help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1406
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tortoriello, D. V.
Right arrow Articles by Chua, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tortoriello, D. V.
Right arrow Articles by Chua, S. C.
Endocrinology Vol. 145, No. 3 1238-1247
Copyright © 2004 by The Endocrine Society

Dietary-Induced Obesity and Hypothalamic Infertility in Female DBA/2J Mice

Drew V. Tortoriello, Julie McMinn and Streamson C. Chua

Division of Reproductive Endocrinology, Department of Obstetrics and Gynecology (D.V.T.), and Division of Molecular Genetics, Department of Pediatrics (J.M., S.C.C.), Columbia University, New York, New York 10032

Address all correspondence and requests for reprints to: Drew V. Tortoriello, M.D, Russ Berrie Medical Science Pavilion, Columbia University Medical Center, New York Presbyterian Hospital, 1150 St. Nicholas Avenue, Room 620, New York, New York 10032. E-mail: dt2016{at}columbia.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The effects of diet and adiposity have been implicated in disturbances of female reproductive function. In an effort to better elucidate the relationship between obesity and female fertility, we analyzed the effect of increasing dietary fat content on body composition, insulin sensitivity, and pregnancy rates in two common inbred mouse strains, DBA/2J and C57BL/6J. After 16 wk, females of both strains on the high fat diet developed glucose intolerance and insulin resistance, but only the female DBA/2J mice developed dietary-induced obesity and hyperleptinemia. The high fat diet was associated with more than a 60% decrease in natural pregnancy rates of female DBA/2J mice, whereas the fertility of female C57BL/6J mice was unaffected. Despite developing a similar degree of obesity, insulin resistance, and hyperleptinemia, male DBA/2J mice did not manifest diminished fertility. Obese female DBA/2J mice achieved normal ovulatory responses and pregnancy rates after exogenous gonadotropin stimulation, suggesting their fertility defect to be central in origin. Real-time PCR quantification of hypothalamic cDNA revealed a 100% up-regulation of neuropeptide Y and a 50% suppression of GnRH expression accompanied by a 95% attenuation of leptin receptor type B expression in obese female DBA/2J mice. These findings suggest that obesity-associated hyperleptinemia, and not insulin resistance or increased dietary fat per se, gradually induces central leptin resistance, increases hypothalamic neuropeptide Y-ergic tone, and ultimately causes hypothalamic hypogonadism. The data establish high fat-fed female DBA/2J mice as a wild-type murine model of obesity-related infertility.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CLINICAL OBSERVATION has long suggested that a powerful relationship exists between adiposity and female fertility. Frisch and McArthur (1) first postulated that a minimal amount of body fat was necessary for both the commencement and the maintenance of ovulatory cycles in young women. Indeed, the average age of menarche in the United States has dropped by nearly 3 months in only the last 30 yr, a shift largely attributed to increasing body weights (2). Moreover, excessively lean women, such as ballet dancers (3, 4), elite athletes (5, 6), and anorectics (7, 8), commonly experience delayed menarche or secondary amenorrhea, often requiring hormonal therapy. At the other extreme, excessive adiposity has also been associated with diminished fertility. Obesity complicates approximately 50% of all cases of polycystic ovarian syndrome and probably instigates or worsens the inherent ovulatory dysfunction by augmenting both the insulin resistance and the hyperandrogenemia present in this disorder (9). An association independent of polycystic ovarian syndrome, however, has also been demonstrated between truncal obesity and irregular menses (10), suggesting that obesity itself may negatively impact fertility. The Nurses’ Health Study II, which examined prospectively collected data on adiposity for 830 cases of incident ovulatory infertility and 26,125 pregnancies, revealed an increased risk for ovulatory infertility with a body mass index (BMI) below 20.0 or above 24.0 kg/m2 (11). Taken together, these findings demonstrate a U-shaped association between BMI and the relative risk for female infertility.

The phenotypes of ob/ob (12) and db/db mice (13), which consist of hyperphagia, severe obesity, insulin resistance, and hypothalamic hypogonadism, have provided perhaps the most striking evidence of the interplay between metabolic and reproductive physiology. These phenotypes, which are now known to emanate from inactivating mutations of the leptin (14, 15) and leptin receptor genes (15, 16), respectively, are not unique to mice. Indeed, mutations affecting these genes have also been reported in rats (17, 18) and humans (19, 20, 21) and yield a remarkably similar pattern of abnormalities. Moreover, leptin repletion has been demonstrated to induce weight loss and pubertal progression in both leptin-deficient mice (22, 23) and humans (24). Therefore, leptin signaling is an evolutionarily conserved requirement for the appropriate maintenance of both energy balance and reproductive capacity.

Although the robust phenotype of murine genetic leptin deficiency indicates a connection between body composition and fertility, its usefulness as a direct model for the study of common obesity is limited. It is now evident that nearly all instances of obesity in both humans and rodents do not arise from monogenic mutation but, rather, from complex interactions between genetic predisposition and the environment. Moreover, obesity is rarely associated with leptin deficiency, but instead with high circulating concentrations of leptin that positively correlate with adiposity (25, 26, 27). This suggests that beyond a certain degree of adiposity, leptin’s ability to modulate weight is compromised. This may emanate from a pathological state of acquired resistance to the physiological effects of leptin (26) or may simply reflect leptin’s range of efficacy as designed by evolution (28). In any event, it is clear that similar doses of leptin do not exert similar reductions in food intake and body weight in normal and overweight subjects. Rodents with dietary-induced obesity (DIO) fail to lose weight in response to leptin concentrations shown to be effective in lean rodents (29, 30). Although the administration of recombinant leptin has been reported to promptly induce dramatic weight loss in obese, hyperphagic humans suffering from congenital leptin deficiency (24, 31), the use of much higher leptin dosages in obese hyperleptinemic humans has proven ineffective (32, 33). Therefore, both DIO in mice and naturally occurring obesity in humans are leptin-resistant states.

As an absolute deficiency of leptin or the signaling form of its receptor is clearly associated with hypothalamic hypogonadism in both rodents and humans, is it possible that acquired leptin resistance, whose most obvious and perhaps primary manifestation is obesity, is also associated with central infertility? Limited data in genetically altered mice support this premise. For example, leptin transgenic mice, whose peripheral concentrations of leptin are approximately 10-fold higher than those in controls since birth, are initially hypophagic, lean, and fertile. However, by 20 wk of age, these mice begin to gain excessive weight and develop hypothalamic hypogonadism (34). Female dominant yellow heterozygote (Ay/+) mice, which are hyperphagic and obese due to antagonism of their hypothalamic melanocortin system by ectopic hyperexpression of agouti protein, are reproductively normal until approximately 16 wk of age, when they also manifest hypothalamic hypogonadism in the context of progressively increasing weight and leptin levels (35, 36).

The preponderance of research investigating the phenomenon of leptin resistance in nonmutant mice has focused upon its appetitive and metabolic ramifications (37, 38, 39, 40, 41, 42, 43), leaving very little light shed upon the association between hyperleptinemic obesity and infertility, especially in the female. To address this issue, we subjected two common inbred mouse strains to dietary fat manipulation in a specific attempt to develop a female model of leptin-resistant DIO and to thereafter assess the impact of this metabolic state upon fertility and hypothalamic neuropeptide expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental animals
Female DBA/2J and C57BL/6J mice were obtained from The Jackson Laboratory (Bar Harbor, ME) at approximately 3–5 wk of age. They were housed five to a cage, maintained on a 14-h light, 10-h dark cycle, and allowed ad libitum access to food and water. Upon receipt, mice of both strains were randomly assigned to receive either standardized diet D12450B-i (4% fat by weight) or D12451-i (24% fat by weight) from Research Diets (New Brunswick, NJ). All mice remained on their assigned diet until death. Mice weights were recorded at intervals of 2 wk or less. All protocols were conducted in accord with the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Columbia University animal care and use committee.

Two-hour glucose tolerance test
At 19 wk, 20 mice from each experimental group were placed into fresh cages and fasted for 12 h. Approximately 5 µl tail blood were obtained to measure blood glucose concentrations by glucometer (Glucometer Elite, Elkhart, IN) before and at 30-min intervals for 2 h after the ip injection of a filter-sterilized solution of 10% dextrose in normal saline (1 mg/kg). In addition, approximately 50 µl tail blood were obtained from fasted mice for later measurements of serum leptin and insulin.

Body composition analysis
Caloric intake in 23-wk-old female DBA/2J and C57BL/6J mice was estimated by weighing food before and after 24 h of ad libitum feeding. The D12450B-i diet contains 3.8 kcal/g, and the D12451-i diet contains 4.7 kcal/g. The body percentages of fat and lean tissues and bone mineral density were calculated from the exsanguinated carcasses of 20 23-wk-old mice from each experimental group by dual energy x-ray absorptiometry (DEXA) using a Lunar PIXImus2 machine (GE Medical Systems, Waukesha, WI).

Female natural mating experiments
At the age of 20 wk, two female mice from each experimental group were mated for 1 wk with a 14-wk-old proven fertile C57BL/6J male mouse. Twenty mice per experimental group were used. Morning postcoital vaginal plugging was checked daily during mating. Starting 1 wk after the mating period was terminated, the females were serially weighed and gently examined for signs of pregnancy while their cages were inspected daily for pups. Three independent replicates of this experiment were performed for the female DBA/2J mice, and two independent replicates were performed for the female C57BL/6J mice.

Ovarian histology
Ten female DBA/2J mice from each dietary group, which had never received any exogenous gonadotropin stimulation, were killed at 20 wk by CO2 asphyxiation and immediately had their ovaries excised and fixed in 4% paraformaldehyde. Paraffin-embedded ovarian sections were stained with hematoxylin-eosin for histological evaluation.

Male fertility
A single DBA/2J male mating experiment was performed in which 20 male DBA/2J mice at 3–5 wk of age were randomly allocated to either the 4% or 24% fat by weight diet. At 20 wk of age, each male was housed with two 12-wk-old proven fertile female C57BL/6J mice per cage for 1 wk. Starting 1 wk after the mating period was terminated, the females were serially weighed and gently examined for signs of pregnancy while their cages were inspected daily for pups.

Gonadotropin-induced ovulatory rates
In a separate experiment, 16 20-wk-old female DBA/2J from each dietary group received an ip injection of pregnant mare’s serum gonadotropin (PMSG; Sigma-Aldrich Corp., St. Louis, MO), followed 46 h later by human chorionic gonadotropin (hCG; Sigma-Aldrich Corp.) to induce superovulation. In an attempt to avoid any potentially confounding dilutional effect from body weight, the dosages of PMSG and hCG used per mouse were calculated according to weight (0.4 IU/g). Twelve hours after the hCG injection, mice were killed by CO2 asphyxiation, exsanguinated by cardiac puncture, and had their oviducts removed and flushed with normal saline for oocyte quantification under a stage microscope.

Gonadotropin-induced fertility
In a separate experiment, 20 female DBA/2J mice at 3–5 wk of age were randomly allocated to receive either the 4% or 24% fat by weight diet. At the age of 20 wk, they were treated with ip injections of 7.5 IU PMSG (Sigma-Aldrich Corp.), followed by 7.5 IU hCG (Sigma-Aldrich Corp.) 46 h later. Immediately after the second injection, each female mouse was placed into the same cage as a single fertile 15-wk-old C57BL/6J male for 24 h. The females were checked for vaginal plugging and then serially weighed and observed to document pregnancy.

Real-time PCR quantification of hypothalamic neuropeptides
At the age of 20 wk, the relative number of hypothalamic GnRH, leptin receptor type B (LEPR-B), suppressor of cytokine signaling-3 (SOCS-3), and neuropeptide Y (NPY) transcripts was quantified in 10 female DBA/2J mice from each dietary group. After CO2 asphyxiation and exsanguination, hypothalami were dissected and stored at -80 C in RNAlater (Ambion, Inc., Austin, TX). Hypothalamic total RNA was then extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions. Approximately 1 µg of each RNA sample was reverse transcribed into cDNA using the Superscript III First-Stand Synthesis System (Invitrogen) as directed. The cDNA was then subjected to real-time PCR amplification using the Dynamo SYBR Green qPCR kit in an Opticon2 thermocycler (MJ Research, Waltham, MA). A standard curve using serial 1:10 dilutions of pooled cDNA for each target transcript was generated in every PCR experiment to quantify copy numbers within any given cDNA sample. These data were then normalized to the number of hypoxanthine phosphoribosyltransferase copies calculated per given sample. The PCR conditions were 35 cycles of 94 C/55 C/72 C at 30 sec each. The forward and reverse primers for each transcript were as follows: GnRH, ctgctgactgtgtgtttgga and acctccttgcccatctcttg; NPY, actccgctctgcgacact and gttctgggggcgttttct; LEPR-B, agaacggacactctttgaagtctc and aaccatagtttaggtttgtttc; SOCS-3, ggcagtagcatttagaagggagac and tgggacagagggcattta; and hypoxanthine phosphoribosyltransferase, agcagtacagccccaaaa and tttggcttttccagtttca.

Hormone assays
Mouse blood was obtained by cardiac puncture immediately after death. Blood was centrifuged, and serum was transferred to clean vials for storage at -80 C until the day of assay. Mouse serum insulin, leptin, and hCG concentrations were quantified by ELISA, and all inter- and intraassay coefficients of variation were less than 10% (leptin and insulin ELISAs, Crystal Chem, Inc., Downers Grove, IL; hCG Immulite chemiluminescent immunoassay, Diagnostic Products Corp., Los Angeles, CA).

Statistics
A two-tailed t test was used to compare cardinal data across dietary groups in any given strain. {chi}2 analysis was used to compare pregnancy rates across dietary groups. A Spearman rank-order nonparametric test was used to calculate correlation coefficients between fertility (pregnant vs. not pregnant), body weight, and dietary fat grouping (4% vs. 24%). P < 0.05 was considered statistically significant.

Definitions
The homeostatic model assessment (HOMA), an index of insulin resistance, was calculated as (G0) x (I0)/22.5, where G0 is the fasting glucose level expressed as millimoles per liter, and I0 is the fasting insulin level expressed as picomoles per liter (44). The quantitative insulin sensitivity check index (QUICKI) was calculated as 1/[log(I0) + log(G0)], where I0 is the fasting insulin level in microinternational units per milliliter, and G0 is the fasting glucose level in milligrams per deciliter (45). BMI was calculated as weight in kilograms per naso-anal length in meters squared. DIO is defined as a body weight of more than 2 SD above the average body weight of mice fed a low fat diet (46).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Strain differences to high fat feeding in female mice
The initial body weights of all female mice at 3–5 wk of age were similar. After 8 wk however, the female DBA/2J mice on the 24% fat diet were significantly heavier than all other female mice, and their weight gain accelerated at this point (Fig. 1Go). By 23 wk of age, the female DBA/2J mice on the 24% fat diet weighed nearly 20% more than their 4% fat cohorts, sufficient for them to meet the criterion for DIO (see Materials and Methods), and their BMI was also significantly increased above controls (Table 1Go). DEXA scanning revealed the body fat percentage of DBA/2J mice on the 24% fat diet to be significantly higher than their cohorts on the 4% fat diet (mean ± SEM, 43.2 ± 2.1% vs. 29.2 ± 1.9%), whereas no appreciable differences existed with regard to bone mineral density or lean body mass (Table 1Go). Although by 23 wk the female C57BL/6J mice on the 24% fat diet did weigh significantly more than their 4% fat counterparts, this small 5% increase was not sufficient to meet the criterion for DIO, nor was it accompanied by any significant alterations in BMI or DEXA parameters (Table 1Go). At 23 wk of age, female mice of both strains were consuming approximately the same amount of kilocalories per day regardless of dietary fat content (Table 1Go).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1. Weight curve of female mice on diets containing either 4% or 24% fat by weight (n = 20/group). All values are expressed as the mean ± SEM. *, P < 0.05 for DBA/2J; **, P < 0.05 for C57BL/6J.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Body composition of 23-wk-old female mice after 4% or 24% fat diets

 
Both DBA/2J and C57BL/6J mice on the higher fat diets manifested a diminished tolerance to a 2-h ip glucose challenge compared with their counterparts on the lower fat diet (Fig. 2Go). Although none of the mice was frankly diabetic, the higher fat diet was associated with significantly higher fasting glucose and insulin levels in both strains. As indicated by the HOMA and QUICKI indexes of insulin sensitivity, the C57BL/6J mice tended to be more insulin resistant than the DBA/2J mice overall. In both mouse strains, the high fat diet was sufficient to worsen these indexes significantly (Table 2Go).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2. Two-hour glucose tolerance testing in female DBA/2J and C57BL/6J mice (n = 20/group). All values are expressed as the mean ± SEM. *, P < 0.05 for DBA/2J; **, P < 0.05 for C57BL/6J.

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Metabolic parameters of 23-wk-old female mice after 4% or 24% fat diets

 
Commensurate with their increase in body weight and fat percentage, the high fat diet induced a significant elevation in the fasting serum leptin concentrations of female DBA/2J, but not C57BL/6J, mice (Table 2Go). In females of the DBA/2J strain only, there was a significant elevation of the leptin/body weight ratio for the 24% fat-fed mice compared with their 4% fat counterparts (Table 3Go), suggesting disproportionately higher leptin levels for their given weight.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Metabolic parameters of 23-wk-old male DBA/2J mice after 4% or 24% fat diets

 
Like the females, DBA/2J males subjected to a 24% fat diet were also susceptible to DIO, insulin resistance, hyperleptinemia, and, as suggested by their significantly higher leptin/body weight ratios, leptin resistance, compared with their 4% fat reference group (Table 3Go).

High fat feeding decreases fertility in DBA/2J female mice
Approximately 70% and 25% of female DBA/2J mice on the low and high fat diets, respectively, demonstrated morning vaginal plugging within 1 wk after being introduced to the cages of fertile males. C57BL/6J female mice demonstrated a similar amount of plugging (~80%) regardless of diet (data not shown). As Fig. 3AGo demonstrates, the natural pregnancy rates of the DIO female DBA/2J mice were over 60% less than those of their lean counterparts on the 4% fat diet, whereas no diminution in pregnancy rates was noted in the female C57BL/6J mice subjected to the 24% fat diet. When fertility was used as a dichotomous variable to classify all DBA/2J females regardless of dietary grouping, significant negative correlations were found with both body weight (r = -0.402; P = 0.0125) and dietary fat grouping (r = -0.406; P = 0.0116), and the never-pregnant females were significantly heavier than the fertile group by an average difference of 3.72 g (Fig. 3BGo). Histological evaluation of ovaries from female DBA/2J mice on the 4% fat diet demonstrated multiple follicles in various stages of development (Fig. 3CGo). Ovaries from female DBA/2J mice on the 24% fat diet had dramatically less follicular activity, although the presence of old corpora lutea suggested that at one point their ovaries functioned normally (Fig. 3DGo).



View larger version (88K):
[in this window]
[in a new window]
 
FIG. 3. A, Increased dietary fat content dramatically decreases the natural pregnancy rate in female DBA/2J, but not C57BL/6J, mice after 1 wk of mating with proven fertile males (n = 20/group, with three replicates for DBA/2J mice and two replicates for C57BL/6J mice). All values are expressed as the mean ± SEM. *, P < 0.05. B, When all female DBA/2J mice that participated in the natural mating experiment were pooled regardless of diet, the never-pregnant DBA/2J females were still significantly heavier than the fertile group by a mean difference of 3.72 g (dotted line). The boxdelimits the 25th–75th percentiles, whereas the whiskersenclose the 10th–90th percentiles. The median is the continuous line within the box. Ovaries from 23-wk-old female DBA/2J mice that were subjected to a 4% fat diet manifest different stages of follicular development, including large antral follicles (C), whereas the ovaries from 23-wk-old female DBA/2J mice that were subjected to the 24% fat diet are inactive (D).

 
A mating study was carried out in 20-wk-old male DBA/2J mice to address the impact of gender on fertility in this particular strain. Even though the males on the 24% fat diet developed a similar spectrum of metabolic abnormalities (Table 3Go), it apparently had no detrimental effect on their fertility, as the number of pregnancies they produced was similar regardless of diet (Fig. 4Go).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. Increased dietary fat did not significantly diminish the number of male DBA/2J mice able to impregnate females after 1 wk of natural mating (n = 10/group).

 
Infertility in high fat-fed DBA/2J females is central in origin
To determine the etiology of the infertility manifested by the female DIO DBA/2J mice, several methods were employed. A large oocyte quantification study was conducted to ascertain whether the fertility defect of DIO DBA/2J mice was attributable to diminished ovarian reserve. In response to gonadotropin administration, the DIO female DBA/2J mice produced a similar number of oocytes compared with the lean female DBA/2J mice (Fig. 5Go). To verify that the mice were being exposed to similar circulating concentrations of gonadotropins, their serum levels of hCG 12 h after injection were quantified by ELISA and found to be statistically similar across dietary groupings (Fig. 5Go). To assess for possible defects in implantation that might be incurred by the 24% fat diet, a lower, fixed dose of gonadotropins (7.5 IU PMSG and hCG) was used to facilitate pregnancy in lean and DIO female DBA/2J mice. The resulting pregnancy rates were noted to be statistically similar (Fig. 6Go).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 5. Oocytes retrieved and serum hCG concentrations after exogenous gonadotropin administration in 20-wk-old female DBA/2J mice subjected to either 4% or 24% fat diets do not differ (n = 16/group). All values expressed as the mean ± SEM.

 


View larger version (12K):
[in this window]
[in a new window]
 
FIG. 6. Exogenous gonadotropin-assisted pregnancy rates in 20-wk-old female DBA/2J mice subjected to either 4% or 24% fat diets do not differ (n = 20/group).

 
Real-time PCR was then used to compare relative numbers of several hypothalamic transcripts involved in metabolism and reproduction. The obese DBA/2J females were noted to possess approximately 50% and 95% less hypothalamic GnRH and LEPR-B transcripts, respectively, than their lean counterparts. Moreover, the DIO females possessed approximately 100% more hypothalamic NPY transcripts. Unlike these statistically significant alterations, there was apparently no effect of increasing dietary fat upon the relative number of hypothalamic SOCS-3 transcripts (Fig. 7Go).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 7. Real-time PCR quantification of key hypothalamic transcripts suggests diminished central leptin effect in female DIO DBA/2J mice (n = 10/group). All values are expressed as the mean ± SEM. *, P < 0.05.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Leptin is an adipocyte-secreted hormone that acts within the hypothalamus to reduce body weight by increasing both satiety and energy expenditure (47). Null mutations of the leptin or leptin receptor genes generate phenotypes in both rodents and humans that consist of hyperphagia, morbid obesity, and intriguingly, infertility secondary to deficient hypothalamic GnRH secretion (12, 13, 16, 18, 19, 20, 21, 48). The administration of recombinant leptin has proven effective in reversing both the metabolic and reproductive derangements induced by these mutations (22, 23, 24, 31), establishing leptin as a long-speculated link between body fat stores and the brain’s reproductive center. Unfortunately, the finding that the extreme obesity of leptin-deficient mice is exquisitely sensitive to the weight-reducing effects of exogenous leptin renders them a poor model for the study of common, dietary-influenced obesity in humans.

Rodents with DIO are an experimental model with much more applicability to human obesity. Like human obesity, DIO is a polygenic condition reflecting the interaction of genetic predisposition with the environment. The DIO phenotype is associated with diminished sensitivity to the physiological effects of circulating leptin and insulin with concomitant increases in their circulating concentrations (30, 42). There are several etiologies that have been postulated to contribute to this leptin resistance, among which are the diminished transport of leptin across the blood-brain barrier (49, 50, 51), reduced signal transducer and activator of transcription-3 (STAT3) activation via increased SOCS-3 activity (52, 53), postreceptor resistance to leptin’s effects in specialized neurons such as those that secrete NPY, agouti-related protein, or proopiomelanocortin (54, 55), and a down-regulation of the signaling isoform of the leptin receptor in key hypothalamic neurons (56, 57, 58, 59, 60).

Recently to emerge through characterization of hyperleptinemic mutant mice (34, 35) was the fact that chronically elevated leptin levels may also be associated with central infertility, suggesting that obesity-induced leptin resistance compromises GnRH pulsatility as well as energy balance. Unfortunately, nearly all prior studies examining the phenomenon of obesity-associated leptin resistance in wild-type rodents have focused upon the impact it exerts on satiety and energy balance rather than fertility and, moreover, have studied these effects in males of the species only (30, 61, 62, 63, 64, 65). The question therefore remained as to what effect gradually acquired obesity and its attendant leptin resistance might exert on fertility in normal female mice, an important prerequisite for studying the effect of leptin resistance on fertility in obese women. To address this, we assessed the body composition, metabolic status, and fertility of two common inbred mouse strains subjected to normal and increased dietary fat content with the specific intent of assessing female fertility in a nongenetically manipulated model of leptin-resistant obesity.

We discovered that after 4 months of consuming a diet containing 24% fat by weight, female DBA/2J mice developed DIO accompanied by hyperinsulinemia, insulin resistance, and hyperleptinemia. The female DBA/2J mice on the 24% fat diet weighed approximately 6.5 g more than their 4% dietary fat counterparts, and as revealed by DEXA imaging, nearly all of this weight gain was attributable to increases in their fat compartment.

The female C57BL/6J mice subjected to the 24% fat diet were approximately 5% heavier after 4 months, but this marginal weight gain was not reflected by significant increases in fat percentages or leptin levels. This is in stark contrast to male C57BL/6J mice, whose predisposition to develop leptin-resistant DIO has been extensively described (66, 67, 68). The literature describing DIO in female C57BL/6J mice is scant and reports its development only after the utilization of a diet containing over 33% more fat on a caloric basis than the high fat diet used in this study (69). Therefore, our data suggest that a distinct female gender-specific resistance toward the development of DIO exists in the C57BL/6J strain. As suggested by the increased body weights encountered in estrogen receptor-{alpha}-deficient (70) and aromatase-deficient (71) mice, estrogen seems to be somewhat protective against the development of obesity, and this effect may be more pronounced in the C57BL/6J strain.

Regardless of weight gained, both female DBA/2J and C57BL/6J mice on the 24% fat diet developed insulin resistance as suggested by their QUICKI and HOMA indexes. The fact that female DBA/2J mice manifested less insulin resistance than C57BL/6J mice despite having gained 95% more body fat from the high fat diet suggests that neither the degree of adiposity nor the extent of hyperleptinemia necessarily correlates with the severity of insulin resistance. These findings also reinforce the fact that modifying genes intrinsic to a particular background strain can independently affect the susceptibility to develop DIO and to become insulin resistant.

The fact that the leptin/body weight ratio was significantly higher in female DBA/2J mice fed the 24% fat diet compared with the 4% fat group suggests that even at their greater average weight, the obese females are manifesting disproportionately high levels of circulating leptin. Moreover, the female DBA/2J mice on the 24% fat diet were able to gain excessive weight despite a caloric intake similar to their 4% fat counterparts, suggesting diminished energy expenditure or increased caloric efficiency. These findings are both consistent with leptin resistance.

We performed several mating studies to characterize the effects of dietary fat on body composition and fertility. The female DBA/2J mice made obese from the 24% fat diet manifested a dramatically impaired pregnancy rate after 1 wk of mating with proven fertile males. When fertility was examined as a dichotomous variable to classify DBA/2J females regardless of dietary grouping, it was found to significantly negatively correlate with both body weight and dietary fat grouping to an almost identical degree (see Results), suggesting that obesity is the factor predisposing to their infertility and not the 24% fat diet per se.

Despite also manifesting metabolic abnormalities suggestive of concomitant insulin and leptin resistance, the DIO male DBA/2J mice were still able to sire pups without any evidence of impaired fertility. This disparity is consistent with previous observations that female fertility is disproportionately more vulnerable to metabolic perturbations than that of the male. For example, sterility is completely penetrant in ob/ob C57BL/6J females, whereas the males, although still quite subfertile, can occasionally sire pups in wild-type females (Chua, S. C., unpublished observations). Moreover, when modifying genes have been introduced to leptin-deficient mice, either through transgenic or congenic complementation, the fertility rates of the males have been nearly normalized while those of the females remain negligible (72, 73, 74). As the maternal investment in the reproductive process is significantly greater than the paternal, the sexual dimorphism of leptin’s effect upon fertility makes teleological sense.

The female C57BL/6J mice on the 24% fat diet did not demonstrate any reduction in their pregnancy rates compared with their 4% fat diet cohorts. Given the fact that female C57BL/6J mice on the 24% fat diet were significantly more insulin resistant than female DBA/2J mice on the same diet, it is likely that the subfertility manifested by DIO female DBA/2J mice is associated with the hyperleptinemia rather than the hyperinsulinemia that accompanied their obesity. It is tempting to speculate that if the resistance to DIO demonstrated by female C57BL/6J mice were to be overcome through enhanced food palatability or even higher concentrations of dietary fat, they also would manifest reductions in their fertility, presumably secondary to leptin resistance.

We conducted several studies to ascertain the nature of the infertility manifested by the female DIO DBA/2J mice. Exogenous gonadotropins were able to restore normal pregnancy rates and also to induce a similar number of ovulations, essentially ruling out a major uterine or ovarian defect. Moreover, upon histological examination, the ovaries of 20-wk-old DIO DBA/2J mice showed diminished follicular development compared with their lean cohorts, but there was evidence of past normal function in the form of corpora lutei. This suggests that their fertility defect, like their obesity, was gradually acquired. The fact that the DIO female DBA/2J mice manifested a more than 50% reduction in their relative number of hypothalamic GnRH transcripts confirmed the central nature of their fertility defect. Therefore, it appears that central resistance to leptin in this model, in a manner similar to an absolute deficiency of leptin by mutation, engenders hypothalamic hypogonadism, and that females have a lower threshold than males for this phenomenon.

How does leptin exert its permissive effect upon reproduction? Although there is a small body of in vitro data suggesting that leptin can directly modulate the activity of immortalized GnRH-secreting cell lines, in situ hybridization and immunofluorescence studies have demonstrated little to no presence of the leptin receptor in GnRH neurons of the monkey or rat (75, 76, 77). If leptin does have a direct stimulatory effect on the GnRH neuron in vivo, it is probably overwhelmed by the effects it indirectly exerts via its influence on interneurons whose axonal processes abut GnRH neurons. NPY is clearly a major mediator in this capacity. In ob/ob mice, the lack of leptin-mediated inhibition of NPY expression and secretion (78, 79, 80) leads to chronic elevations of hypothalamic NPY expression. Moreover, treatment of ob/ob mice with leptin is sufficient to normalize hypothalamic NPY levels while concomitantly ameliorating the hyperphagia, obesity, and central infertility, effects not achieved by inducing a similar degree of weight loss through hypocaloric feeding (22, 23, 79). Further evidence that elevated central NPY tone mediates the pathology of leptin deficiency is that most of the defects of ob/ob mice, including infertility, are attenuated or normalized when superimposed onto NPY knockout mice (81). Interestingly, NPY may exert its effects on body weight and fertility via separate mechanisms as selective deletion of the Y4 receptor alone is sufficient to restore fertility, but not normal body weight, to ob/ob mice (72).

We wished to discern whether the infertility present in our obese female DBA/2J model was associated with heightened central NPY tone, itself an indirect gauge of leptin effect. Therefore, we investigated relative hypothalamic transcript levels of NPY using real-time PCR technology. Consistent with the presence of diminished central leptin effect, the obese female DBA/2J mice manifested nearly 100% more NPY transcripts within their hypothalami. It is presumably this heightened NPY-ergic tone that is responsible for the diminished central GnRH expression seen in the DIO DBA/2J females.

The limited data examining hypothalamic leptin receptor levels in DIO rodents are inconsistent, with some studies demonstrating a diminution (38, 39, 56), while others showed no difference (65). In our model of female murine leptin resistance, we are able to demonstrate that the level of LEPR-B, the STAT-signaling competent isoform of the leptin receptor, was dramatically reduced by 95% in obese female DBA/2J mice compared with their lean counterparts. In addition, there was no difference between lean and obese DBA/2J mice with regard to their hypothalamic transcript levels of SOCS-3, a molecule implicated in leptin resistance by its ability to reverse leptin-induced STAT3 phosphorylation.

Although these findings suggest that in this particular model of female leptin resistance, diminished central leptin effect may stem at least in part from diminished LEPR-B expression rather than from postreceptor antagonism of leptin signal transduction, future studies are needed to address the possibility that the lowered LEPR-B expression is not the primary pathological insult induced by hyperleptinemia but, rather, a compensatory mechanism used to help overcome another central aberration induced by excessive central leptin signaling. In addition, as LEPR-B is produced by the preferential splicing of exon 18a from the LEPR-A isoform, future measurements of hypothalamic LEPR-A in lean and obese female DBA/2J mice may determine whether the diminished LEPR-B expression noted in obese female DBA/2J mice is attributable to a diminution in transcription vs. splicing.

In conclusion, we have demonstrated that DBA/2J mice on a 24% fat diet develop obesity accompanied by hyperleptinemia, hyperinsulinemia, and a female-specific central fertility defect. As suggested by real-time PCR analysis, this infertility is probably secondary to enhanced expression of NPY, a neuropeptide known to tonically inhibit GnRH pulsatility. The presence of hyperleptinemia and increased central NPY tone are both suggestive that the infertile female DBA/2J mice suffer from a diminished central leptin effect, which appears at least partially attributable to decreased hypothalamic LEPR-B expression. Given that obesity has reached epidemic proportions in the United States (82), the magnitude of even a mildly detrimental impact of obesity-associated leptin resistance on fertility in women assumes dramatic proportions. This model will be used to further investigate the neuroendocrine derangements underlying the female infertility of leptin resistance and its possible remediation.


    Acknowledgments
 
We are indebted to Drs. Michel Ferin and Rogerio Lobo for their critical review of the manuscript.


    Footnotes
 
This work was supported by Women’s Reproductive Health Research Scholarship NIH 5-K12-HD-001275-04 (to D.V.T.).

Abbreviations: BMI, Body mass index; DEXA, dual energy x-ray absorptiometry; DIO, dietary-induced obesity; HOMA, homeostatic model assessment; LEPR-B, leptin receptor type B; NPY, neuropeptide Y; PMSG, pregnant mare’s serum gonadotropin; QUICKI, quantitative insulin sensitivity check index; SOCS-3, suppressor of cytokine signaling-3; STAT-3, signal transducer and activator of transcription-3.

Received October 20, 2003.

Accepted for publication December 4, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Frisch RE, McArthur JW 1974 Menstrual cycles: fatness as a determinant of minimum weight for height necessary for their maintenance or onset. Science 185:949–951[Abstract/Free Full Text]
  2. Anderson SE, Dallal GE, Must A 2003 Relative weight and race influence average age at menarche: results from two nationally representative surveys of US girls studied 25 years apart. Pediatrics 111:844–850[Abstract/Free Full Text]
  3. Abraham SF, Beumont PJ, Fraser IS, Llewellyn-Jones D 1982 Body weight, exercise and menstrual status among ballet dancers in training. Br J Obstet Gynaecol 89:507–510[Medline]
  4. Anderson BS 1980 Delayed menarche and amenorrhea in ballet dancers. N Engl J Med 303:1125–1126[Medline]
  5. Wilkerson LA 1984 The female athlete. Am Fam Physician 29:233–237[Medline]
  6. Williams M 1984 Oligomenorrhoea and amenorrhoea associated with exercise. A literature review. Aust Fam Physician 13:659–663[Medline]
  7. Golden NH, Shenker IR 1994 Amenorrhea in anorexia nervosa. Neuroendocrine control of hypothalamic dysfunction. Int J Eat Disord 16:53–60[Medline]
  8. Nufer NJ 1989 Pediatric management problems. Anorexia nervosa causing amenorrhea. Pediatr Nurs 15:380–389[Medline]
  9. Rittmaster RS, Deshwal N, Lehman L 1993 The role of adrenal hyperandrogenism, insulin resistance, and obesity in the pathogenesis of polycystic ovarian syndrome. J Clin Endocrinol Metab 76:1295–1300[Abstract]
  10. Douchi T, Kuwahata R, Yamamoto S, Oki T, Yamasaki H, Nagata Y 2002 Relationship of upper body obesity to menstrual disorders. Acta Obstet Gynecol Scand 81:147–150[CrossRef][Medline]
  11. Rich-Edwards JW, Spiegelman D, Garland M, Hertzmark E, Hunter DJ, Colditz GA, Willett WC, Wand H, Manson JE 2002 Physical activity, body mass index, and ovulatory disorder infertility. Epidemiology 13:184–190[CrossRef][Medline]
  12. Ingalls AM DM, Snell GD 1950 Obese, a new mutation in the mouse. J Hered 41:317–318[Free Full Text]
  13. Hummel KP DM, Coleman DL 1966 Diabetes, a new mutation in the mouse. Science 153:1127–1128[Abstract/Free Full Text]
  14. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 372:425–432[CrossRef][Medline]
  15. Tartaglia LA, Dembski M, Weng X, Deng N, Culpepper J, Devos R, Richards GJ, Campfield LA, Clark FT, Deeds J, Muir C, Sanker S, Moriarty A, Moore KJ, Smutko JS, Mays GG, Woolf EA, Monroe CA, Tepper RI 1995 Identification and expression cloning of a leptin receptor, OB-R. Cell 83:1263–1271[CrossRef][Medline]
  16. Chua Jr SC, Chung WK, Wu-Peng XS, Zhang Y, Liu SM, Tartaglia L, Leibel RL 1996 Phenotypes of mouse diabetes and rat fatty due to mutations in the OB (leptin) receptor. Science 271:994–996[Abstract]
  17. Koletsky S 1973 Obese spontaneously hypertensive rats–a model for study of atherosclerosis. Exp Mol Pathol 19:53–60[CrossRef][Medline]
  18. Phillips MS, Liu Q, Hammond HA, Dugan V, Hey PJ, Caskey CJ, Hess JF 1996 Leptin receptor missense mutation in the fatty Zucker rat. Nat Genet 13:18–19[CrossRef][Medline]
  19. Clement K, Vaisse C, Lahlou N, Cabrol S, Pelloux V, Cassuto D, Gourmelen M, Dina C, Chambaz J, Lacorte JM, Basdevant A, Bougneres P, Lebouc Y, Froguel P, Guy-Grand B 1998 A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 392:398–401[CrossRef][Medline]
  20. Montague CT, Farooqi IS, Whitehead JP, Soos MA, Rau H, Wareham NJ, Sewter CP, Digby JE, Mohammed SN, Hurst JA, Cheetham CH, Earley AR, Barnett AH, Prins JB, O’Rahilly S 1997 Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387:903–908[CrossRef][Medline]
  21. Farooqi IS, Keogh JM, Kamath S, Jones S, Gibson WT, Trussell R, Jebb SA, Lip GY, O’Rahilly S 2001 Partial leptin deficiency and human adiposity. Nature 414:34–35[CrossRef][Medline]
  22. Chehab FF, Lim ME, Lu R 1996 Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat Genet 12:318–320[CrossRef][Medline]
  23. Mounzih K, Lu R, Chehab FF 1997 Leptin treatment rescues the sterility of genetically obese ob/ob males. Endocrinology 138:1190–1193[Abstract/Free Full Text]
  24. Farooqi IS, Jebb SA, Langmack G, Lawrence E, Cheetham CH, Prentice AM, Hughes IA, McCamish MA, O’Rahilly S 1999 Effects of recombinant leptin therapy in a child with congenital leptin deficiency. N Engl J Med 341:879–884[Free Full Text]
  25. Frederich RC, Lollmann B, Hamann A, Napolitano-Rosen A, Kahn BB, Lowell BB, Flier JS 1995 Expression of ob mRNA and its encoded protein in rodents. Impact of nutrition and obesity. J Clin Invest 96:1658–1663
  26. Frederich RC, Hamann A, Anderson S, Lollmann B, Lowell BB, Flier JS 1995 Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action. Nat Med 1:1311–1314[CrossRef][Medline]
  27. Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ, Bauer TL, Caro JF 1996 Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N Engl J Med 334:292–295[Abstract/Free Full Text]
  28. Friedman JM, Halaas JL 1998 Leptin and the regulation of body weight in mammals. Nature 395:763–770[CrossRef][Medline]
  29. Halaas JL, Boozer C, Blair-West J, Fidahusein N, Denton DA, Friedman JM 1997 Physiological response to long-term peripheral and central leptin infusion in lean and obese mice. Proc Natl Acad Sci USA 94:8878–8883[Abstract/Free Full Text]
  30. Van Heek M, Compton DS, France CF, Tedesco RP, Fawzi AB, Graziano MP, Sybertz EJ, Strader CD, Davis Jr HR 1997 Diet-induced obese mice develop peripheral, but not central, resistance to leptin. J Clin Invest 99:385–390[Medline]
  31. Farooqi IS, Matarese G, Lord GM, Keogh JM, Lawrence E, Agwu C, Sanna V, Jebb SA, Perna F, Fontana S, Lechler RI, DePaoli AM, O’Rahilly S 2002 Beneficial effects of leptin on obesity, T cell hyporesponsiveness, and neuroendocrine/metabolic dysfunction of human congenital leptin deficiency. J Clin Invest 110:1093–1103[CrossRef][Medline]
  32. Heymsfield SB, Greenberg AS, Fujioka K, Dixon RM, Kushner R, Hunt T, Lubina JA, Patane J, Self B, Hunt P, McCamish M 1999 Recombinant leptin for weight loss in obese and lean adults: a randomized, controlled, dose-escalation trial. JAMA 282:1568–1575[Abstract/Free Full Text]
  33. Hukshorn CJ, Saris WH, Westerterp-Plantenga MS, Farid AR, Smith FJ, Campfield LA 2000 Weekly subcutaneous pegylated recombinant native human leptin (PEG-OB) administration in obese men. J Clin Endocrinol Metab 85:4003–4009[Abstract/Free Full Text]
  34. Yura S, Ogawa Y, Sagawa N, Masuzaki H, Itoh H, Ebihara K, Aizawa-Abe M, Fujii S, Nakao K 2000 Accelerated puberty and late-onset hypothalamic hypogonadism in female transgenic skinny mice overexpressing leptin. J Clin Invest 105:749–755[Medline]
  35. Granholm NH, Jeppesen KW, Japs RA 1986 Progressive infertility in female lethal yellow mice (Ay/a; strain C57BL/6J). J Reprod Fertil 76:279–287[Abstract/Free Full Text]
  36. Granholm NH, Dickens GA 1986 Effects of reciprocal ovary transplantation on reproductive performance of lethal yellow mice (Ay/a; C57BL/6J). J Reprod Fertil 78:749–753[Abstract/Free Full Text]
  37. Sahu A 2002 Resistance to the satiety action of leptin following chronic central leptin infusion is associated with the development of leptin resistance in neuropeptide Y neurons. J Neuroendocrinol 14:796–804[CrossRef][Medline]
  38. Fernandez-Galaz C, Fernandez-Agullo T, Perez C, Peralta S, Arribas C, Andres A, Carrascosa JM, Ros M 2002 Long-term food restriction prevents ageing-associated central leptin resistance in Wistar rats. Diabetologia 45:997–1003[CrossRef][Medline]
  39. Scarpace PJ, Matheny M, Zhang Y, Shek EW, Prima V, Zolotukhin S, Tumer N 2002 Leptin-induced leptin resistance reveals separate roles for the anorexic and thermogenic responses in weight maintenance. Endocrinology 143:3026–3035[Abstract/Free Full Text]
  40. Steinberg GR, Parolin ML, Heigenhauser GJ, Dyck DJ 2002 Leptin increases FA oxidation in lean but not obese human skeletal muscle: evidence of peripheral leptin resistance. Am J Physiol 283:E187–E192
  41. Gabriely I, Ma XH, Yang XM, Rossetti L, Barzilai N 2002 Leptin resistance during aging is independent of fat mass. Diabetes 51:1016–1021[Abstract/Free Full Text]
  42. Wang J, Obici S, Morgan K, Barzilai N, Feng Z, Rossetti L 2001 Overfeeding rapidly induces leptin and insulin resistance. Diabetes 50:2786–2791[Abstract/Free Full Text]
  43. Lin S, Thomas TC, Storlien LH, Huang XF 2000 Development of high fat diet-induced obesity and leptin resistance in C57BL/6J mice. Int J Obes Relat Metab Disord 24:639–646[CrossRef][Medline]
  44. Lansang MC, Williams GH, Carroll JS 2001 Correlation between the glucose clamp technique and the homeostasis model assessment in hypertension. Am J Hypertens 14:51–53[CrossRef][Medline]
  45. Katz A, Nambi SS, Mather K, Baron AD, Follmann DA, Sullivan G, Quon MJ 2000 Quantitative insulin sensitivity check index: a simple, accurate method for assessing insulin sensitivity in humans. J Clin Endocrinol Metab 85:2402–2410[Abstract/Free Full Text]
  46. El-Haschimi K, Lehnert H 2003 Leptin resistance–or why leptin fails to work in obesity. Exp Clin Endocrinol Diabetes 111:2–7[CrossRef][Medline]
  47. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P 1996 OB protein: a peripheral signal linking adiposity and central neural networks. Appetite 26:302[CrossRef][Medline]
  48. Ozata M, Ozdemir IC, Licinio J 1999 Human leptin deficiency caused by a missense mutation: multiple endocrine defects, decreased sympathetic tone, and immune system dysfunction indicate new targets for leptin action, greater central than peripheral resistance to the effects of leptin, and spontaneous correction of leptin-mediated defects. J Clin Endocrinol Metab 84:3686–3695[Abstract/Free Full Text]
  49. Caro JF, Kolaczynski JW, Nyce MR, Ohannesian JP, Opentanova I, Goldman WH, Lynn RB, Zhang PL, Sinha MK, Considine RV 1996 Decreased cerebrospinal-fluid/serum leptin ratio in obesity: a possible mechanism for leptin resistance. Lancet 348:159–161[CrossRef][Medline]
  50. Banks WA, Farrell CL 2003 Impaired transport of leptin across the blood-brain barrier in obesity is acquired and reversible. Am J Physiol 285:E10–E15
  51. Banks WA 2003 Is obesity a disease of the blood-brain barrier? Physiological, pathological, and evolutionary considerations. Curr Pharm Des 9:801–809[CrossRef][Medline]
  52. Bjorbaek C, Elmquist JK, Frantz JD, Shoelson SE, Flier JS 1998 Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1:619–625[CrossRef][Medline]
  53. Wang Z, Zhou YT, Kakuma T, Lee Y, Kalra SP, Kalra PS, Pan W, Unger RH 2000 Leptin resistance of adipocytes in obesity: role of suppressors of cytokine signaling. Biochem Biophys Res Commun 277:20–26[CrossRef][Medline]
  54. Lu H, Buison A, Jen KC, Dunbar JC 2000 Leptin resistance in obesity is characterized by decreased sensitivity to proopiomelanocortin products. Peptides 21:1479–1485[CrossRef][Medline]
  55. Lin S, Storlien LH, Huang XF 2000 Leptin receptor, NPY, POMC mRNA expression in the diet-induced obese mouse brain. Brain Res 875:89–95[CrossRef][Medline]
  56. Martin RL, Perez E, He YJ, Dawson Jr R, Millard WJ 2000 Leptin resistance is associated with hypothalamic leptin receptor mRNA and protein downregulation. Metabolism 49:1479–1484[CrossRef][Medline]
  57. Baskin DG, Seeley RJ, Kuijper JL, Lok S, Weigle DS, Erickson JC, Palmiter RD, Schwartz MW 1998 Increased expression of mRNA for the long form of the leptin receptor in the hypothalamus is associated with leptin hypersensitivity and fasting. Diabetes 47:538–543[Abstract]
  58. Plut C, Ribiere C, Giudicelli Y, Dausse JP 2003 Hypothalamic leptin receptor and signaling molecules expressions in cafeteria diet-fed rats. J Pharmacol Exp Ther
  59. Sahu A, Nguyen L, O’Doherty RM 2002 Nutritional regulation of hypothalamic leptin receptor gene expression is defective in diet-induced obesity. J Neuroendocrinol 14:887–893[Medline]
  60. Peiser C, McGregor GP, Lang RE 2000 Leptin receptor expression and suppressor of cytokine signaling transcript levels in high-fat-fed rats. Life Sci 67:2971–2981[CrossRef][Medline]
  61. Pierroz DD, Ziotopoulou M, Ungsunan L, Moschos S, Flier JS, Mantzoros CS 2002 Effects of acute and chronic administration of the melanocortin agonist MTII in mice with diet-induced obesity. Diabetes 51:1337–1345[Abstract/Free Full Text]
  62. Nakagawa T, Ogawa Y, Ebihara K, Yamanaka M, Tsuchida A, Taiji M, Noguchi H, Nakao K 2003 Anti-obesity and anti-diabetic effects of brain-derived neurotrophic factor in rodent models of leptin resistance. Int J Obes Relat Metab Disord 27:557–565[CrossRef][Medline]
  63. Moraes R, Blondet A, Birkenkamp-Demtroeder K, Tirard J, Orntoft T, Gertler A, Durand P, Naville D, Begeot M 2003 Study of the alteration of gene expression in adipose tissue of diet-induced obesity (DIO) mice by microarray and RT-PCR analyses. Endocrinology 144:4773–4782[Abstract/Free Full Text]
  64. Seeley RJ, van Dijk G, Campfield LA, Smith FJ, Burn P, Nelligan JA, Bell SM, Baskin DG, Woods SC, Schwartz MW 1996 Intraventricular leptin reduces food intake and body weight of lean rats but not obese Zucker rats. Horm Metab Res 28:664–668[Medline]
  65. El-Haschimi K, Pierroz DD, Hileman SM, Bjorbaek C, Flier JS 2000 Two defects contribute to hypothalamic leptin resistance in mice with diet-induced obesity. J Clin Invest 105:1827–1832[Medline]
  66. Huang XF, Han M, South T, Storlien L 2003 Altered levels of POMC, AgRP and MC4-R mRNA expression in the hypothalamus and other parts of the limbic system of mice prone or resistant to chronic high-energy diet-induced obesity. Brain Res 992:9–19[CrossRef][Medline]
  67. Huang XF, Han M, Storlien LH 2003 The level of NPY receptor mRNA expression in diet-induced obese and resistant mice. Brain Res Mol Brain Res 115:21–28[Medline]
  68. Ravinet Trillou C, Arnone M, Delgorge C, Gonalons N, Keane P, Maffrand JP, Soubrie P 2003 Anti-obesity effect of SR141716, a CB1 receptor antagonist, in diet-induced obese mice. Am J Physiol 284:R345–R353
  69. Agardh CD, Agardh E, Hultberg B, Ahren B 2000 Long-standing hyperglycemia in C57BL/6J mice does not affect retinal glutathione levels or endothelial/pericyte ratio in retinal capillaries. J Diabetes Complications 14:146–153[CrossRef][Medline]
  70. Heine PA, Taylor JA, Iwamoto GA, Lubahn DB, Cooke PS 2000 Increased adipose tissue in male and female estrogen receptor-{alpha} knockout mice. Proc Natl Acad Sci USA 97:12729–12734[Abstract/Free Full Text]
  71. Jones ME, Thorburn AW, Britt KL, Hewitt KN, Misso ML, Wreford NG, Proietto J, Oz OK, Leury BJ, Robertson KM, Yao S, Simpson ER 2001 Aromatase-deficient (ArKO) mice accumulate excess adipose tissue. J Steroid Biochem Mol Biol 79:3–9[CrossRef][Medline]
  72. Sainsbury A, Schwarzer C, Couzens M, Jenkins A, Oakes SR, Ormandy CJ, Herzog H 2002 Y4 receptor knockout rescues fertility in ob/ob mice. Genes Dev 16:1077–1088[Abstract/Free Full Text]
  73. Qiu J, Ogus S, Mounzih K, Ewart-Toland A, Chehab FF 2001 Leptin-deficient mice backcrossed to the BALB/cJ genetic background have reduced adiposity, enhanced fertility, normal body temperature, and severe diabetes. Endocrinology 142:3421–3425[Abstract/Free Full Text]
  74. Ewart-Toland A, Mounzih K, Qiu J, Chehab FF 1999 Effect of the genetic background on the reproduction of leptin-deficient obese mice. Endocrinology 140:732–738[Abstract/Free Full Text]
  75. Finn PD, Cunningham MJ, Pau KY, Spies HG, Clifton DK, Steiner RA 1998 The stimulatory effect of leptin on the neuroendocrine reproductive axis of the monkey. Endocrinology 139:4652–4662[Abstract/Free Full Text]
  76. Ogura K, Irahara M, Kiyokawa M, Tezuka M, Matsuzaki T, Yasui T, Kamada M, Aono T 2001 Effects of leptin on secretion of LH and FSH from primary cultured female rat pituitary cells. Eur J Endocrinol 144:653–658[Abstract]
  77. Hakansson ML, Brown H, Ghilardi N, Skoda RC, Meister B 1998 Leptin receptor immunoreactivity in chemically defined target neurons of the hypothalamus. J Neurosci 18:559–572[Abstract/Free Full Text]
  78. Schwartz MW, Seeley RJ, Campfield LA, Burn P, Baskin DG 1996 Identification of targets of leptin action in rat hypothalamus. J Clin Invest 98:1101–1106[Medline]
  79. Stephens TW, Basinski M, Bristow PK, Bue-Valleskey JM, Burgett SG, Craft L, Hale J, Hoffmann J, Hsiung HM, Kriauciunas A, MacKellar W, Rosteck PR, Schoner B, Smith D, Tinsley FC, Zhang XY, Heiman M 1995 The role of neuropeptide Y in the antiobesity action of the obese gene product. Nature 377:530–532[CrossRef][Medline]
  80. Widdowson PS, Wilding JP 2000 Hypothalamic neuropeptide Y and its neuroendocrine regulation by leptin. Front Horm Res 26:71–86[Medline]
  81. Erickson JC, Hollopeter G, Palmiter RD 1996 Attenuation of the obesity syndrome of ob/ob mice by the loss of neuropeptide Y. Science 274:1704–1707[Abstract/Free Full Text]
  82. Mokdad AH, Ford ES, Bowman BA, Dietz WH, Vinicor F, Bales VS, Marks JS 2003 Prevalence of obesity, diabetes, and obesity-related health risk factors, 2001. JAMA 289:76–79[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
H. R. Light, E. Tsanzi, J. Gigliotti, K. Morgan, and J. C. Tou
The Type of Caloric Sweetener Added to Water Influences Weight Gain, Fat Mass, and Reproduction in Growing Sprague-Dawley Female Rats
Experimental Biology and Medicine, June 1, 2009; 234(6): 651 - 661.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. J. Chang
Obesity and the Emergence of Sleep-Wake Gonadotropin Secretion in Girls during Early Pubertal Development
J. Clin. Endocrinol. Metab., April 1, 2009; 94(4): 1094 - 1096.
[Full Text] [PDF]


Home page
EndocrinologyHome page
S. P. Weisberg, R. Leibel, and D. V. Tortoriello
Dietary Curcumin Significantly Improves Obesity-Associated Inflammation and Diabetes in Mouse Models of Diabesity
Endocrinology, July 1, 2008; 149(7): 3549 - 3558.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. L. Trevaskis, E. A. Meyer, J. E. Galgani, and A. A. Butler
Counterintuitive Effects of Double-Heterozygous Null Melanocortin-4 Receptor and Leptin Genes on Diet-Induced Obesity and Insulin Resistance in C57BL/6J Mice
Endocrinology, January 1, 2008; 149(1): 174 - 184.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. Gelegen, D. A. Collier, I. C. Campbell, H. Oppelaar, and M. J. H. Kas
Behavioral, physiological, and molecular differences in response to dietary restriction in three inbred mouse strains
Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E574 - E581.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
B Beck
Neuropeptide Y in normal eating and in genetic and dietary-induced obesity
Phil Trans R Soc B, July 29, 2006; 361(1471): 1159 - 1185.
[Abstract] [Full Text] [PDF]


Home page
Proc R Soc BHome page
S.L Johnston, T Grune, L.M Bell, S.J Murray, D.M Souter, S.S Erwin, J.M Yearsley, I.J Gordon, A.W Illius, I Kyriazakis, et al.
Having it all: historical energy intakes do not generate the anticipated trade-offs in fecundity
Proc R Soc B, June 7, 2006; 273(1592): 1369 - 1374.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
M Mitchell, D T Armstrong, R L Robker, and R J Norman
Adipokines: implications for female fertility and obesity
Reproduction, November 1, 2005; 130(5): 583 - 597.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. E. McMinn, S.-M. Liu, H. Liu, I. Dragatsis, P. Dietrich, T. Ludwig, C. N. Boozer, and S. C. Chua Jr.
Neuronal deletion of Lepr elicits diabesity in mice without affecting cold tolerance or fertility
Am J Physiol Endocrinol Metab, September 1, 2005; 289(3): E403 - E411.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tortoriello, D. V.
Right arrow Articles by Chua, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tortoriello, D. V.
Right arrow Articles by Chua, S. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals