help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0873
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seth, A.
Right arrow Articles by Bloom, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seth, A.
Right arrow Articles by Bloom, S.
Endocrinology Vol. 145, No. 2 743-750
Copyright © 2004 by The Endocrine Society

Galanin-Like Peptide Stimulates the Release of Gonadotropin-Releasing Hormone in Vitro and May Mediate the Effects of Leptin on the Hypothalamo-Pituitary-Gonadal Axis

Asha Seth, Sarah Stanley, Preeti Jethwa, James Gardiner, Mohammad Ghatei and Stephen Bloom

Division of Metabolic Medicine, Faculty of Medicine, Imperial College of Science, Technology and Medicine, Hammersmith Campus, London W12 ONN, United Kingdom

Address all correspondence and requests for reprints to: Professor S. Bloom, Division of Metabolic Medicine, Faculty of Medicine, Imperial College of Science Technology and Medicine, Hammersmith Campus, Du Cane Road, London W12 ONN, United Kingdom. E-mail: s.bloom{at}ic.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Leptin regulates the hypothalamo-pituitary-gonadal axis in relation to nutritional status. The mechanism through which leptin mediates its effects on neuroendocrine reproductive circuits remains unclear. Galanin-like peptide (GALP) is a recently identified hypothalamic peptide, localized in the arcuate nucleus, which seems to be regulated by leptin and stimulates LH when administered centrally. Here, we demonstrate that leptin stimulates the release of GALP and GnRH in vitro from hypothalamic explants harvested from male rats. In addition, we show that GALP stimulates the release of GnRH from hypothalamic explants and GT1–7 cells. Furthermore, we demonstrate that GALP antiserum blocks the stimulatory action of leptin on GnRH release from hypothalamic explants. GALP is a ligand of the galanin receptors. We therefore investigated whether the effect of GALP on GnRH release may be mediated via a known galanin receptor. GALP-stimulated GnRH release from hypothalamic explants was attenuated (but not abolished) by the galanin receptor antagonist galantide. However, GALP-stimulated GnRH release from GT1–7 cells was not diminished by the coadministration of galantide. In addition, none of the cloned galanin receptors were expressed in GT1–7 cells by RT-PCR. These observations suggest that GALP may stimulate GnRH release through an indirect pathway involving a galanin receptor and via a direct action on GnRH neurons, possibly through a novel receptor. These findings suggest that GALP may mediate the actions of leptin on the reproductive axis and provide a link between nutrition and fertility.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ENERGY STATUS AND fertility are highly regulated in mammals. The adipocyte hormone leptin, which is secreted in proportion to body adiposity, acts as a metabolic signal to the neuroendocrine system to integrate feeding behavior, metabolism, and pituitary function with the level of energy reserves (1). Several studies have indicated leptin may have a permissive role in the regulation of the reproductive axis, because low or absent leptin inhibits the hypothalamo-pituitary-gonadal (HPG) axis and impairs reproductive function. In both rodents and humans, the absence of leptin results in infertility attributable to hypogonadotropic hypogonadism (2, 3); reproductive function can be restored by peripheral injections of recombinant leptin (3, 4). Furthermore, in both rodents and humans, fasting, and therefore low leptin (5, 6), suppresses pulsatile LH secretion (7, 8). Again the exogenous administration of leptin in physiological replacement doses prevents these fasting-induced changes of the HPG axis (1, 9).

The mechanism of leptin’s effects on the HPG axis remains unclear. Leptin is known to act on hypothalamic neuronal targets primarily located in the arcuate nucleus (ARC). However, the leptin receptor has not been identified on GnRH neurons in vivo (10), and the intermediaries in the signal transduction pathway between leptin and GnRH have yet to be conclusively established. Galanin-like peptide (GALP) is a novel peptide recently isolated from the porcine hypothalamus (11), which is expressed solely in the ARC (12, 13, 14). The majority of GALP neurons in the ARC colocalize with the leptin receptor (12), and leptin treatment has been shown to increase GALP mRNA expression in ovariectomized female rats (13) and ob/ob mice (15). GALP immunoreactive (IR) fibers project from the ARC to the medial preoptic area (MPOA) and are often seen in close apposition with GnRH-IR perikarya (12). Intracerebroventricular (ICV) administration of GALP increases serum LH and testosterone in intact males (16, 17) and induces c-fos activation in GnRH neurons in the MPOA (16).

GALP shares sequence homology with galanin (11). To date, three G protein-coupled receptors, termed GAL R1, GAL R2, and GAL R3, with high affinity for galanin have been identified (18, 19, 20). GALP also shows high affinity for GAL R1 and GAL R2 (its affinity for GAL R3 is unknown) (11). Galanin has also been reported to act on the HPG axis. Galanin stimulates the release of GnRH from median eminence-ARC fragments in vitro (21), and ICV administration of galanin stimulates LH release in females in vivo (22). The receptor mediating the effects of galanin on the HPG axis remains unknown, given that selective galanin receptor antagonists are not available.

In our current study, we have examined the hypothesis that GALP mediates the effects of leptin on the reproductive axis, and we have also compared the effects of GALP with those of galanin. We have investigated, first, the effect of leptin on the release of GALP, galanin, and GnRH from hypothalamic explants in vitro; and second, the effects of GALP and galanin on the release of GnRH from hypothalamic explants. Furthermore, we have investigated the effects of GALP antiserum on leptin-stimulated GnRH release. To determine whether GALP or galanin has a direct effect on the GnRH neuron, we have examined the effect of both peptides on GnRH release from the immortalized GnRH cell line GT1–7 cells. Finally, because GALP is a ligand of the galanin receptors, we aimed to identify the galanin receptor mediating these effects on GnRH release.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Rat GALP and galantide were purchased from Bachem (UK) Ltd. (Merseyside, UK). Rat galanin was synthesized using an automated peptide synthesizer (model 6 MPS, Advanced Chemotech, Louisville, KY). Peptides were purified to homogeneity by reversed-phase HPLC on a C8 column, and molecular weight was checked by mass spectroscopy (23). Recombinant murine leptin was a gift from M. Chiesi and N. Levens from Novartis (Basel, Switzerland). Reagents for the hypothalamic explant experiments were supplied by BDH (Poole, Dorset, UK). GALP antibody was purchased from Phoenix Pharmaceuticals (Belmont, CA).

Animals
Adult male Wistar rats, weighing 200–250 g, were maintained in cages of five, under controlled temperature (21–23 C) and light (12-h light, 12-h dark cycle; lights on at 0700 h). Animals had ad libitum access to food (RM1 diet SDS, Witham, UK.) and water unless otherwise stated. Adult male C57BCK6/CBA mice (20–25 g) were maintained as above. All animal procedures undertaken were approved by the British Home Office Animals (Scientific Procedures) Act, 1986.

Static incubation of hypothalamic explants
The static incubation system was used as previously described (24). Rats were killed by decapitation. The upper skull was removed and the brain dissected free of dura; the frontal lobes were then lifted, and the exposed optic nerves were cut. The whole brain was then reflected. The brain was mounted with ventral surface uppermost and placed in a vibrating microtome (EnergyBeam Sciences Inc., Agawam, MA). A 1.7-mm explant was taken from the basal hypothalamus. Extrahypothalamic tissue was removed by dissection through the mamillary bodies posteriorly and laterally through the Circle of Willis. The explant includes the MPOA. The explant was incubated in artificial cerebrospinal fluid (aCSF) (20 nM NaHCO3, 126 mM Nacl, 0.09 mM Na2HPO4, 6 mM KCl, 1.4 mM CaCl2, 0.09 mM MgSO4, 5 mM glucose, 0.18 mg/ml ascorbic acid, and 100 µg/ml aprotinin), equilibrated with 95% O2 and 5% CO2 at 37 C. After an initial 2-h equilibration period, the hypothalami were incubated for 45 min in aCSF (basal period) before being challenged with peptide for 45 min. At the end of the study, the viability of the tissue was verified by a 45-min exposure to 56 mM KCl; isotonicity was maintained by substituting K+ for Na+. Explants were excluded from analysis if release during the K+ exposure was less than basal release (<10% of explants excluded). The aCSF collected at the end of each period was frozen at -20 C until measurement of peptide-IR by RIA.

GT1–7 cell culture and secretion experiments
The immortalized hypothalamic GnRH-producing neurone subclone GT1–7 cells (25) were maintained at 37 C in 5% CO2 in DMEM with 4.5 g/liter glucose, 10% fetal bovine serum, penicillin (100 IU/ml), and streptomycin (100 µg/ml). GT1–7 cells were plated on poly-L-lysine-coated 48-well plates. After growing for 2–3 d to confluence, cells were washed twice in DMEM with 4.5 g/liter glucose, penicillin (100 IU/ml), streptomycin (100 µg/ml), and 0.1% BSA. The cells were then preincubated for 2 h in serum-free medium. Thereafter, the medium was discarded, and the cells were incubated in 500 µl of serum-free medium plus the appropriate test substance [GALP/galanin/galantide (0.01–100 nM) or 56 mM KCl]. The cells were incubated with the test substances for 60 min, after which the medium was removed and frozen at -20 C until measurement of GnRH-IR by RIA. Protein content per well was assayed using the Pierce bicinchoninic acid (BCA) protein assay (Sigma, Poole, Dorset, UK). Protein content was consistent between wells (<10% variation).

RIAs
GnRH-IR levels were measured using reagents and methods kindly provided by H. M. Fraser, Medical Research Centre Reproductive Biology Unit, Edinburgh (26). The intraassay and interassay variations were 8 and 12%, respectively, and the sensitivity was 0.25 fmol/tube. Rat GALP-IR was measured using a commercially available RIA from Phoenix Pharmaceuticals, CA. The intraassay and interassay variations were 4 and 15%, respectively, and the sensitivity was 1 pg/tube (0.16 fmol/tube). An in-house rat galanin RIA was used to measure galanin immunoreactivity, as previously described (27). Briefly, galanin antiserum raised in rabbits to unconjugated synthetic rat galanin was used at a final dilution of 1:320,000. The tracer prepared by the iodogen method had a specific activity of 48 Bq/fmol. The intraassay and interassay variations were less that 15%, and the sensitivity was 2 fmol/tube.

RT-PCR analysis
Generation of total RNA.
Total RNA was extracted from GT1–7 cells, mouse hypothalami, and rat hypothalami using Tri-reagent (Helena Biosciences, Sunderland, Tyne and Wear, UK) according to the manufacturer’s protocol. Hypothalami were harvested from male C57BL6/CBA mice (20–25 g) and male Wistar rats (200–250 g). The tissue removed was bordered rostrally by the anterior edge of the optic chiasma, laterally by the hypothalamic fissures, and caudally by the mamillary bodies.

RT-PCR.
RT-PCR was performed as previously described (28). Briefly, total RNA was reverse transcribed using avian myoblastoma virus reverse transcriptase (RT) (Promega, Southampton, UK) in a reaction primed using oligo(dT) (12, 13, 14, 15, 16, 17, 18). The RT reaction was subjected to PCR using primers obtained from the published sequence of the rat GAL R1, GAL R2, and GAL R3 (accession nos. U33193, AF010318, and AF079844, respectively). The primers were synthesized by Oswel DNA services (Southampton, UK). The primers used for GAL R1 were agtcggatccccaaggttctcaatcatctgc and agtcgaattccggggtatctattcggttct corresponding to positions 659–679 and 997-1016 of the GenBank nucleotide sequence; for GAL R2, the primers were agtcggatcccacacctcgaaacgcgctggc and agtcgaattcgtgcagttgggaagtgcggg corresponding to sequence positions 432–451 and 1086–1105; and for GAL R3, the primers were agtcggatccctcatcttcctgttgggcatg and agtcgaattcgtagatgagcagatgtaccg, corresponding to sequence positions 76–96 and 289–309. Using these primers, amplified fragments of 357 bp for GAL R1, 673 bp for GALR2, and 233 bp for GAL R3 would be expected. PCR cycles were as follows: 95 C for 1 min, 55 C for 1 min (decreasing by 2 C each cycle for 5 cycles), then 95 C for 1 min, 50 C for 1 min (decreasing by 1 C each cycle for 8 cycles) then 95 C for 1 min, 45 C for 45 sec, 72 C for 1 min for 12 cycles. To check for possible artifacts generated by amplification of remnants of genomic DNA, control RT-PCRs were performed and treated in an identical way but without RT added to the RT-reaction mixture. Amplified fragments were resolved by 1% agarose gel electrophoresis and visualized by ethidium bromide staining.

Statistical analysis
Results are shown as mean values ± SEM. Data from the hypothalamic explant experiments was analyzed by paired t test between basal and treatment groups. Pairwise comparison between groups, where appropriate, was performed using a one-way ANOVA with a Student-Newman-Keuls post hoc test. For the secretion experiments, the data were analyzed using a one-way ANOVA with a Dunnet’s post hoc analysis, to compare the different groups with the basal control. In all cases, the level of statistical significance was set at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Study 1: a dose-response curve for the effect of leptin (1, 10, and 100 nM) on GALP release from hypothalamic explants harvested from fed animals
Hypothalamic explants, harvested from ad libitum-fed animals, were exposed to leptin (1, 10, and 100 nM) for 45 min. All doses of leptin significantly increased GALP release from hypothalamic explants, when compared with basal release [GALP release: basal 124.3 ± 10 fmol/explant, GALP (1 nM) 139.4 ± 23 fmol/explant, P < 0.05; GALP (10 nM) 149.6 ± 14 fmol/explant, P < 0.05; GALP (100 nM) 161.0 ± 26 fmol/explant, P < 0.05, n = 9–11] (Fig. 1Go).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. A dose-response curve for the effect of leptin (1, 10, and 100 nM) on GALP release from hypothalamic explants. *, P < 0.05, basal vs. GALP (dose).

 
Study 2: effect of leptin (100 nM) on galanin and GnRH release from hypothalamic explants harvested from fed animals
The top dose of leptin was used to examine the effect of leptin on galanin and GnRH release from hypothalamic explants harvested from fed animals. Leptin (100 nM) had no significant effect on the release of galanin [galanin release: basal 274.0 ± 26.6 fmol/explant, leptin 288.2 ± 30.9 fmol/explant, P = not significant (n.s), n = 20, data not shown]. As expected 100 nM leptin significantly increased the release of GnRH, when compared with basal release (GnRH release: basal 8.6 ± 1.1 fmol/explant vs. leptin 12.8 ± 2.2 fmol/explant, P < 0.01, n = 22).

Study 3: the effect of GALP and galanin on the release of GnRH from hypothalamic explants harvested from fed animals
Hypothalamic explants, harvested from ad libitum-fed animals, were exposed to GALP (100 nM) for 45 min. GALP treatment significantly increased the release of GnRH, when compared with basal release (GnRH release: basal 8.1 ± 2.3 fmol/explant, GALP 18.2 ± 2.4, P < 0.01, n = 14) (Fig. 2AGo). Exposure to galanin (100 nM) also significantly increased GnRH release (GnRH release: basal 9.1 ± 1.4 fmol/explant, galanin 14.0 ± 1.4 fmol/explant, P < 0.01, n = 10) (Fig. 2BGo).



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 2. A, The effect of GALP (100 nM) on GnRH release from hypothalamic explants (**, P < 0.01, GALP vs. basal). B, The effect of galanin (100 nM) on GnRH release from hypothalamic explants (**, P < 0.01, galanin vs. basal).

 
Study 4: blocking effect of GALP antibody on leptin-induced GnRH release from hypothalami harvested from 24-h-fasted animals
To investigate the role of GALP in mediating the effects of leptin on GnRH release, we examined the ability of GALP antiserum to block leptin-induced GnRH release. In this study, hypothalami were harvested from animals which had been fasted for 24 h. Leptin (100 nM), GALP antiserum (1:300), or both leptin (100 nM) and GALP antiserum (1:300) were applied to hypothalamic explants harvested from 24-h-fasted animals. Leptin significantly increased GnRH release from hypothalami harvested from 24-h-fasted rats. GALP antiserum blocked leptin-stimulated GnRH release. GALP antiserum alone did not alter GnRH release (GnRH release: basal 9.0 ± 0.6 fmol/explant, leptin 13.1 ± 1.2 fmol/explant, P < 0.001; leptin + GALP antiserum 9.6 ± 0.9 fmol/explant, P = n.s; GALP antiserum 9.3 ± 1.1 fmol/explant, P = n.s; n = 20–22 per group) (Fig. 3Go). GnRH release during leptin and GALP antiserum treatment were significantly reduced, in comparison with GnRH release during leptin treatment (P < 0.05).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 3. The effect of leptin (100 nM), leptin (100 nM) and GALP antiserum (1:300 dilution), and GALP antiserum (1:300 dilution) alone on GnRH release from hypothalami harvested from 24-h-fasted rats (**, P < 0.001, leptin vs. basal; #, P < 0.05, leptin vs. leptin + GALP antiserum). ab, Antibody.

 
Study 5: the effect of galanin receptor antagonist galantide on GALP-induced GnRH release from hypothalamic explants harvested from fed animals
To investigate the role of galanin receptors in mediating the effects of GALP on GnRH release, we examined the ability of the galanin receptor antagonist, galantide, to block GALP-stimulated GnRH release. GALP (100 nM), galantide (100 nM), or both were applied to hypothalamic explants harvested from ad libitum-fed animals. GALP significantly increased GnRH release from hypothalamic explants. Galantide alone did not alter GnRH release, but it did attenuate the GALP-stimulated GnRH release (GnRH release: basal 7.6 ± 0.7 fmol/explant, GALP 12.5 ± 1.5 fmol/explant, P < 0.001; galantide 8.0 ± 1.1 fmol/explant, P = n.s; GALP + galantide 10.0 ± 1.3 fmol/explant, P = n.s; n = 12–14 per group) (Fig. 4Go).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. The effect of GALP (100 nM), both GALP (100 nM) and galantide (100 nM), and galantide (100 nM) alone on GnRH release from hypothalamic explants (**, P < 0.001, GALP vs. basal).

 
Study 6: the effect of GALP and galanin (0.01–100 nM) on the release of GnRH from GT1–7 cells
Exposure of GT1–7 cells to GALP resulted in dose-dependent stimulation of GnRH release. At concentrations of 0.1, 1, 10, and 100 nM, GALP significantly increased GnRH release, when compared with basal levels. Basal release was 33.0 ± 0.59 fmol/ml/h, and GALP (10 nM) increased this to a maximum of 199% of basal (65.8 ± 3.8 fmol/ml·h, P < 0.001, n = 16) (Fig. 5Go). Exposure of GT1–7 cells to galanin had no significant effect on the release of GnRH at any of the concentrations tested [basal 30.7 ± 2.3 fmol/well, galanin (100 nM) 29.3 ± 3.1 fmol/ml/h, P = n.s, n = 16] (Fig. 6Go). The positive control (56 mM KCl) significantly increased GnRH release in both studies.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 5. The effect of GALP (0.01–100 nM) on the release of GnRH from GT1–7 cells. (*, P < 0.001 vs. basal).

 


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 6. The effect of galanin (0.01–100 nM) on the release of GnRH from GT1–7 cells. (*, P < 0.0001 vs. basal).

 
Study 7: the effect of galanin antagonist galantide on GALP-induced GnRH release from GT1–7 cells
Exposure of GT1–7 cells to galantide (0.1–100 nM) alone had no significant effect on the release of GnRH at any of the concentrations tested (basal 33.1 ± 5.1 fmol/ml·h vs. galantide (100 nM) 41.9 ± 9, P = n.s, n = 12) (Fig. 7Go). Coadministration of the galanin antagonist galantide (100 nM) with GALP (10 nM) did not diminish the effect of GALP on GnRH release [basal 28.0 ± 3.3 fmol/well, GALP (10 nM) 55.8 ± 3.0 fmol/well, P < 0.001 vs. basal; GALP (10 nM) + galantide (100 nM) 58.7 ± 3.6 fmol/well, P < 0.001 vs. basal, n = 16] (Fig. 8Go).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 7. The effect of galanin antagonist galantide (0.1–100 nM) on GnRH release from GT1–7 cells. (*, P < 0.0001 vs. basal).

 


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 8. The effect of galanin antagonist galantide (100 nM) on GALP (10 nM)-induced GnRH release from GT1–7 cells. (*, P < 0.001 vs. basal).

 
Study 8: galanin receptor expression studies
The expression of GAL R1, R2, and R3 in GT1–7 cells was examined in comparison with galanin receptor expression in the mouse and rat hypothalamus. The primers designed for the galanin receptor cDNAs amplified the fragments of the expected size for GAL R1 (357 bp), GAL R2 (673 bp), and GALR3 (233 bp) with mouse hypothalamic RNA (Fig. 9Go) and rat hypothalamic RNA (data not shown). However, no amplified fragments were generated with GT1–7 RNA, indicating that the GT1–7 cells did not express mRNA for either GAL R1, R2, or GAL R3 (Fig. 9Go).



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 9. Galanin receptor (Gal R) mRNA expression in the GT1–7 cell line as determined by RT-PCR. M, 1-kb ladder; H, mouse hypothalamic RNA; G+, GT1–7 RNA + RT; G-, GT1–7 RNA - RT; W, water. The size of the expected PCR product for GAL R1 was 357 bp; for GAL R2, it was 673 bp; and for GAL R3, 233 bp.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The reproductive system of the mammal is highly sensitive to the availability of food. Leptin has been proposed to serve as a metabolic gate to the reproductive system to indicate that sufficient nutritional stores are available for reproduction. Leptin signals, via hypothalamic arcuate, target neurons, which (in turn) initiate neuroendocrine changes. Using a static hypothalamic explant system, we confirmed that leptin stimulates the release of GnRH in vitro from hypothalamic tissue from male rats (29). The leptin receptor has not been detected on GnRH neurons in vivo (10), suggesting that leptin’s actions on GnRH release are not direct. However, the hypothalamic mediators of this action remain to be elucidated.

In these studies, we demonstrate that in vitro leptin significantly stimulates the release of GALP peptide from hypothalamic explants harvested from male rats in a dose-dependent manner. The observation that GALP peptide is positively regulated by leptin is supported by previous studies demonstrating that GALP mRNA expression is up-regulated by leptin. ICV injection of leptin for 7 d in ob/ob mice significantly increased GALP expression, when compared with vehicle (15); twice daily peripheral injections of leptin administered to 48-h fasted ovariectomized female rats for 2 d significantly increased GALP mRNA (13); and GALP mRNA is reduced in male Zucker obese (fa/fa) rats (rats with defective leptin signaling), compared with age-matched Zucker lean (Fa/fa or Fa/Fa) rats (30). The literature therefore suggests that chronic manipulation of leptin alters GALP expression in the ARC; however, this is the first demonstration that GALP peptide release can be acutely regulated by leptin.

We have also found that exposure of hypothalamic explants to GALP dramatically stimulates the release of GnRH. This is the first direct demonstration that GALP increases hypothalamic GnRH release in vitro, and it suggests that the increase in LH seen after ICV GALP administration is attributable to the activation of hypothalamic GnRH neurons (16). In addition to this, we have demonstrated that GALP antiserum blocked leptin-induced GnRH release from hypothalamic explants. This finding provides support for the hypothesis that GALP may mediate the actions of leptin on the HPG axis. The following model can therefore be proposed. In freely fed rats, the level of circulating leptin is high. Leptin interacts with leptin receptors found on GALP neurons in the ARC, resulting in the release of GALP. Consequently, GALP stimulates the release of GnRH and, thus, further-downstream components of the HPG axis. Under conditions of prolonged food restriction, however, the low levels of circulating leptin may be insufficient to stimulate the release of GALP. This would remove a stimulatory input on the HPG axis and may be one mechanism through which the HPG axis is suppressed during fasting.

Recent studies have indicated that the main physiological role of leptin is to mediate the metabolic and endocrine responses necessary to adapt to changes in nutritional status (31). Thus, leptin is involved in the regulation of the thyroid, reproductive, growth, and adrenal axes in addition to regulating feeding behavior. The mechanism through which leptin regulates food intake and energy expenditure is well documented (32, 33, 34). Two populations of neurons within the ARC, one expressing the orexigenic peptides neuropeptide Y and agouti-related protein and another expressing the anorexic peptides {alpha}-melanocyte stimulating hormone and cocaine and amphetamine-regulated transcript, are believed to be the principal mediators of leptin’s effects on energy homeostasis. However, the mechanisms through which leptin controls the reproductive, growth, and stress axes have not been investigated as thoroughly. The data presented here identifies a new neuronal population in the ARC, which may mediate the effects of leptin on the reproductive axis. These findings develop our understanding of how the integration of nutritional status and fertility is achieved within the hypothalamus and may help to distinguish between the complex effects of leptin on the neuroendocrine axes and metabolism.

In contrast to GALP, leptin had no significant effect on the release of galanin from hypothalamic explants. The effect of leptin on galanin expression seems to be dependent on the region of the hypothalamus examined. Galanin is found in several hypothalamic nuclei, including the ARC and dorsomedial nucleus (DMN) (35), areas with high expression of the leptin receptor. However, no colocalization between galanin IR neurons and the leptin receptor has been observed (10). In the ob/ob mouse, treatment with leptin significantly decreased galanin expression in the periventricular nucleus but had no effect in the other nuclei examined, including the ARC and DMN (36). In the obese Zucker rat, galanin expression in the PVN is double that of age-matched lean controls. However, expression in the median eminence is significantly reduced, and there are no changes in the ARC or DMN (37). These studies indicate that the regulation of galanin expression by leptin is complex. This may be attributable, in part, to the widespread distribution of galanin in the hypothalamus and the diverse functions attributed to it (35).

We also found that galanin stimulated the release of GnRH from hypothalamic explants. This observation is consistent with previous studies in which galanin was found to stimulate GnRH release from arcuate-median eminence fragments from both male rats and ovarian steroid-primed ovariectomized female rats (21, 38). The median eminence contains the highest concentration of galanin peptide in the hypothalamus, and it has been hypothesized that galanin may act presynaptically to potentiate the release of GnRH from nerve terminals in the median eminence (35). The finding that both GALP and galanin stimulated GnRH release suggested that this effect may be mediated by a galanin receptor. Therefore, we examined the ability of the galanin receptor antagonist, galantide, to block GALP-induced GnRH release. Galantide is a chimeric peptide that binds with high affinity to all three galanin receptors and has been shown to block the actions of galanin on the HPG axis (21, 39, 40). An equimolar concentration of galantide completely blocks galanin-stimulated GnRH release from arcuate-median eminence fragments from steroid-primed rats (21). In these studies, galantide had no effect on basal release, but an equimolar concentration was able to reduce GALP-stimulated GnRH release from hypothalamic explants. Taken together with the finding that galanin stimulates GnRH from hypothalamic explants, this data suggests that GALP-stimulated GnRH release may be mediated, at least in part, via the galanin receptors. However, GALP-induced GnRH release was not entirely abolished by galantide. This observation suggests that galanin receptor-independent pathways may also contribute to GALP’s effects on GnRH.

To further investigate the mechanism through which GALP and galanin stimulate the release of GnRH, we used the GnRH immortalized cell line GT1–7 cells. GT1–7 cells exhibit many of the known physiological characteristics of GnRH neurons in situ; they respond appropriately to depolarization, release GnRH in a pulsatile manner (41), and have been shown to respond to known GnRH secretogogues such as neuropeptide Y and glucagon-like peptide 1 (26, 42). In whole hypothalamic tissue, both GALP and galanin stimulated the release of GnRH. However, only GALP stimulated GnRH release from GT1–7 cells. Moreover, the addition of galantide did not attenuate GALP-induced GnRH release from GT1–7 cells. This suggests that GALP-induced GnRH release from GT1–7 cells may not be mediated by a cloned galanin receptor. In keeping with this, RT-PCR analysis failed to detect the presence of transcript for any of the cloned galanin receptors in GT1–7 cells. To date, no significant colocalization between the galanin receptors and GnRH neurons has been reported, despite all three receptors being expressed in the MPOA (19, 20, 43). However, further studies are required to establish definitively whether GnRH and galanin receptors colocalize in vivo.

Taken together, these studies indicate that in vitro GALP may stimulate GnRH through two distinct mechanisms: first, through an indirect action mediated by a galanin receptor; and second, through direct activation of GnRH neurons, possibly via a novel receptor. It should be noted, however, that the different mechanisms observed in hypothalamic explants and GT1–7 cells could be explained by differences between GnRH neurons from animal tissue and cultured GnRH neurons. It is possible that the lack of input from afferent neurons and supporting glia may alter the pattern of receptor expression in GT1–7 cells. In vivo colocalization studies would be of great interest. From the experiments carried out in this investigation, it is difficult to identify whether the action of GALP on GnRH release occurs at the level of the cell body or at the terminals in the median eminence. It would be interesting to examine the effect of GALP on the release of GnRH from median eminence explants.

The absence of transcript for the known galanin receptors, in addition to the observation that galanin has no effect on GnRH release from GT1–7 cells, suggests that GALP’s direct effects on GnRH release in GT1–7 cells may be mediated through a novel receptor. The presence of a specific GALP receptor has been suggested previously because of the differential effects of GALP and galanin on food intake (44), LH release (16), and the differential effects of galanin and GALP on c-fos induction (45). Within the GALP sequence, there are two highly conserved and unique amino acid sequences not shared with galanin (GALP 1–8 and 38–54). It is possible that these sequences may dictate its interaction with a unique GALP receptor and mediate its physiological effects. Further work is required to identify the receptor mediating the effects of GALP in GT1–7 cells. A summary of the proposed interactions among leptin, GALP, and GnRH in the regulation of the reproductive axis is illustrated in Fig. 10Go.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 10. A proposed model for the interaction among leptin, GALP, and GnRH in the regulation of the neuroendocrine reproductive axis. Circulating leptin passes across the blood-brain barrier into the ARC of the hypothalamus and binds to the leptin receptor (Ob-R) expressed on GALP neurons. This stimulates the release of GALP, which acts on GnRH neurons through two mechanisms: first, through a direct activation of GnRH neurons via a novel receptor; and second, through an indirect pathway that involves a galanin receptor (Gal-R). The net result is an increase in GnRH release.

 
In summary, the in vitro studies carried out in this investigation suggest that GALP neurons in the ARC of the hypothalamus are stimulated by leptin, resulting in increased GALP release. GALP stimulates the release of GnRH from both hypothalamic explants and GT1–7 cells. Furthermore, GALP antiserum blocks leptin-induced GnRH release from hypothalamic explants, suggesting that GALP may mediate leptin’s actions on GnRH. Studies with the galanin antagonist, galantide, suggest that GALP may stimulate GnRH release through a dual mechanism. Galantide attenuates GALP-stimulated GnRH release from explants, suggesting that this is mediated, in part, by galanin receptors. However, galantide fails to block GALP-stimulated release from GT1–7 cells, which also lack GAL R1, R2, or R3 mRNA. These data suggest that GALP may play an important role as an intermediary neuroendocrine signal between leptin and the HPG axis and that this action may be mediated by a novel receptor.


    Footnotes
 
This work was supported by an Medical Research Council (MRC) program grant, an MRC studentship for A.S., and a Biotechnology and Biological Sciences Research Council-GlaxoSmithKline case studentship for P.J.

Abbreviations: aCSF, Artificial cerebrospinal fluid; ARC, arcuate nucleus; DMN, dorsomedial nucleus; GALP, galanin-like peptide; HPG, hypothalamo-pituitary-gonadal; ICV, intracerebroventricular; IR, immunoreactive; MPOA, medial preoptic area; n.s, not significant; RT, reverse transcriptase.

Received July 14, 2003.

Accepted for publication October 16, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ahima RS, Prabakaran D, Mantzoros C, Qu D, Lowell B, Maratos-Flier E, Flier JS 1996 Role of leptin in the neuroendocrine response to fasting. Nature 382:250–252[CrossRef][Medline]
  2. Swerdloff RS, Batt RA, Bray GA 1976 Reproductive hormonal function in the genetically obese (ob/ob) mouse. Endocrinology 98:1359–1364[Abstract/Free Full Text]
  3. Farooqi IS, Matarese G, Lord GM, Keogh JM, Lawrence E, Agwu C, Sanna V, Jebb SA, Perna F, Fontana S, Lechler RI, DePaoli AM, O’Rahilly S 2002 Beneficial effects of leptin on obesity, T cell hyporesponsiveness, and neuroendocrine/metabolic dysfunction of human congenital leptin deficiency. J Clin Invest 110:1093–1103[CrossRef][Medline]
  4. Chehab FF, Lim ME, Lu R 1996 Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat Genet 12:318–320[CrossRef][Medline]
  5. Boden G, Chen X, Mozzoli M, Ryan I 1996 Effect of fasting on serum leptin in normal human subjects. J Clin Endocrinol Metab 81:3419–3423[Abstract]
  6. Hardie LJ, Rayner DV, Holmes S, Trayhurn P 1996 Circulating leptin levels are modulated by fasting, cold exposure and insulin administration in lean but not Zucker (fa/fa) rats as measured by ELISA. Biochem Biophys Res Commun 223:660–665[CrossRef][Medline]
  7. Cagampang FR, Maeda K, Yokoyama A, Ota K 1990 Effect of food deprivation on the pulsatile LH release in the cycling and ovariectomized female rat. Horm Metab Res 22:269–272[Medline]
  8. Cameron JL, Weltzin TE, McConaha C, Helmreich DL, Kaye WH 1991 Slowing of pulsatile luteinizing hormone secretion in men after forty-eight hours of fasting. J Clin Endocrinol Metab 73:35–41[Abstract/Free Full Text]
  9. Chan JL, Heist K, DePaoli AM, Veldhuis JD, Mantzoros CS 2003 The role of falling leptin levels in the neuroendocrine and metabolic adaptation to short-term starvation in healthy men. J Clin Invest 111:1409–1421[CrossRef][Medline]
  10. Hakansson ML, Brown H, Ghilardi N, Skoda RC, Meister B 1998 Leptin receptor immunoreactivity in chemically defined target neurons of the hypothalamus. J Neurosci 18:559–572[Abstract/Free Full Text]
  11. Ohtaki T, Kumano S, Ishibashi Y, Ogi K, Matsui H, Harada M, Kitada C, Kurokawa T, Onda H, Fujino M 1999 Isolation and cDNA cloning of a novel galanin-like peptide (GALP) from porcine hypothalamus. J Biol Chem 274:37041–37045[Abstract/Free Full Text]
  12. Takatsu Y, Matsumoto H, Ohtaki T, Kumano S, Kitada C, Onda H, Nishimura O, Fujino M 2001 Distribution of galanin-like peptide in the rat brain. Endocrinology 142:1626–1634[Abstract/Free Full Text]
  13. Jureus A, Cunningham MJ, McClain ME, Clifton DK, Steiner RA 2000 Galanin-like peptide (GALP) is a target for regulation by leptin in the hypothalamus of the rat. Endocrinology 141:2703–2706[Abstract/Free Full Text]
  14. Larm JA, Gundlach AL 2000 Galanin-like peptide (GALP) mRNA expression is restricted to arcuate nucleus of hypothalamus in adult male rat brain. Neuroendocrinology 72:67–71[CrossRef][Medline]
  15. Jureus A, Cunningham MJ, Li D, Johnson LL, Krasnow SM, Teklemichael DN, Clifton DK, Steiner RA 2001 Distribution and regulation of galanin-like peptide (GALP) in the hypothalamus of the mouse. Endocrinology 142:5140–5144[Abstract/Free Full Text]
  16. Matsumoto H, Noguchi J, Takatsu Y, Horikoshi Y, Kumano S, Ohtaki T, Kitada C, Itoh T, Onda H, Nishimura O, Fujino M 2001 Stimulation effect of galanin-like peptide (GALP) on luteinizing hormone-releasing hormone-mediated luteinizing hormone (LH) secretion in male rats. Endocrinology 142:3693–3696[Abstract/Free Full Text]
  17. Krasnow SM, Fraley GS, Schuh SM, Baumgartner JW, Clifton DK, Steiner RA 2003 A role for galanin-like peptide in the integration of feeding, body weight regulation, and reproduction in the mouse. Endocrinology 144:813–822[Abstract/Free Full Text]
  18. Habert-Ortoli E, Amiranoff B, Loquet I, Laburthe M, Mayaux JF 1994 Molecular cloning of a functional human galanin receptor. Proc Natl Acad Sci USA 91:9780–9783[Abstract/Free Full Text]
  19. Mitchell V, Bouret S, Howard AD, Beauvillain JC 1999 Expression of the galanin receptor subtype Gal-R2 mRNA in the rat hypothalamus. J Chem Neuroanat 16:265–277[CrossRef][Medline]
  20. Mennicken F, Hoffert C, Pelletier M, Ahmad S, O’Donnell D 2002 Restricted distribution of galanin receptor 3 (GalR3) mRNA in the adult rat central nervous system. J Chem Neuroanat 24:257–268[CrossRef][Medline]
  21. Sahu A, Xu B, Kalra SP 1994 Role of galanin in stimulation of pituitary luteinizing hormone secretion as revealed by a specific receptor antagonist, galantide. Endocrinology 134:529–536[Abstract/Free Full Text]
  22. Sahu A, Crowley WR, Tatemoto K, Balasubramaniam A, Kalra SP 1987 Effects of neuropeptide Y, NPY analog (norleucine4-NPY), galanin and neuropeptide K on LH release in ovariectomized (ovx) and ovx estrogen, progesterone-treated rats. Peptides 8:921–926[CrossRef][Medline]
  23. Todd JF, Small CJ, Akinsanya KO, Stanley SA, Smith DM, Bloom SR 1998 Galanin is a paracrine inhibitor of gonadotroph function in the female rat. Endocrinology 139:4222–4229[Abstract/Free Full Text]
  24. Stanley SA, Small CJ, Kim MS, Heath MM, Seal LJ, Russell SH, Ghatei MA, Bloom SR 1999 Agouti related peptide (Agrp) stimulates the hypothalamo pituitary gonadal axis in vivo, in vitro in male rats. Endocrinology 140:5459–5462[Abstract/Free Full Text]
  25. Mellon PL, Windle JJ, Goldsmith PC, Padula CA, Roberts JL, Weiner RI 1990 Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5:1–10[CrossRef][Medline]
  26. Beak SA, Heath MM, Small CJ, Morgan DG, Ghatei MA, Taylor AD, Buckingham JC, Bloom SR, Smith DM 1998 Glucagon-like peptide-1 stimulates luteinizing hormone-releasing hormone secretion in a rodent hypothalamic neuronal cell line. J Clin Invest 101:1334–1341[Medline]
  27. Wang ZL, Kulkarni RN, Wang RM, Smith DM, Ghatei MA, Byfield PG, Bennet WM, Bloom SR 1997 Possible evidence for endogenous production of a novel galanin-like peptide. J Clin Invest 100:189–196[Medline]
  28. Bates SH, Gardiner JV, Jones RB, Bloom SR, Bailey CJ 2002 Acute stimulation of glucose uptake by leptin in l6 muscle cells. Horm Metab Res 34:111–115[Medline]
  29. Yu WH, Kimura M, Walczewska A, Karanth S, McCann SM 1997 Role of leptin in hypothalamic-pituitary function. Proc Natl Acad Sci USA 94:1023–1028[Abstract/Free Full Text]
  30. Kumano S, Matsumoto H, Takatsu Y, Noguchi J, Kitada C, Ohtaki T 2003 Changes in hypothalamic expression levels of galanin-like peptide in rat and mouse models support that it is a leptin-target peptide. Endocrinology 144:2634–2643[Abstract/Free Full Text]
  31. Ahima RS, Saper CB, Flier JS, Elmquist JK 2000 Leptin regulation of neuroendocrine systems. Front Neuroendocrinol 21:263–307[CrossRef][Medline]
  32. Kim MS, Small CJ, Stanley SA, Morgan DG, Seal LJ, Kong WM, Edwards CM, Abusnana S, Sunter D, Ghatei MA, Bloom SR 2000 The central melanocortin system affects the hypothalamo-pituitary thyroid axis and may mediate the effect of leptin. J Clin Invest 105:1005–1011[Medline]
  33. Seeley RJ, Yagaloff KA, Fisher SL, Burn P, Thiele TE, van Dijk G, Baskin DG, Schwartz MW 1997 Melanocortin receptors in leptin effects. Nature 390:349[Medline]
  34. Wang Q, Bing C, Al Barazanji K, Mossakowaska DE, Wang XM, McBay DL, Neville WA, Taddayon M, Pickavance L, Dryden S, Thomas ME, McHale MT, Gloyer IS, Wilson S, Buckingham R, Arch JR, Trayhurn P, Williams G 1997 Interactions between leptin and hypothalamic neuropeptide Y neurons in the control of food intake and energy homeostasis in the rat. Diabetes 46:335–341[Abstract]
  35. Merchenthaler I, Lopez FJ, Negro-Vilar A 1993 Anatomy and physiology of central galanin-containing pathways. Prog Neurobiol 40:711–769[CrossRef][Medline]
  36. Cheung CC, Hohmann JG, Clifton DK, Steiner RA 2001 Distribution of galanin messenger RNA-expressing cells in murine brain and their regulation by leptin in regions of the hypothalamus. Neuroscience 103:423–432[CrossRef][Medline]
  37. Beck B, Burlet A, Nicolas JP, Burlet C 1993 Galanin in the hypothalamus of fed and fasted lean and obese Zucker rats. Brain Res 623:124–130[CrossRef][Medline]
  38. Lopez FJ, Merchenthaler I, Ching M, Wisniewski MG, Negro-Vilar A 1991 Galanin: a hypothalamic-hypophysiotropic hormone modulating reproductive functions. Proc Natl Acad Sci USA 88:4508–4512[Abstract/Free Full Text]
  39. Bartfai T, Bedecs K, Land T, Langel U, Bertorelli R, Girotti P, Consolo S, Xu XJ, Wiesenfeld-Hallin Z, Nilsson S 1991 M-15: high-affinity chimeric peptide that blocks the neuronal actions of galanin in the hippocampus, locus coeruleus, and spinal cord. Proc Natl Acad Sci USA 88:10961–10965[Abstract/Free Full Text]
  40. Floren A, Land T, Langel U 2000 Galanin receptor subtypes and ligand binding. Neuropeptides 34:331–337[CrossRef][Medline]
  41. Wetsel WC, Valenca MM, Merchenthaler I, Liposits Z, Lopez FJ, Weiner RI, Mellon PL, Negro-Vilar A 1992 Intrinsic pulsatile secretory activity of immortalized luteinizing hormone-releasing hormone-secreting neurons. Proc Natl Acad Sci USA 89:4149–4153[Abstract/Free Full Text]
  42. Besecke LM, Wolfe AM, Pierce ME, Takahashi JS, Levine JE 1994 Neuropeptide Y stimulates luteinizing hormone-releasing hormone release from superfused hypothalamic GT1–7 cells. Endocrinology 135:1621–1627[Abstract]
  43. Mitchell V, Habert-Ortoli E, Epelbaum J, Aubert JP, Beauvillain JC 1997 Semiquantitative distribution of galanin-receptor (GAL-R1) mRNA-containing cells in the male rat hypothalamus. Neuroendocrinology 66:160–172[Medline]
  44. Seth A, Stanley S, Dhillo W, Murphy K, Ghatei M, Bloom S 2003 Effects of galanin-like peptide on food intake and the hypothalamo-pituitary-thyroid axis. Neuroendocrinology 77:125–131[CrossRef][Medline]
  45. Fraley GS, Shimada I, Baumgartner JW, Clifton DK, Steiner RA 2003 Differential patterns of Fos induction in the hypothalamus of the rat following central injections of galanin-like peptide and galanin. Endocrinology 144:1143–1146[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. M. McGowan, S. A. Stanley, J. Donovan, E. L. Thompson, M. Patterson, N. M. Semjonous, J. V. Gardiner, K. G. Murphy, M. A. Ghatei, and S. R. Bloom
Relaxin-3 stimulates the hypothalamic-pituitary-gonadal axis
Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E278 - E286.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
V. M Navarro, R Fernandez-Fernandez, J. M Castellano, J Roa, A Mayen, M. L Barreiro, F Gaytan, E Aguilar, L Pinilla, C Dieguez, et al.
Advanced vaginal opening and precocious activation of the reproductive axis by KiSS-1 peptide, the endogenous ligand of GPR54
J. Physiol., December 1, 2004; 561(2): 379 - 386.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seth, A.
Right arrow Articles by Bloom, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seth, A.
Right arrow Articles by Bloom, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals