278[Abstract/Free Full Text]
  9. Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM 2000 Subgroup of reproductive functions of progesterone mediated by receptor-B isoform. Science 289:1751–1754[Abstract/Free Full Text]
  10. Jaffe RC, Donnelly KM, Mavrogianis PA, Verhage HG 1989 Molecular cloning and characterization of a progesterone-dependent cat endometrial secretory protein complementary deoxyribonucleic acid. Mol Endocrinol 3:1807–1814[Abstract/Free Full Text]
  11. Zabludoff SD, Charron M, Decerbo JN, Simukova N, Wright WW 2001 Male germ cells regulate transcription of the cathepsin L gene in rat Sertoli cells. Endocrinology 142:2318–2327[Abstract/Free Full Text]
  12. Ishidoh K, Taniguchi S, Kominami E 1997 Egr family member proteins are involved in the activation of the cathepsin L gene in v-src-transformed cells. Biochem Biophys Res Comm 238:665–669[CrossRef][Medline]
  13. Charron M, DeCerbo JN, Wright WW 2003 A GC-box within the proximal promoter region of the rat cathepsin L gene activates transcription in Sertoli cells of sexually mature rats. Biol Reprod 68:1649–1656[Abstract/Free Full Text]
  14. Deleted in proof
  15. Sriraman V, Sharma SC, Richards JS 2003 Transactivation of the progesterone receptor gene in granulosa cells: evidence that Sp1/Sp3 binding sites in the proximal promoter play a key role in LH inducibility. Mol Endocrinol 17:436–449[Abstract/Free Full Text]
  16. Alliston TN, Maiyar AC, Buse P, Firestone GL, Richards JS 1997 Follicle stimulating hormone-regulated expression of serum/glucocorticoid-inducible kinase in rat ovarian granulosa cells: a functional role for the Sp1 family in promoter activity. Mol Endocrinol 11:1934–1949[Abstract/Free Full Text]
  17. Espey LL, Ujioka T, Russell DL, Skelsey M, Vladu B, Robker RL, Okamura H, Richards JS 2000 Induction of early growth response protein-1 (Egr-1) gene expression in the rat ovary in response to an ovulatory dose of hCG. Endocrinology 141:2385–2391[Abstract/Free Full Text]
  18. Russell DL, Doyle KM, Gonzales-Robayna I, Pipaon C, Richards JS 2003 Egr-1 induction in rat granulosa cells by FSH and LH; combinatorial regulation by transcription factors CREB, SRF, Sp1 and Egr-1. Mol Endocrinol 17:520–533[Abstract/Free Full Text]
  19. Deleted in proof
  20. Wilkensen D 1993 In situ hybridization. In: Stem CD, Holland PWH, eds. Essential developmental biology: a practical approach. New York: Oxford University Press; 258–263
  21. Robker RL, Richards JS 1998 Hormone-induced proliferation and differentiation of granulosa cells: a coordinated balance of the cell cycle regulators cyclin D2 and p27KIP1. Mol Endocrinol 12:924–940[Abstract/Free Full Text]
  22. Clemens JW, Kraus WL, Katenellenbogen BS, Richards JS 1998 Hormone induction of progesterone receptor (PR) mRNA and activation of PR promoter regions in ovarian granulosa cells: evidence for a role of cAMP but not estradiol. Mol Endocrinol 12:1201–1214[Abstract/Free Full Text]
  23. Fitzpatrick SL, Richards JS 1991 Regulation of cytochrome P450 aromatase messenger ribonucleic acid and activity by steroids and gonadotropins in rat granulosa cells. Endocrinology 129:1452–1462[Abstract/Free Full Text]
  24. Morris JK, Richards JS 1993 Hormonal induction of luteinization and prostaglandin endoperoxide synthase-2 involves multiple cellular signaling pathways. Endocrinology 133:770–779[Abstract/Free Full Text]
  25. Sharma SC, Clemens JW, Pisarska MD, Richards JS 1999 Expression and function of estrogen receptor subtypes in granulosa cells: regulation by estradiol and forskolin. Endocrinology 140:4320–4334[Abstract/Free Full Text]
  26. Carlone DL, Richards JS 1997 Functional interactions, phosphorylation, and levels of 3'5'-cyclic adenosine monophosphate-regulatory element binding protein and steroidogenic factor-1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292–304[Abstract/Free Full Text]
  27. Courey AJ, Tjian R 1988 Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55:887–898[CrossRef][Medline]
  28. Beers C, Honey K, Fink S, Forbush K, Rudensky A 2003 Differential regulation of cathepsin S and cathepsin L in interferon {gamma}-treated macrophages. J Exp Med 197:169–179[Abstract/Free Full Text]
  29. Milanini-Mongiat J, Pouyssegur J, Pages G 2002 Identification of two Sp1 phosphorylation sites for p42/p44 mitogen-activated protein kinases: their implication in vascular endothelial growth factor gene transcription. J Biol Chem 277:20631–20639[Abstract/Free Full Text]
  30. Khachigian LM, Williams AJ, Collins T 1995 Interplay of Sp1 and Egr-1 in the proximal platelet-derived growth factor-A chain promoter in cultured vascular endothelial cells. J Biol Chem 270:27679–27686[Abstract/Free Full Text]
  31. Safe S 2001 Transcriptional activation of genes by 17ß-estradiol through estrogen receptor-Sp1 interactions. Vitam Horm 62:231–252[Medline]
  32. Kim K, Thu N, Saville B, Safe S 2003 Domains of estrogen receptor {alpha} (ER{alpha}) required for ER{alpha}/Sp1 mediated activation of GC-rich promoters by estrogens and antiestrogens in breast cancer cells. Mol Endocrinol 17:804–817[Abstract/Free Full Text]
  33. Doyle KMH, Russell DL, Richards JS 2001 Hormonal regulation of ADAMTS-1 in the rodent ovary. Society for the Study of Reproduction 34th Annual Meeting (Abstracts). Biol Reprod 64:290–291
  34. Lu S, Jenster G, Epner DE 2000 Androgen induction of cyclin dependent kinase inhibitor p21 gene: role of androgen receptor and transcription factor Sp1 complex. Mol Endocrinol 14:753–760[Abstract/Free Full Text]
  35. Sugawara T, Saito M, Fujimoto S 2000 Sp1 and SF-1 interact and cooperate in the regulation of human steroidogenic acute regulatory protein gene expression. Endocrinology 141:2895–2903[Abstract/Free Full Text]
  36. Liu A, Simpson ER 1997 Steroidogenic factor 1 and Sp1 are required for regulation of bovine CYP11A gene expression in bovine luteal cells and adrenal Y1 cells. Mol Endocrinol 11:127–137[Abstract/Free Full Text]
  37. Petz LN, Nardulli AM 2000 Sp1 binding sites and an estrogen response element half-site are involved in regulation of the human progesterone receptor A promoter. Mol Endocrinol 14:972–985[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
A. Bettegowda, O. V. Patel, K.-B. Lee, K.-E. Park, M. Salem, J. Yao, J. J. Ireland, and G. W. Smith
Identification of Novel Bovine Cumulus Cell Molecular Markers Predictive of Oocyte Competence: Functional and Diagnostic Implications
Biol Reprod, August 1, 2008; 79(2): 301 - 309.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
V. Sriraman, U. Eichenlaub-Ritter, J. W. Bartsch, A. Rittger, S. M. Mulders, and J. S. Richards
Regulated Expression of ADAM8 (a Disintegrin and Metalloprotease Domain 8) in the Mouse Ovary: Evidence for a Regulatory Role of Luteinizing Hormone, Progesterone Receptor, and Epidermal Growth Factor-Like Growth Factors
Biol Reprod, June 1, 2008; 78(6): 1038 - 1048.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Shimada, Y. Yanai, T. Okazaki, Y. Yamashita, V. Sriraman, M. C. Wilson, and J. S. Richards
Synaptosomal-Associated Protein 25 Gene Expression Is Hormonally Regulated during Ovulation and Is Involved in Cytokine/Chemokine Exocytosis from Granulosa Cells
Mol. Endocrinol., October 1, 2007; 21(10): 2487 - 2502.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
D. L. Russell and R. L. Robker
Molecular mechanisms of ovulation: co-ordination through the cumulus complex
Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
K. Sayasith, K. A Brown, J. G Lussier, M. Dore, and J. Sirois
Characterization of bovine early growth response factor-1 and its gonadotropin-dependent regulation in ovarian follicles prior to ovulation.
J. Mol. Endocrinol., October 1, 2006; 37(2): 239 - 250.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. Sriraman, M. D. Rudd, S. M. Lohmann, S. M. Mulders, and J. S. Richards
Cyclic Guanosine 5'-Monophosphate-Dependent Protein Kinase II Is Induced by Luteinizing Hormone and Progesterone Receptor-Dependent Mechanisms in Granulosa Cells and Cumulus Oocyte Complexes of Ovulating Follicles
Mol. Endocrinol., February 1, 2006; 20(2): 348 - 361.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. A. MacLean II, M. K. Rao, K. M.H. Doyle, J. S. Richards, and M. F. Wilkinson
Regulation of the Rhox5 Homeobox Gene in Primary Granulosa Cells: Preovulatory Expression and Dependence on SP1/SP3 and GABP
Biol Reprod, December 1, 2005; 73(6): 1126 - 1134.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. M. H. Doyle, D. L. Russell, V. Sriraman, and J. S. Richards
Coordinate Transcription of the ADAMTS-1 Gene by Luteinizing Hormone and Progesterone Receptor
Mol. Endocrinol., October 1, 2004; 18(10): 2463 - 2478.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sriraman, V.
Right arrow Articles by Richards, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sriraman, V.
Right arrow Articles by Richards, J. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals