help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2003-0770
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/2/659    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, G.
Right arrow Articles by Greeley, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, G.
Right arrow Articles by Greeley, G. H., Jr.
Endocrinology Vol. 145, No. 2 659-666
Copyright © 2004 by The Endocrine Society

Insulin-Like Growth Factor I Increases Rat Peptide YY Promoter Activity through Sp1 Binding Sites

Guiyun Wang, Andrew B. Leiter, Ella W. Englander and George H. Greeley, Jr.

Department of Surgery (G.W., E.W.E., G.H.G.), The University of Texas Medical Branch, and Shriners Hospitals for Children, Galveston, Texas 77555-0725; and New England Medical Center (A.B.L.), Boston, Massachusetts 02111

Address all correspondence and requests for reprints to: George H. Greeley, Jr., Ph.D., Department of Surgery, The University of Texas Medical Branch, 301 University Boulevard, Galveston, Texas 77555-0725. E-mail: ggreeley{at}utmb.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Studies in rodents demonstrate that the mitogen, IGF-I, stimulates intestinal peptide YY (PYY) expression. To investigate whether the stimulatory influence of IGF-I is exerted at the level of gene transcription, rat PYY 5'-upstream sequences (-2800/+37 bp, -770/+37 bp, -127/+37 bp) fused to the firefly luciferase (luc) reporter gene were transfected into rat pheochromocytoma cells (PC12) and luc activity measured after IGF-I treatment. IGF-I increased transcriptional activity of all constructs similarly; the PYY (-127/+37 bp)-luc construct was used in subsequent experiments. IGF-I increased PYY (-127/+37 bp)-luc activity in a time- and dose-dependent fashion. Sequence analysis detected five putative Sp1 binding sites in the -127/+37-bp sequence. EMSA and supershift experiments using two oligonucleotide fragments of the -127/+37 region showed that Sp1 and Sp3 proteins bound to putative Sp1 sites. Overexpression of Sp1 greatly increased PYY (-127/+37 bp)-luc activity and site-directed mutagenesis of putative Sp1 binding sites decreased basal and IGF-I-induced elevations in PYY (-127/+37 bp)-luc activity. IGF-I treatment also increased Sp1 protein levels and binding activity. Blockade of the IGF-I receptor (IGF-IR) with an IGF-IR antibody decreased the stimulatory influence of IGF-I on Sp1 protein levels and PYY (-127/+37 bp)-luc activity. Together, these findings indicate that IGF-I functions as a positive regulator of PYY gene expression and that the stimulatory effect may be mediated by Sp1 proteins that bind to the proximal PYY promoter region.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
PEPTIDE YY (PYY) is a 36-amino acid peptide hormone produced in endocrine cells of the distal ileum, colon, and pancreas (1, 2, 3). The rat PYY gene and approximately 550 nucleotides of the 5' flanking region have been characterized (4). Circulating PYY levels increase in response to various nutrients especially dietary fat (5). Intestinal PYY is thought to act as an enterogastrone and as an ileal brake factor because IV administration of PYY inhibits gastric acid secretion, gastric emptying and intestinal motility in laboratory animals and humans (3, 6, 7, 8). More recently, PYY in physiological amounts, has been shown to inhibit food intake in rodents and humans (9).

Although numerous studies show that gastrointestinal hormone expression, including PYY, is influenced by caloric intake (10, 11), the factors directly regulating gene expression have not been identified. Expression and secretion of the pleiotropic growth factor, IGF-I, is sensitive to caloric intake (12, 13, 14) and IGF-I administration has been shown to increase intestinal PYY mRNA and peptide levels in mice (15), suggesting that IGF-I mediates the stimulatory influence of food on intestinal PYY expression.

In the present study, to examine whether the stimulatory action of IGF-I on intestinal PYY expression is exerted at the level of gene transcription, the 5'-flanking region of the rat PYY gene was fused to the firefly luciferase (luc) reporter gene and the effect of IGF-I on transcriptional activity measured by a luc assay in transient transfection experiments. We show that IGF-I up-regulates PYY transcriptional activity in a time- and dose-dependent fashion, and that this IGF-I-induced elevation in transcriptional activity is dependent upon putative Sp1 binding sites identified in the proximal PYY promoter region.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
Oligonucleotides were from Promega (Madison, WI) and Invitrogen (Carlsbad, CA). Buffers and chemicals were purchased from Sigma (St. Louis, MO). The Sp1 and Sp3 antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). IGF-I (recombinant human IGF-I) was a gift of Genentech, Inc. (South San Francisco, CA).

Cell culture, transient transfection, and luc assays
Rat pheochromocytoma cells (PC12 cells) were used for all experiments because pilot studies showed that the PYY promoter-luc gene reporter constructs have the highest activity in PC12 cells. Transfection of PC12 cells with PYY (-127/+37 bp)-luc resulted in promoter activity 20-fold higher than the promoterless vector. PC12 cells were grown in RPMI 1640 containing 5% fetal bovine serum (FBS) and 5% horse serum supplemented with 100 IU/ml penicillin and 100 µg/ml streptomycin. Control and test plasmids were mixed and transfected in triplicate using lipofectamine (Invitrogen) in six-well plates. PC12 cells were transfected transiently with an IGF-I receptor (IGF-IR) expression vector (gift of R. Beserga, Thomas Jefferson University Medical College) to express elevated levels of IGF-IR. Transfections included 1 µg PYY promoter-reporter gene construct, 0.08 µg pRL-thymidine kinase (pRL-TK) containing the cDNA encoding Renilla luc (Promega) for monitoring transfection efficiency, and 1 µg IGF-IR expression vector for the IGF-I treatment experiments. The triple transfection procedure did not affect PC-12 cells adversely because Sp1 protein levels were unchanged when compared with controls (data not shown). In the presence of DNA, cells were treated with lipofectamine for 5 h that was replaced by normal medium containing FBS and horse serum for 15 h. Transfected cells were then cultured in serum-free media including IGF-I at doses and times indicated in the figure legends. In the IGF-I receptor antibody experiments, cells were exposed to an IGF-IR antibody (15 µg/ml, gift of Imclone Systems Inc., New York, NY) 8 h before and continuously through the IGF-I treatment period (16 h). Cells were harvested in lysis buffer and luc activities were determined by means of a luminometer (Monolight 2010, Analytical Luminescence Laboratory, San Diego, CA) using the dual luc assay system (Promega). The luc assay was performed in a final volume of 120 µl, containing 20 µl cell extract. Luciferin was added just before measuring light units, which were measured during the first second of the reaction at 25 C. PYY promoter firefly luc reporter activity was normalized with luc activity of cotransfected pRL-TK. Values are expressed as fold induction relative to the activity of the control-treated PYY promoter constructs and represent the mean ± SEM of at least three determinations repeated two to three times.

Rat pituitary cells (GH3) were grown in F-12K medium containing 15% horse serum and 2.5% FBS supplemented with 100 IU/ml penicillin and 100 µg/ml streptomycin. GH3 cells (six-well plates) were cotransfected with 0.8 µg/well of PYY (-127/+37 bp)-luc gene reporter construct and 1.2 µg/well of either Sp1 or Sp3 expression vector. Control plates were cotransfected with the appropriate Sp1 and Sp3 empty vectors. All plates were transfected with 0.08 µg of pRL-TK/well as an internal control. Luc activity was measured 40 h after transfection. The pEVR2/Sp1 expression vector was a gift of Dr. G. Suske (University of Marburg, Germany). The human Sp3 cDNA was obtained from American Type Culture Collection (Manassas, VA) and was subcloned into pcDNA 3(+) expression vector (Invitrogen).

Nuclear protein extracts
Nuclear extracts were prepared according to previously published methods (16). Protein concentrations were quantitated using a modified Bradford assay (Bio-Rad Laboratories, Hercules, CA). Nuclear extracts were aliquoted and frozen immediately at -80 C for storage.

EMSAs
Double-stranded oligonucleotides were radiolabeled with T4 polynucleotide kinase and [{gamma}-32P] ATP. The standard binding reaction was in a final volume of 20 µl: [4% glycerol; 1 mM MgCl2; 0.5 mM EDTA; 50 mM NaCl; 10 mM Tris (pH 7.5); 0.5 mM dithiothreitol; 1 µg poly(dI-dC)·poly(dI-dC); 1 mM ZnSO4]; and 5–15 µg PC12 cell nuclear extract. For competition experiments, nuclear extracts were incubated with a 100-fold molar excess of double-stranded, nonradiolabeled oligonucleotides at room temperature for 10 min before addition of 50,000 cpm of radiolabeled oligonucleotides. The mixture was incubated for 20 min at room temperature. In supershift experiments, either Sp1 or Sp3 antibody was added to the standard reaction and incubated for 60 min at room temperature. The DNA-protein complexes were resolved by electrophoresis at 190 V at room temperature in 0.5x Tris-borate-EDTA (TBE) in 4% nondenaturing polyacrylamide gels (37.5:1, acrylamide:bisacrylamide) for 2 h. In pilot experiments, incubation of nuclear extract with IgG at appropriate dilutions did not modify migration of DNA-protein complexes (data not shown).

Western blot analysis
Nuclear protein extracts of control and IGF-I-treated PC12 cells were boiled for 5 min in the presence of sample buffer (NuPAGE LDS sample buffer, Invitrogen) before separation on an 8% sodium dodecyl sulfate-polyacrylamide gel. One lane of the gel included molecular weight markers. After gel separation, proteins were transferred onto nitrocellulose membranes and blocked with 10% nonfat dry milk in TBS overnight at 4 C. Membranes were then incubated with a mouse Sp1 (1:400) antibody in washing buffer (1% milk in TBS with 0.1% Tween 20) for 3 h at room temperature. After three washes, membranes were incubated for 45 min at room temperature with conjugated antimouse (1:7000) IgG-horseradish peroxidase antibody in washing buffer. Membranes were then washed three times and detection was performed using the enhanced chemiluminescent method (ECL, NEN Life Science Products, Boston, MA) according to the manufacturer’s instructions. Membranes were exposed to x-ray film and autoradiographs were subjected to densitometric scanning quantification. The Sp1 amounts were expressed either as a ratio of Sp1 over a nonspecific protein band (see Fig. 6Go) that was not influenced by IGF-I or the relative amounts of Sp1 were calculated in arbitrary densitometric units (Table 1Go). For the IGF-IR antibody experiment, cells were exposed to an IGF-IR antibody as described for the luc assay.



View larger version (50K):
[in this window]
[in a new window]
  		FIG. 6. IGF-I increases Sp1 protein levels and DNA binding activity. Left panel, Western blotting analysis shows that IGF-I treatment increases Sp1 protein levels (3.01 ± 0.12, n = 3/group, P < 0.05) when compared with control treatment (1.61 ± 0.05). Molecular weight markers and Sp1 protein bands are identified. ns, Nonspecific band. Right panel, EMSA experiments show that IGF-I treatment increased Sp1 binding but did not affect Sp3 binding significantly, P > 0.05. The experiment was done using 32P-labeled Sp1 consensus and 5 µg of control or IGF-I-treated PC12 cell nuclear extract. Sp1 and Sp3 protein-DNA complexes are identified. Free, Free probe.

 

View this table:
[in this window]
[in a new window]
  		TABLE 1. Blockade of IGF-I activity with IGF-IR antibody inhibits the stimulatory effect of IGF-I on PYY promoter activity and Sp1 protein levels

 
Site-directed mutagenesis of the putative Sp1/Sp3 binding sites in the proximal PYY promoter
Mutations were introduced into the putative Sp1 binding sites of the PYY (-127/+37 bp)-luc construct by PCR using the Quick change XL site-directed Mutagenesis Kit (Stratagene, La Jolla, CA). The sequences of the mutagenic primers were:

site B1: GTGCAGGGAGAGAGGATATGAGGGAGGGAGGAGACAAGCA and TGCTTGTCTCCTCCCTCCCTCATATCCTCTCTCCCTGCAC;

site B2: CAGGGAGAGAGGGGAGGAGATATGGAGGAGACAAGCCCTC and GAGGGCTTGTCTCCTCCATATCTCCTCCCCTCTCTCCCTG

sites B1 + B2: AGGGAGAGAGGATATGAGATATGGAGGAGACAAGCCCTC and GAGGGCTTGTCTCCTCCATATCTCATATCCTCTCTCCCTG; and

site D: CTGGATTCCCCATATCTTTCCAAGTG and CACTTGGAAAGATATGGGGAATCCAG

After 18 cycles of PCR using Pfu Turbo DNA polymerase at 95 C for 50 sec, 60 C for 50 sec, and 68 C for 9 min, the parental, double-stranded DNA was digested with DpnI and the sequences of the clones for site-directed mutants were confirmed by DNA sequencing.

Statistical analysis
Results are expressed as the mean ± SEM. Data were analyzed by t test or one-way ANOVA and subsequently with Newman-Keuls test when appropriate. P < 0.05 was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
IGF-I increases transcription of the PYY gene
One possible mechanism behind the IGF-I-induced elevation in intestinal PYY gene expression (15) is that IGF-I stimulates PYY promoter activity. Therefore, to determine the extent to which IGF-I increases PYY promoter activity, three 5'-upstream segments flanking the rat PYY gene (-2800/+37 bp, -770/+37 bp, -127/+37 bp) were fused to the luc reporter gene and transfected into rat pheochromocytoma cells (PC12 cells). The effect of IGF-I (50 ng/ml) treatment was measured by a luc reporter assay. Our results show that treatment of PC12 cells with IGF-I increased PYY transcriptional activity approximately to the same extent (~2- to 3-fold) for the three constructs (Fig. 1Go).



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 1. Delineation of the IGF-I response regions in the rat PYY gene promoter. Deletion constructs of the 5'-flanking region of the rat PYY gene (-2800/+37 bp, -770/+37 bp, -127/+37 bp) and IGF-IR expression vector were transfected into rat PC12 cells, and luc activities were measured after a 24-h exposure to 50 ng/ml recombinant human IGF-I. Data are presented as fold increase of control in the presence of IGF-I and represent the means ± SEM of three separate experiments with triplicate plates for all treatments. *, P < 0.05 vs. vehicle-treated control plates.

 
We next examined the influence of different doses of IGF-I and the time course for IGF-I stimulation of PYY promoter activity. Because the enhancement effect of IGF-I was present with the three different PYY 5'-upstream segments and sequence analysis of the -127/+37-bp fragment showed the presence of five potential Sp1 binding sites (see Fig. 3Go, top panel) the subsequent experiments were done using the -127/+37 bp fragment. After transfection, PC12 cells were exposed to different doses of IGF-I (5–200 ng/ml) and luc activities were measured 24 h later. Findings show that IGF-I stimulated PYY promoter activity in a dose-dependent manner (Fig. 2Go, top panel). An approximately 1.7-fold stimulation was measured with IGF-I at 25 ng/ml, and a 2-fold stimulation was measured with IGF-I at 50 ng/ml, when compared with controls. No significantly greater stimulation of PYY promoter activity was measured with IGF-I treatment at 200 ng/ml. To show that the stimulatory effect of IGF-I is mediated by the IGF-I receptor (IGF-IR), cells were pretreated with an IGF-IR antibody: blockade of IGF-IR decreased the stimulatory effect of IGF-I on PYY promoter activity by approximately 60% (Table 1Go).



View larger version (73K):
[in this window]
[in a new window]
  		FIG. 3. Top panel, Nucleotide sequence of the rat proximal PYY promoter region (-127/+37 bp). The numbers above the nucleotide sequence are positions relative to the transcription initiation site. Five putative Sp1 binding sites are identified (bold-underlined) by sequence analysis. Four oligonucleotide fragments were used in EMSA experiments: A, -127/-108; B, -107/-84; C, -83/-60; and D, -59/-36. B1 and B2 were used in site-directed mutagenesis experiments. Bottom panel, EMSAs of the Sp1 consensus oligonucleotide and fragments A–D of the proximal region of the rat PYY gene promoter (see Fig. 4Go) with nuclear extract (5 µg) from rat PC12 cells. Double-stranded competitor DNA fragments (Sp1 consensus or mSp1) were added in 100-fold molar excess. The Sp1 consensus bound to the PC12 nuclear proteins to form three complexes identified by the numbers 1, 2, and 3 (lane 1). The nuclear protein-DNA complexes were competed by a Sp1 consensus (lane 2). Fragment A did not form a complex (lane 3), fragment C formed 1 complex (lane 9, arrow), and fragments B and D formed three complexes (lanes 6 and 12, arrows). Free, Free probe.

 


View larger version (36K):
[in this window]
[in a new window]
  		FIG. 2. Dose- and time-dependent stimulation of the rat PYY promoter by IGF-I. Top panel, The 5' flanking region (-127/+37 bp) of the rat PYY gene fused to the luc reporter gene and IGF-IR expression vector were transfected into rat PC12 cells and treated with different concentrations of IGF-I. Luc activities were measured 24 h after start of IGF-I treatment and are expressed as fold increase of control in the presence of IGF-I. *, P < 0.05 vs. control vehicle and 5 ng/ml; {dagger}, P < 0.05 vs. control vehicle and lower IGF-I doses. Bottom panel, Time course for IGF-I stimulation of rat PYY promoter. Transfected cells were treated with IGF-I (50 ng/ml) and harvested after either 8, 12, 24, or 48 h exposure to IGF-I. *, P < 0.05 vs. control-vehicle-treated plates; {dagger}, P < 0.05 vs. control-vehicle and 8-, 12-, and 48-h-treated plates.

 
For the time course experiment, the stimulatory effect of IGF-I exposure on PYY promoter activity was examined at 8, 12, 24, and 48 h after the initiation of IGF-I treatment (50 ng/ml) (Fig. 2Go, bottom panel). Although IGF-I treatment increased PYY promoter activity at all time points, a maximal stimulation of PYY promoter activity occurred 24 h after addition of IGF-I.

Sp1 proteins bind to proximal PYY promoter region
Sequence analysis of the proximal 5' PYY promoter region (i.e. -127/+37 bp) identified five putative Sp1 binding sites (Fig. 3Go, top panel). Therefore, we next compared the patterns of protein binding to these sites to the protein binding to the Sp1 consensus oligonucleotide (Fig. 3Go, bottom panel). The consensus Sp1 oligonucleotide or segments of the proximal promoter region (oligonucleotides A–D) were analyzed by EMSA using a PC12 cell nuclear extract (5 µg). The oligonucleotide segments correspond to four consecutive fragments (A–D) of the proximal PYY promoter, each comprising one or two putative Sp1 binding sites (Fig. 3Go, top panel). A 100-fold molar excess of a consensus or mutant Sp1 oligonucleotide was used to confirm specificity of binding. EMSA experiments showed that two major and one minor DNA-protein complexes were detected with the Sp1 consensus oligonucleotide (Fig. 3Go, bottom panel, lane 1). Formation of these complexes was completely inhibited by a 100-fold molar excess of the cold Sp1 oligonucleotide (lane 2). EMSA experiments showed that Sp1 did not bind to the potential Sp1 binding sequence in fragment A (lane 3). Fragment C of the PYY promoter (lane 9) formed one DNA-protein complex with a mobility identical with the top band formed with the Sp1 consensus. Fragments B and D of the PYY promoter (lanes 6 and 12) formed three DNA-protein complexes with mobilities identical with those formed with the Sp1 consensus (lane 1). Incubation with excess Sp1 consensus (lanes 7, 10, and 13), but not mutated Sp1 (mSp1) (lanes 8, 12, and 14) inhibited formation of these complexes. The presence of Sp1 and Sp3 proteins in the complexes observed with nuclear extracts prepared from PC12 cells was confirmed by using 32P-labeled Sp1 consensus and antibodies immunoreacting with either Sp1 or Sp3 proteins (Fig. 4Go, top panel). Preincubation of PC12 cell nuclear extracts either with Sp1 or Sp3 antibody either further retarded (supershift) or eliminated the DNA-protein complexes (Fig. 4Go, top panel, lanes 2 and 3). Based on this analysis, the slower migrating complex (i.e. top band) contains Sp1 complex, whereas the two faster migrating complexes (i.e. middle and lower bands) contain Sp3 protein. For promoter fragments B and D, preincubation of nuclear extracts with a Sp1 or Sp3 antibody supershifted the formation of the DNA-protein complexes (Fig. 4Go, bottom panel, lanes 2, 3, 5, and 6) confirming the binding of Sp1 and Sp3 proteins to the putative Sp1 sites in the upstream PYY promoter region. For promoter fragments B and D, the supershifted DNA-Sp3 protein complexes showed the same mobility, in part, as the DNA-Sp1 protein complex (lanes 3 and 6).



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 4. Supershift gel mobility assays using antibodies to Sp1 and Sp3. Top panel, A gel mobility shift assay was performed using 32P-labeled Sp1 consensus and 15 µg of control PC12 cell nuclear extract (NE). Sp1 or Sp3 antibody was added to the gel shift reaction mixture for 60 min before addition of radiolabeled Sp1 consensus. Complex 1 and complexes 2 and 3 are supershifted by antibodies to Sp1 and Sp3, respectively (lanes 2 and 3: clear arrowhead = supershift), indicating that complex 1 is a Sp1 protein-DNA complex and complexes 2 and 3 are Sp3-DNA complexes. Bottom panel, A gel mobility shift assay was performed using 32P-labeled PYY promoter oligonucleotide fragments B and D (see Fig. 4Go) and control PC12 nuclear extract (NE, 5–10 µg). Either Sp1 or Sp3 antibody was added to the gel shift reaction mixture for 60 min before addition of radiolabeled fragment B or D. Black arrowheads to the left of control lanes (lanes 1 and 4) indicate positions of Sp1/Sp3 protein-DNA complexes. Preincubation of nuclear extracts with an Sp1 or Sp3 antibody supershifted the DNA-protein complexes for fragments B and D. Supershifted complexes are identified by the clear arrowheads.

 
Sp1 protein increases PYY promoter-reporter gene activity
The aim of the next experiment was to examine the extent to which Sp1 and Sp3 proteins activate the PYY promoter by means of transient transfection experiments. The proximal PYY (-127/+37bp)-luc reporter gene construct was cotransfected with either a Sp1 or Sp3 expression vector into GH3 cells. GH3 cells were chosen for this experiment because they express low endogenous levels of Sp1 (17, 18). Sp1 overexpression resulted in an 8-fold increase in the PYY promoter-reporter gene activity when compared with PYY promoter-reporter gene activity in cells cotransfected with an empty vector, a control treatment (Fig. 5Go). Although overexpression of Sp3 increased PYY promoter-reporter gene construct activity significantly, the increase was less than an 1-fold elevation.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 5. Effects of Sp1 and Sp3 overexpression on PYY -127/+37 promoter activity. GH3 cells were transiently cotransfected with the PYY (-127/+37)-luc gene reporter construct and either a Sp1or Sp3 expression vector. Empty-control vectors were also transfected. Luc activity was normalized to pRL-TK activity in transfection efficiency. Data represent means ± SEM of three separate experiments. *, P < 0.05 vs. respective empty vector.

 
IGF-I increases Sp1 protein levels and binding activity
The presence of Sp1 protein in nuclear extracts isolated from IGF-I-treated PC12 cells was confirmed by Western analysis (Fig. 6Go). Additionally, Western analyses were done to test the possibility that IGF-I treatment alters the levels of Sp1 protein. Western findings show that Sp1 protein levels were increased significantly (Fig. 6Go) in nuclear extracts isolated from IGF-I-treated cells when compared with control cells: control, 1.61 ± 0.05 vs. IGF-I treated; 3.01 ± 0.12, n = 3/group, P < 0.05). Levels of unrelated protein (i.e. nonspecific proteins) cross-reacting with the Sp-1 antiserum in the Western blotting procedure did not change with IGF-I treatment (data not shown). IGF-I treatment did not alter Sp1 expression significantly (data not shown). Furthermore, exposure of PC-12 cells to an IGF-IR antibody inhibited the stimulatory effect of IGF-I on Sp1 protein levels (Table 1Go).

To test whether IGF-I affects Sp1 binding activity, an EMSA experiment was performed with nuclear extracts of control and IGF-I-treated PC12 cells and 32P-labeled consensus Sp1 oligonucleotide probe. When compared with controls, IGF-I treatment increased Sp1 binding activity to 128 ± 6% (n = 7/group, P < 0.05) of control treatment (Fig. 6Go). IGF-I did not affect Sp3 binding activity significantly (P > 0.05, data not shown).

IGF-I increases PYY promoter-reporter gene activity through Sp1 binding to proximal promoter region
As described earlier, sequence analysis of the proximal 5' PYY promoter region (i.e. -127/+37 bp) identified five putative Sp1 binding sites (Fig. 3Go, top panel). To assess the role of three of the putative Sp1 sites on basal and the IGF-I-induced increase in PYY transcriptional activity, site-directed mutagenesis analyses were done. Constructs carrying mutations in regions B and D of the proximal 5' PYY promoter region and wild-type counterparts were transfected into PC12 cells. Basal PYY transcriptional activity (without IGF-I treatment) was decreased by mutation of the putative Sp1 sites (Fig. 7Go). Mutation of the B1 and B2 sites individually decreased basal PYY transcriptional activity only marginally whereas mutation of the B1 and B2 sites in combination caused a 50% decrease in basal PYY transcriptional activity. Mutation of the D site alone decreased basal PYY transcriptional activity by approximately 40%. Mutation of the B1, B2, and D sites in combination decreased basal PYY transcriptional activity by approximately 60%. When compared with the wild-type PYY (-127/+37)-luc reporter gene construct, mutation of the B1 site resulted in a 20% reduction in the IGF-I-induced increase in luc activity. Mutation of the B2 site alone and the B1 and B2 sites in combination resulted in 40 and 45% reductions, respectively, of the IGF-I-induced elevations in luc activity. Mutation of the D site alone resulted in a 75% reduction of IGF-I-induced increase in luc activity. Mutation of the B1, B2, and D sites in combination resulted in a 100% reduction of the IGF-I-induced increase of luc activity.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 7. The dependence of basal and of the IGF-I-induced increase in the transcriptional activity of the PYY (-127/+37 bp)-luc gene reporter construct on the putative Sp1 binding sites. Top panel, Putative Sp1 sites identified as B1, B2, or D (see Fig. 4Go) were mutated individually (i.e. mSp1 B1, etc.) or in combination by site directed mutagenesis. The putative Sp1 sites are underlined and the mutated nucleotides are indicated by bold letters. Bottom panel, Wild-type PYY (-127/+37 bp)-luc and mutated constructs were transfected into PC12 cells and treated with IGF-I for 24 h. Each construct was tested in triplicate, and the data are given as the mean ± SEM. *, P < 0.05 vs. wild-type PYY (-127/+37 bp)-luc. {dagger}, P < 0.05 vs. control-treated construct.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Previous studies have demonstrated that expression and secretion of the intestinal peptide hormone, peptide YY (PYY), is up-regulated by the growth factor, IGF-I (15). The primary objective of this study was to determine the level at which IGF-I increases PYY expression. The present findings show that IGF-I exposure increased PYY gene transcriptional activity and that this stimulatory action is mediated by the IGF-I receptor because IGF-IR blockade with a specific antibody decreased the stimulatory influence of IGF-I substantially.

EMSA experiments using four sequential segments of the proximal PYY promoter region (Fig. 4Go), which contain putative Sp1 binding sequences, confirmed the presence of Sp1 and Sp3 proteins in the protein-DNA complexes for fragments B–D; however, Sp1 did not bind to the potential Sp1 sequence in fragment A. In fragments B and D, three Sp1/Sp3 protein-DNA complexes were identified, whereas in fragment C only a single protein-DNA complex was found. The most important EMSA finding was that IGF-I treatment of PC-12 cells resulted in an increased Sp1 binding activity to the PYY-promoter-luc reporter gene construct. This finding suggests that IGF-I enhances PYY transcription in part by an elevation in Sp1 binding activity.

Interestingly, the present findings also show that IGF-I increases Sp1 protein levels. Previously, it has been reported that the transcriptional activity of Sp1 is either increased or decreased by its phosphorylation or glycosylation, a change in Sp1 protein levels is uncommon (19, 20, 21, 22). Furthermore, blockade of the IGF-I receptor with an IGF-IR antibody prevented the elevation in Sp1 protein levels indicating the dependence of the IGF-I-induced increase in Sp1 protein levels upon an IGF-I activated IGF-IR.

The site-directed mutation analyses clearly demonstrated the dependence of basal and of the IGF-I-induced elevation in the transcriptional activity of the PYY promoter-reporter gene construct on the Sp1 binding sites. Both the basal and the IGF-I-induced activity were dependent upon intact Sp1 sites. Sequential mutation of the B1 and B2 sites (Figs. 3Go and 7Go) caused a synergistic decrease in basal PYY transcriptional activity, suggesting that the binding of the Sp1 to multiple sites (B1 and B2) is essential for full promoter activity. Mutation of the D site, the most proximal Sp1 site, decreased basal PYY transcriptional activity to a magnitude similar to that caused by mutation of either the B1 and B2 sites in combination or the B1, B2, and D sites in combination. The finding that mutation of the B1, B2, and D sites in combination did not abolish basal PYY transcriptional activity indicates that other Sp1 sites or binding elements are essential for basal PYY transcriptional activity. Mutation of the three putative Sp1 sites in combination (sites B1 and B2 in segment B, and site D in segment D; Figs. 3Go and 7Go) abolished the enhancement effect of IGF-I on PYY transcriptional activity indicating that these sites mediate the IGF-I-induced enhancement of PYY transcriptional activity. Although mutation of the B1 and B2 sites individually and in combination diminished the enhancement effect of IGF-I, mutation of the most proximal site (D site) had the largest effect. The importance of Sp1 protein and Sp1 sites in the enhancement effect of IGF-I was further supported by the finding that overexpression of Sp1 greatly increased activity of the proximal PYY promoter-luc construct (Fig. 5Go). Although Sp3 has been shown to act as a transcriptional activator similar to Sp1 (23), overexpression of Sp3, in contrast to Sp1, had a marginal stimulatory effect on PYY promoter activity indicating the specificity of Sp1 activity.

The transcription factor Sp1 is expressed ubiquitously in various cell types and numerous studies support its involvement in the regulation of cell growth and differentiation (23, 24, 25, 26, 27, 28) as well as in regulation of peptide hormone expression (29, 30, 31). Many of the Sp1 mediated effects involve either a posttranslational modification of Sp1, i.e. glycosylation or phosphorylation (20, 21, 22). Phosphorylation has been shown to either increase, decrease or have no effect on Sp1 activity (22, 32, 33), and glycosylation also has variable effects on Sp1 activity (20, 34, 35). Sp1 has been shown to be involved in the transcriptional regulation of the stomach peptide hormone, gastrin (31, 36), and the hypothalamic hormone, TSH-releasing hormone gene by epidermal growth factor (29). Epidermal growth factor also stimulates the gastrin promoter by activation of a Sp1 kinase (31). Our Western analysis indicates that IGF-I treatment increases levels of Sp1 protein; however, a posttranslational modification such as phosphorylation was not examined in this study. Blockade of the stimulatory effect of IGF-I by an IGF-IR antibody clearly demonstrated dependence of the elevated Sp1 protein levels on an IGF-I activated IGF-IR.

Numerous studies have demonstrated that the gastrointestinal tract is a major target organ for IGF-I (37, 38, 39, 40). IGF-IR is expressed in the epithelial layer of the rodent gastrointestinal tract and IGF-I exerts a strong mitogenic action on the gastric and intestinal epithelium (37, 38, 39, 41, 42). The IGF-I system is sensitive to metabolic alterations. Malnutrition, fasting and caloric restriction compromise hepatic production and systemic IGF-I levels (12, 13, 14, 43). Enteric nutrition is also important for maintenance of gut hormone expression (10, 11). Because IGF-I increases PYY promoter activity in vitro and PYY expression levels (i.e. mRNA levels) in vivo, IGF-I may mediate the influence of caloric intake on intestinal PYY expression.

Although PC-12 cells are endocrine cells and express neuropeptide Y, a regulatory peptide structurally and evolutionally related to PYY (44, 45), it should be emphasized that PC-12 cells are not gastrointestinal cell in origin. Therefore, extrapolation of our findings to an intestinal endocrine cell system should be done with this information in mind.


   Footnotes
 
This work was supported by a grant from the National Institutes of Health (RO1 DK15241).

Abbreviations: FBS, Fetal bovine serum; GH3, rat pituitary cells; IGF-IR, IGF-I receptor; luc, luciferase; mSp1, mutated Sp1; PC12, rat pheochromocytoma cells; PYY, peptide YY; pRL-TK, pRL-thymidine kinase.

Received June 20, 2003.

Accepted for publication October 16, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Adrian TE, Ferri GL, Bacarese-Hamilton AJ, Fuessl HS, Polak JM, Bloom SR 1985 Human distribution and release of a putative new gut hormone, peptide YY. Gastroenterology 89:1070–1077[Medline]
  2. Greeley Jr GH, Hill FL, Spannagel A, Thompson JC 1987 Distribution of peptide YY in the gastrointestinal tract of the rat, dog, and monkey. Regul Pept 19:365–372[CrossRef][Medline]
  3. Lundberg JM, Tatemoto K, Terenius L, Hellstrom PM, Mutt V, Hokfelt T, Hamberger B 1982 Localization of peptide YY (PYY) in gastrointestinal endocrine cells and effects on intestinal blood flow and motility. Proc Natl Acad Sci USA 79:4471–4475[Abstract/Free Full Text]
  4. Krasinski SD, Wheeler MB, Leiter AB 1991 Isolation, characterization, and developmental expression of the rat peptide-YY gene. Mol Endocrinol 5:433–440[CrossRef][Medline]
  5. Greeley Jr GH, Hashimoto T, Izukura M, Gomez G, Jeng J, Hill FL, Lluis F, Thompson JC 1989 A comparison of intraduodenally and intracolonically administered nutrients on the release of peptide-YY in the dog. Endocrinology 125:1761–1765[Abstract]
  6. Guo YS, Fujimura M, Lluis F, Tsong Y, Greeley Jr GH, Thompson JC 1987 Inhibitory action of peptide YY on gastric acid secretion. Am J Physiol 253:G298–302
  7. Adrian TE, Savage AP, Sagor GR, Allen JM, Bacarese-Hamilton AJ, Tatemoto K, Polak JM, Bloom SR 1985 Effect of peptide YY on gastric, pancreatic, and biliary function in humans. Gastroenterology 89:494–499[Medline]
  8. Pappas TN, Debas HT, Taylor IL 1986 Enterogastrone-like effect of peptide YY is vagally mediated in the dog. J Clin Invest 77:49–53
  9. Batterham RL, Cowley MA, Small CJ, Herzog H, Cohen MA, Dakin CL, Wren AM, Brynes AE, Low MJ, Ghatei MA, Cone RD, Bloom SR 2002 Gut hormone PYY(3–36) physiologically inhibits food intake. Nature 418:650–654[CrossRef][Medline]
  10. Kanayama S, Liddle RA 1991 Influence of food deprivation on intestinal cholecystokinin and somatostatin. Gastroenterology 100:909–915[Medline]
  11. Wu V, Sumii K, Tari A, Sumii M, Walsh JH 1991 Regulation of rat antral gastrin and somatostatin gene expression during starvation and after refeeding. Gastroenterology 101:1552–1558[Medline]
  12. Clemmons DR, Underwood LE 1991 Nutritional regulation of IGF-I and IGF binding proteins. Annu Rev Nutr 11:393–412[CrossRef][Medline]
  13. Lowe Jr WL, Adamo M, Werner H, Roberts Jr CT, LeRoith D 1989 Regulation by fasting of rat insulin-like growth factor I and its receptor. Effects on gene expression and binding. J Clin Invest 84:619–626
  14. Oster MH, Fielder PJ, Levin N, Cronin MJ 1995 Adaptation of the growth hormone and insulin-like growth factor-I axis to chronic and severe calorie or protein malnutrition. J Clin Invest 95:2258–2265
  15. Lee HM, Udupi V, Englander EW, Rajaraman S, Coffey Jr RJ, Greeley Jr GH 1999 Stimulatory actions of insulin-like growth factor-I and transforming growth factor-{alpha} on intestinal neurotensin and peptide YY. Endocrinology 140:4065–4069[Abstract/Free Full Text]
  16. Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res 17:6419[Free Full Text]
  17. Coleman TA, Hou YT, Kopchick JJ 1992 The SV40 early transcriptional regulatory element is unable to direct gene expression in pituitary GH-3 cells. Gene Expr 2:175–189[Medline]
  18. Kimura N, Tomizawa S, Arai KN, Osamura RY 2001 Characterization of 5'-flanking region of rat somatostatin receptor sst2 gene: transcriptional regulatory elements and activation by Pitx1 and estrogen. Endocrinology 142:1427–1441[Abstract/Free Full Text]
  19. Jensen DE, Rich CB, Terpstra AJ, Farmer SR, Foster JA 1995 Transcriptional regulation of the elastin gene by insulin-like growth factor-I involves disruption of Sp1 binding. Evidence for the role of Rb in mediating Sp1 binding in aortic smooth muscle cells. J Biol Chem 270:6555–6563[Abstract/Free Full Text]
  20. Majumdar G, Harmon A, Candelaria R, Martinez-Hernandez A, Raghow R, Solomon SS 2003 O-glycosylation of Sp1 and transcriptional regulation of the calmodulin gene by insulin and glucagon. Am J Physiol Endocrinol Metab 285:E584–591
  21. Jackson SP, Tjian R 1988 O-glycosylation of eukaryotic transcription factors: implications for mechanisms of transcriptional regulation. Cell 55:125–133[CrossRef][Medline]
  22. Jackson SP, MacDonald JJ, Lees-Miller S, Tjian R 1990 GC box binding induces phosphorylation of Sp1 by a DNA-dependent protein kinase. Cell 63:155–165[CrossRef][Medline]
  23. Suske G 1999 The Sp-family of transcription factors. Gene 238:291–300[CrossRef][Medline]
  24. Biggs JR, Kudlow JE, Kraft AS 1996 The role of the transcription factor Sp1 in regulating the expression of the WAF1/CIP1 gene in U937 leukemic cells. J Biol Chem 271:901–906[Abstract/Free Full Text]
  25. Shin TH, Paterson AJ, Grant 3rd JH, Meluch AA, Kudlow JE 1992 5-Azacytidine treatment of HA-A melanoma cells induces Sp1 activity and concomitant transforming growth factor {alpha} expression. Mol Cell Biol 12:3998–4006[Abstract/Free Full Text]
  26. Chen X, Azizkhan JC, Lee DC 1992 The binding of transcription factor Sp1 to multiple sites is required for maximal expression from the rat transforming growth factor {alpha} promoter. Oncogene 7:1805–1815[Medline]
  27. Miltenberger RJ, Farnham PJ, Smith DE, Stommel JM, Cornwell MM 1995 v-Raf activates transcription of growth-responsive promoters via GC-rich sequences that bind the transcription factor Sp1. Cell Growth Differ 6:549–556[Abstract]
  28. Black AR, Jensen D, Lin SY, Azizkhan JC 1999 Growth/cell cycle regulation of Sp1 phosphorylation. J Biol Chem 274:1207–1215[Abstract/Free Full Text]
  29. Ren Y, Satoh T, Yamada M, Hashimoto K, Konaka S, Iwasaki T, Mori M 1998 Stimulation of the preprothyrotropin-releasing hormone gene by epidermal growth factor. Endocrinology 139:195–203[Abstract/Free Full Text]
  30. Gerhard M, Neumayer N, Presecan-Siedel E, Zanner R, Lengyel E, Cramer T, Hocker M, Prinz C 2001 Gastrin induces expression and promoter activity of the vesicular monoamine transporter subtype 2. Endocrinology 142:3663–3672[Abstract/Free Full Text]
  31. Chupreta S, Du M, Todisco A, Merchant JL 2000 EGF stimulates gastrin promoter through activation of Sp1 kinase activity. Am J Physiol Cell Physiol 278:C697–C708
  32. Mortensen ER, Marks PA, Shiotani A, Merchant JL 1997 Epidermal growth factor and okadaic acid stimulate Sp1 proteolysis. J Biol Chem 272:16540–16547[Abstract/Free Full Text]
  33. Rohlff C, Ahmad S, Borellini F, Lei J, Glazer RI 1997 Modulation of transcription factor Sp1 by cAMP-dependent protein kinase. J Biol Chem 272:21137–21141[Abstract/Free Full Text]
  34. Du XL, Edelstein D, Rossetti L, Fantus IG, Goldberg H, Ziyadeh F, Wu J, Brownlee M 2000 Hyperglycemia-induced mitochondrial superoxide overproduction activates the hexosamine pathway and induces plasminogen activator inhibitor-1 expression by increasing Sp1 glycosylation. Proc Natl Acad Sci USA 97:12222–12226[Abstract/Free Full Text]
  35. Yang X, Su K, Roos MD, Chang Q, Paterson AJ, Kudlow JE 2001 O-linkage of N-acetylglucosamine to Sp1 activation domain inhibits its transcriptional capability. Proc Natl Acad Sci USA 98:6611–6616[Abstract/Free Full Text]
  36. Merchant JL, Shiotani A, Mortensen ER, Shumaker DK, Abraczinskas DR 1995 Epidermal growth factor stimulation of the human gastrin promoter requires Sp1. J Biol Chem 270:6314–6319[Abstract/Free Full Text]
  37. Burrin DG, Wester TJ, Davis TA, Amick S, Heath JP 1996 Orally administered IGF-I increases intestinal mucosal growth in formula-fed neonatal pigs. Am J Physiol 270:R1085–R1091
  38. Steeb CB, Shoubridge CA, Tivey DR, Read LC 1997 Systemic infusion of IGF-I or LR(3)IGF-I stimulates visceral organ growth and proliferation of gut tissues in suckling rats. Am J Physiol 272:G522–G533
  39. Tremblay E, Chailler P, Menard D 2001 Coordinated control of fetal gastric epithelial functions by insulin-like growth factors and their binding proteins. Endocrinology 142:1795–1803[Abstract/Free Full Text]
  40. Winesett DE, Ulshen MH, Hoyt EC, Mohapatra NK, Fuller CR, Lund PK 1995 Regulation and localization of the insulin-like growth factor system in small bowel during altered nutrient status. Am J Physiol 268:G631–G640
  41. Laburthe M, Rouyer-Fessard C, Gammeltoft S 1988 Receptors for insulin-like growth factors I and II in rat gastrointestinal epithelium. Am J Physiol 254:G457–G462
  42. Termanini B, Nardi RV, Finan TM, Parikh I, Korman LY 1990 Insulinlike growth factor I receptors in rabbit gastrointestinal tract. Characterization and autoradiographic localization. Gastroenterology 99:51–60[Medline]
  43. Frystyk J, Delhanty PJ, Skjaerbaek C, Baxter RC 1999 Changes in the circulating IGF system during short-term fasting and refeeding in rats. Am J Physiol 277:E245–E252
  44. Allen JM, Martin JB, Heinrich G 1987 Neuropeptide Y gene expression in PC12 cells and its regulation by nerve growth factor: a model for developmental regulation. Brain Res 427:39–43[Medline]
  45. Larhammar D, Soderberg C, Blomqvist AG 1993 Evolution of the neuropeptide Y family of peptides. In: Colmers WF, Wahlestedt C, eds. The biology of neuropeptide Y. Totowa, NJ: Humana Press; 1–41



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
G. Majumdar, A. Harrington, J. Hungerford, A. Martinez-Hernandez, I. C. Gerling, R. Raghow, and S. Solomon
Insulin Dynamically Regulates Calmodulin Gene Expression by Sequential O-Glycosylation and Phosphorylation of Sp1 and Its Subcellular Compartmentalization in Liver Cells
J. Biol. Chem., February 10, 2006; 281(6): 3642 - 3650.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/2/659    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, G.
Right arrow Articles by Greeley, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, G.
Right arrow Articles by Greeley, G. H., Jr.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals