| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Reproductive Endocrinology, Department of Obstetrics and Gynecology (D.V.T.), and Division of Molecular Genetics, Department of Pediatrics (J.M., S.C.C.), Columbia University, New York, New York 10032
Address all correspondence and requests for reprints to: Drew V. Tortoriello, M.D, Russ Berrie Medical Science Pavilion, Columbia University Medical Center, New York Presbyterian Hospital, 1150 St. Nicholas Avenue, Room 620, New York, New York 10032. E-mail: dt2016{at}columbia.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The phenotypes of ob/ob (12) and db/db mice (13), which consist of hyperphagia, severe obesity, insulin resistance, and hypothalamic hypogonadism, have provided perhaps the most striking evidence of the interplay between metabolic and reproductive physiology. These phenotypes, which are now known to emanate from inactivating mutations of the leptin (14, 15) and leptin receptor genes (15, 16), respectively, are not unique to mice. Indeed, mutations affecting these genes have also been reported in rats (17, 18) and humans (19, 20, 21) and yield a remarkably similar pattern of abnormalities. Moreover, leptin repletion has been demonstrated to induce weight loss and pubertal progression in both leptin-deficient mice (22, 23) and humans (24). Therefore, leptin signaling is an evolutionarily conserved requirement for the appropriate maintenance of both energy balance and reproductive capacity.
Although the robust phenotype of murine genetic leptin deficiency indicates a connection between body composition and fertility, its usefulness as a direct model for the study of common obesity is limited. It is now evident that nearly all instances of obesity in both humans and rodents do not arise from monogenic mutation but, rather, from complex interactions between genetic predisposition and the environment. Moreover, obesity is rarely associated with leptin deficiency, but instead with high circulating concentrations of leptin that positively correlate with adiposity (25, 26, 27). This suggests that beyond a certain degree of adiposity, leptins ability to modulate weight is compromised. This may emanate from a pathological state of acquired resistance to the physiological effects of leptin (26) or may simply reflect leptins range of efficacy as designed by evolution (28). In any event, it is clear that similar doses of leptin do not exert similar reductions in food intake and body weight in normal and overweight subjects. Rodents with dietary-induced obesity (DIO) fail to lose weight in response to leptin concentrations shown to be effective in lean rodents (29, 30). Although the administration of recombinant leptin has been reported to promptly induce dramatic weight loss in obese, hyperphagic humans suffering from congenital leptin deficiency (24, 31), the use of much higher leptin dosages in obese hyperleptinemic humans has proven ineffective (32, 33). Therefore, both DIO in mice and naturally occurring obesity in humans are leptin-resistant states.
As an absolute deficiency of leptin or the signaling form of its receptor is clearly associated with hypothalamic hypogonadism in both rodents and humans, is it possible that acquired leptin resistance, whose most obvious and perhaps primary manifestation is obesity, is also associated with central infertility? Limited data in genetically altered mice support this premise. For example, leptin transgenic mice, whose peripheral concentrations of leptin are approximately 10-fold higher than those in controls since birth, are initially hypophagic, lean, and fertile. However, by 20 wk of age, these mice begin to gain excessive weight and develop hypothalamic hypogonadism (34). Female dominant yellow heterozygote (Ay/+) mice, which are hyperphagic and obese due to antagonism of their hypothalamic melanocortin system by ectopic hyperexpression of agouti protein, are reproductively normal until approximately 16 wk of age, when they also manifest hypothalamic hypogonadism in the context of progressively increasing weight and leptin levels (35, 36).
The preponderance of research investigating the phenomenon of leptin resistance in nonmutant mice has focused upon its appetitive and metabolic ramifications (37, 38, 39, 40, 41, 42, 43), leaving very little light shed upon the association between hyperleptinemic obesity and infertility, especially in the female. To address this issue, we subjected two common inbred mouse strains to dietary fat manipulation in a specific attempt to develop a female model of leptin-resistant DIO and to thereafter assess the impact of this metabolic state upon fertility and hypothalamic neuropeptide expression.
| Materials and Methods |
|---|
|
|
|---|
Two-hour glucose tolerance test
At 19 wk, 20 mice from each experimental group were placed into fresh cages and fasted for 12 h. Approximately 5 µl tail blood were obtained to measure blood glucose concentrations by glucometer (Glucometer Elite, Elkhart, IN) before and at 30-min intervals for 2 h after the ip injection of a filter-sterilized solution of 10% dextrose in normal saline (1 mg/kg). In addition, approximately 50 µl tail blood were obtained from fasted mice for later measurements of serum leptin and insulin.
Body composition analysis
Caloric intake in 23-wk-old female DBA/2J and C57BL/6J mice was estimated by weighing food before and after 24 h of ad libitum feeding. The D12450B-i diet contains 3.8 kcal/g, and the D12451-i diet contains 4.7 kcal/g. The body percentages of fat and lean tissues and bone mineral density were calculated from the exsanguinated carcasses of 20 23-wk-old mice from each experimental group by dual energy x-ray absorptiometry (DEXA) using a Lunar PIXImus2 machine (GE Medical Systems, Waukesha, WI).
Female natural mating experiments
At the age of 20 wk, two female mice from each experimental group were mated for 1 wk with a 14-wk-old proven fertile C57BL/6J male mouse. Twenty mice per experimental group were used. Morning postcoital vaginal plugging was checked daily during mating. Starting 1 wk after the mating period was terminated, the females were serially weighed and gently examined for signs of pregnancy while their cages were inspected daily for pups. Three independent replicates of this experiment were performed for the female DBA/2J mice, and two independent replicates were performed for the female C57BL/6J mice.
Ovarian histology
Ten female DBA/2J mice from each dietary group, which had never received any exogenous gonadotropin stimulation, were killed at 20 wk by CO2 asphyxiation and immediately had their ovaries excised and fixed in 4% paraformaldehyde. Paraffin-embedded ovarian sections were stained with hematoxylin-eosin for histological evaluation.
Male fertility
A single DBA/2J male mating experiment was performed in which 20 male DBA/2J mice at 35 wk of age were randomly allocated to either the 4% or 24% fat by weight diet. At 20 wk of age, each male was housed with two 12-wk-old proven fertile female C57BL/6J mice per cage for 1 wk. Starting 1 wk after the mating period was terminated, the females were serially weighed and gently examined for signs of pregnancy while their cages were inspected daily for pups.
Gonadotropin-induced ovulatory rates
In a separate experiment, 16 20-wk-old female DBA/2J from each dietary group received an ip injection of pregnant mares serum gonadotropin (PMSG; Sigma-Aldrich Corp., St. Louis, MO), followed 46 h later by human chorionic gonadotropin (hCG; Sigma-Aldrich Corp.) to induce superovulation. In an attempt to avoid any potentially confounding dilutional effect from body weight, the dosages of PMSG and hCG used per mouse were calculated according to weight (0.4 IU/g). Twelve hours after the hCG injection, mice were killed by CO2 asphyxiation, exsanguinated by cardiac puncture, and had their oviducts removed and flushed with normal saline for oocyte quantification under a stage microscope.
Gonadotropin-induced fertility
In a separate experiment, 20 female DBA/2J mice at 35 wk of age were randomly allocated to receive either the 4% or 24% fat by weight diet. At the age of 20 wk, they were treated with ip injections of 7.5 IU PMSG (Sigma-Aldrich Corp.), followed by 7.5 IU hCG (Sigma-Aldrich Corp.) 46 h later. Immediately after the second injection, each female mouse was placed into the same cage as a single fertile 15-wk-old C57BL/6J male for 24 h. The females were checked for vaginal plugging and then serially weighed and observed to document pregnancy.
Real-time PCR quantification of hypothalamic neuropeptides
At the age of 20 wk, the relative number of hypothalamic GnRH, leptin receptor type B (LEPR-B), suppressor of cytokine signaling-3 (SOCS-3), and neuropeptide Y (NPY) transcripts was quantified in 10 female DBA/2J mice from each dietary group. After CO2 asphyxiation and exsanguination, hypothalami were dissected and stored at -80 C in RNAlater (Ambion, Inc., Austin, TX). Hypothalamic total RNA was then extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) according to manufacturers instructions. Approximately 1 µg of each RNA sample was reverse transcribed into cDNA using the Superscript III First-Stand Synthesis System (Invitrogen) as directed. The cDNA was then subjected to real-time PCR amplification using the Dynamo SYBR Green qPCR kit in an Opticon2 thermocycler (MJ Research, Waltham, MA). A standard curve using serial 1:10 dilutions of pooled cDNA for each target transcript was generated in every PCR experiment to quantify copy numbers within any given cDNA sample. These data were then normalized to the number of hypoxanthine phosphoribosyltransferase copies calculated per given sample. The PCR conditions were 35 cycles of 94 C/55 C/72 C at 30 sec each. The forward and reverse primers for each transcript were as follows: GnRH, ctgctgactgtgtgtttgga and acctccttgcccatctcttg; NPY, actccgctctgcgacact and gttctgggggcgttttct; LEPR-B, agaacggacactctttgaagtctc and aaccatagtttaggtttgtttc; SOCS-3, ggcagtagcatttagaagggagac and tgggacagagggcattta; and hypoxanthine phosphoribosyltransferase, agcagtacagccccaaaa and tttggcttttccagtttca.
Hormone assays
Mouse blood was obtained by cardiac puncture immediately after death. Blood was centrifuged, and serum was transferred to clean vials for storage at -80 C until the day of assay. Mouse serum insulin, leptin, and hCG concentrations were quantified by ELISA, and all inter- and intraassay coefficients of variation were less than 10% (leptin and insulin ELISAs, Crystal Chem, Inc., Downers Grove, IL; hCG Immulite chemiluminescent immunoassay, Diagnostic Products Corp., Los Angeles, CA).
Statistics
A two-tailed t test was used to compare cardinal data across dietary groups in any given strain.
2 analysis was used to compare pregnancy rates across dietary groups. A Spearman rank-order nonparametric test was used to calculate correlation coefficients between fertility (pregnant vs. not pregnant), body weight, and dietary fat grouping (4% vs. 24%). P < 0.05 was considered statistically significant.
Definitions
The homeostatic model assessment (HOMA), an index of insulin resistance, was calculated as (G0) x (I0)/22.5, where G0 is the fasting glucose level expressed as millimoles per liter, and I0 is the fasting insulin level expressed as picomoles per liter (44). The quantitative insulin sensitivity check index (QUICKI) was calculated as 1/[log(I0) + log(G0)], where I0 is the fasting insulin level in microinternational units per milliliter, and G0 is the fasting glucose level in milligrams per deciliter (45). BMI was calculated as weight in kilograms per naso-anal length in meters squared. DIO is defined as a body weight of more than 2 SD above the average body weight of mice fed a low fat diet (46).
| Results |
|---|
|
|
|---|
|
|
|
|
|
High fat feeding decreases fertility in DBA/2J female mice
Approximately 70% and 25% of female DBA/2J mice on the low and high fat diets, respectively, demonstrated morning vaginal plugging within 1 wk after being introduced to the cages of fertile males. C57BL/6J female mice demonstrated a similar amount of plugging (
80%) regardless of diet (data not shown). As Fig. 3A
demonstrates, the natural pregnancy rates of the DIO female DBA/2J mice were over 60% less than those of their lean counterparts on the 4% fat diet, whereas no diminution in pregnancy rates was noted in the female C57BL/6J mice subjected to the 24% fat diet. When fertility was used as a dichotomous variable to classify all DBA/2J females regardless of dietary grouping, significant negative correlations were found with both body weight (r = -0.402; P = 0.0125) and dietary fat grouping (r = -0.406; P = 0.0116), and the never-pregnant females were significantly heavier than the fertile group by an average difference of 3.72 g (Fig. 3B
). Histological evaluation of ovaries from female DBA/2J mice on the 4% fat diet demonstrated multiple follicles in various stages of development (Fig. 3C
). Ovaries from female DBA/2J mice on the 24% fat diet had dramatically less follicular activity, although the presence of old corpora lutea suggested that at one point their ovaries functioned normally (Fig. 3D
).
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Rodents with DIO are an experimental model with much more applicability to human obesity. Like human obesity, DIO is a polygenic condition reflecting the interaction of genetic predisposition with the environment. The DIO phenotype is associated with diminished sensitivity to the physiological effects of circulating leptin and insulin with concomitant increases in their circulating concentrations (30, 42). There are several etiologies that have been postulated to contribute to this leptin resistance, among which are the diminished transport of leptin across the blood-brain barrier (49, 50, 51), reduced signal transducer and activator of transcription-3 (STAT3) activation via increased SOCS-3 activity (52, 53), postreceptor resistance to leptins effects in specialized neurons such as those that secrete NPY, agouti-related protein, or proopiomelanocortin (54, 55), and a down-regulation of the signaling isoform of the leptin receptor in key hypothalamic neurons (56, 57, 58, 59, 60).
Recently to emerge through characterization of hyperleptinemic mutant mice (34, 35) was the fact that chronically elevated leptin levels may also be associated with central infertility, suggesting that obesity-induced leptin resistance compromises GnRH pulsatility as well as energy balance. Unfortunately, nearly all prior studies examining the phenomenon of obesity-associated leptin resistance in wild-type rodents have focused upon the impact it exerts on satiety and energy balance rather than fertility and, moreover, have studied these effects in males of the species only (30, 61, 62, 63, 64, 65). The question therefore remained as to what effect gradually acquired obesity and its attendant leptin resistance might exert on fertility in normal female mice, an important prerequisite for studying the effect of leptin resistance on fertility in obese women. To address this, we assessed the body composition, metabolic status, and fertility of two common inbred mouse strains subjected to normal and increased dietary fat content with the specific intent of assessing female fertility in a nongenetically manipulated model of leptin-resistant obesity.
We discovered that after 4 months of consuming a diet containing 24% fat by weight, female DBA/2J mice developed DIO accompanied by hyperinsulinemia, insulin resistance, and hyperleptinemia. The female DBA/2J mice on the 24% fat diet weighed approximately 6.5 g more than their 4% dietary fat counterparts, and as revealed by DEXA imaging, nearly all of this weight gain was attributable to increases in their fat compartment.
The female C57BL/6J mice subjected to the 24% fat diet were approximately 5% heavier after 4 months, but this marginal weight gain was not reflected by significant increases in fat percentages or leptin levels. This is in stark contrast to male C57BL/6J mice, whose predisposition to develop leptin-resistant DIO has been extensively described (66, 67, 68). The literature describing DIO in female C57BL/6J mice is scant and reports its development only after the utilization of a diet containing over 33% more fat on a caloric basis than the high fat diet used in this study (69). Therefore, our data suggest that a distinct female gender-specific resistance toward the development of DIO exists in the C57BL/6J strain. As suggested by the increased body weights encountered in estrogen receptor-
-deficient (70) and aromatase-deficient (71) mice, estrogen seems to be somewhat protective against the development of obesity, and this effect may be more pronounced in the C57BL/6J strain.
Regardless of weight gained, both female DBA/2J and C57BL/6J mice on the 24% fat diet developed insulin resistance as suggested by their QUICKI and HOMA indexes. The fact that female DBA/2J mice manifested less insulin resistance than C57BL/6J mice despite having gained 95% more body fat from the high fat diet suggests that neither the degree of adiposity nor the extent of hyperleptinemia necessarily correlates with the severity of insulin resistance. These findings also reinforce the fact that modifying genes intrinsic to a particular background strain can independently affect the susceptibility to develop DIO and to become insulin resistant.
The fact that the leptin/body weight ratio was significantly higher in female DBA/2J mice fed the 24% fat diet compared with the 4% fat group suggests that even at their greater average weight, the obese females are manifesting disproportionately high levels of circulating leptin. Moreover, the female DBA/2J mice on the 24% fat diet were able to gain excessive weight despite a caloric intake similar to their 4% fat counterparts, suggesting diminished energy expenditure or increased caloric efficiency. These findings are both consistent with leptin resistance.
We performed several mating studies to characterize the effects of dietary fat on body composition and fertility. The female DBA/2J mice made obese from the 24% fat diet manifested a dramatically impaired pregnancy rate after 1 wk of mating with proven fertile males. When fertility was examined as a dichotomous variable to classify DBA/2J females regardless of dietary grouping, it was found to significantly negatively correlate with both body weight and dietary fat grouping to an almost identical degree (see Results), suggesting that obesity is the factor predisposing to their infertility and not the 24% fat diet per se.
Despite also manifesting metabolic abnormalities suggestive of concomitant insulin and leptin resistance, the DIO male DBA/2J mice were still able to sire pups without any evidence of impaired fertility. This disparity is consistent with previous observations that female fertility is disproportionately more vulnerable to metabolic perturbations than that of the male. For example, sterility is completely penetrant in ob/ob C57BL/6J females, whereas the males, although still quite subfertile, can occasionally sire pups in wild-type females (Chua, S. C., unpublished observations). Moreover, when modifying genes have been introduced to leptin-deficient mice, either through transgenic or congenic complementation, the fertility rates of the males have been nearly normalized while those of the females remain negligible (72, 73, 74). As the maternal investment in the reproductive process is significantly greater than the paternal, the sexual dimorphism of leptins effect upon fertility makes teleological sense.
The female C57BL/6J mice on the 24% fat diet did not demonstrate any reduction in their pregnancy rates compared with their 4% fat diet cohorts. Given the fact that female C57BL/6J mice on the 24% fat diet were significantly more insulin resistant than female DBA/2J mice on the same diet, it is likely that the subfertility manifested by DIO female DBA/2J mice is associated with the hyperleptinemia rather than the hyperinsulinemia that accompanied their obesity. It is tempting to speculate that if the resistance to DIO demonstrated by female C57BL/6J mice were to be overcome through enhanced food palatability or even higher concentrations of dietary fat, they also would manifest reductions in their fertility, presumably secondary to leptin resistance.
We conducted several studies to ascertain the nature of the infertility manifested by the female DIO DBA/2J mice. Exogenous gonadotropins were able to restore normal pregnancy rates and also to induce a similar number of ovulations, essentially ruling out a major uterine or ovarian defect. Moreover, upon histological examination, the ovaries of 20-wk-old DIO DBA/2J mice showed diminished follicular development compared with their lean cohorts, but there was evidence of past normal function in the form of corpora lutei. This suggests that their fertility defect, like their obesity, was gradually acquired. The fact that the DIO female DBA/2J mice manifested a more than 50% reduction in their relative number of hypothalamic GnRH transcripts confirmed the central nature of their fertility defect. Therefore, it appears that central resistance to leptin in this model, in a manner similar to an absolute deficiency of leptin by mutation, engenders hypothalamic hypogonadism, and that females have a lower threshold than males for this phenomenon.
How does leptin exert its permissive effect upon reproduction? Although there is a small body of in vitro data suggesting that leptin can directly modulate the activity of immortalized GnRH-secreting cell lines, in situ hybridization and immunofluorescence studies have demonstrated little to no presence of the leptin receptor in GnRH neurons of the monkey or rat (75, 76, 77). If leptin does have a direct stimulatory effect on the GnRH neuron in vivo, it is probably overwhelmed by the effects it indirectly exerts via its influence on interneurons whose axonal processes abut GnRH neurons. NPY is clearly a major mediator in this capacity. In ob/ob mice, the lack of leptin-mediated inhibition of NPY expression and secretion (78, 79, 80) leads to chronic elevations of hypothalamic NPY expression. Moreover, treatment of ob/ob mice with leptin is sufficient to normalize hypothalamic NPY levels while concomitantly ameliorating the hyperphagia, obesity, and central infertility, effects not achieved by inducing a similar degree of weight loss through hypocaloric feeding (22, 23, 79). Further evidence that elevated central NPY tone mediates the pathology of leptin deficiency is that most of the defects of ob/ob mice, including infertility, are attenuated or normalized when superimposed onto NPY knockout mice (81). Interestingly, NPY may exert its effects on body weight and fertility via separate mechanisms as selective deletion of the Y4 receptor alone is sufficient to restore fertility, but not normal body weight, to ob/ob mice (72).
We wished to discern whether the infertility present in our obese female DBA/2J model was associated with heightened central NPY tone, itself an indirect gauge of leptin effect. Therefore, we investigated relative hypothalamic transcript levels of NPY using real-time PCR technology. Consistent with the presence of diminished central leptin effect, the obese female DBA/2J mice manifested nearly 100% more NPY transcripts within their hypothalami. It is presumably this heightened NPY-ergic tone that is responsible for the diminished central GnRH expression seen in the DIO DBA/2J females.
The limited data examining hypothalamic leptin receptor levels in DIO rodents are inconsistent, with some studies demonstrating a diminution (38, 39, 56), while others showed no difference (65). In our model of female murine leptin resistance, we are able to demonstrate that the level of LEPR-B, the STAT-signaling competent isoform of the leptin receptor, was dramatically reduced by 95% in obese female DBA/2J mice compared with their lean counterparts. In addition, there was no difference between lean and obese DBA/2J mice with regard to their hypothalamic transcript levels of SOCS-3, a molecule implicated in leptin resistance by its ability to reverse leptin-induced STAT3 phosphorylation.
Although these findings suggest that in this particular model of female leptin resistance, diminished central leptin effect may stem at least in part from diminished LEPR-B expression rather than from postreceptor antagonism of leptin signal transduction, future studies are needed to address the possibility that the lowered LEPR-B expression is not the primary pathological insult induced by hyperleptinemia but, rather, a compensatory mechanism used to help overcome another central aberration induced by excessive central leptin signaling. In addition, as LEPR-B is produced by the preferential splicing of exon 18a from the LEPR-A isoform, future measurements of hypothalamic LEPR-A in lean and obese female DBA/2J mice may determine whether the diminished LEPR-B expression noted in obese female DBA/2J mice is attributable to a diminution in transcription vs. splicing.
In conclusion, we have demonstrated that DBA/2J mice on a 24% fat diet develop obesity accompanied by hyperleptinemia, hyperinsulinemia, and a female-specific central fertility defect. As suggested by real-time PCR analysis, this infertility is probably secondary to enhanced expression of NPY, a neuropeptide known to tonically inhibit GnRH pulsatility. The presence of hyperleptinemia and increased central NPY tone are both suggestive that the infertile female DBA/2J mice suffer from a diminished central leptin effect, which appears at least partially attributable to decreased hypothalamic LEPR-B expression. Given that obesity has reached epidemic proportions in the United States (82), the magnitude of even a mildly detrimental impact of obesity-associated leptin resistance on fertility in women assumes dramatic proportions. This model will be used to further investigate the neuroendocrine derangements underlying the female infertility of leptin resistance and its possible remediation.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: BMI, Body mass index; DEXA, dual energy x-ray absorptiometry; DIO, dietary-induced obesity; HOMA, homeostatic model assessment; LEPR-B, leptin receptor type B; NPY, neuropeptide Y; PMSG, pregnant mares serum gonadotropin; QUICKI, quantitative insulin sensitivity check index; SOCS-3, suppressor of cytokine signaling-3; STAT-3, signal transducer and activator of transcription-3.
Received October 20, 2003.
Accepted for publication December 4, 2003.
| References |
|---|
|
|
|---|
knockout mice. Proc Natl Acad Sci USA 97:1272912734This article has been cited by other articles:
![]() |
H. R. Light, E. Tsanzi, J. Gigliotti, K. Morgan, and J. C. Tou The Type of Caloric Sweetener Added to Water Influences Weight Gain, Fat Mass, and Reproduction in Growing Sprague-Dawley Female Rats Exp Biol Med, June 1, 2009; 234(6): 651 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Chang Obesity and the Emergence of Sleep-Wake Gonadotropin Secretion in Girls during Early Pubertal Development J. Clin. Endocrinol. Metab., April 1, 2009; 94(4): 1094 - 1096. [Full Text] [PDF] |
||||
![]() |
L. B Lemke, A. B Rogers, P. R Nambiar, and J. G Fox Obesity and non-insulin-dependent diabetes mellitus in Swiss-Webster mice associated with late-onset hepatocellular carcinoma J. Endocrinol., October 1, 2008; 199(1): 21 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Weisberg, R. Leibel, and D. V. Tortoriello Dietary Curcumin Significantly Improves Obesity-Associated Inflammation and Diabetes in Mouse Models of Diabesity Endocrinology, July 1, 2008; 149(7): 3549 - 3558. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Trevaskis, E. A. Meyer, J. E. Galgani, and A. A. Butler Counterintuitive Effects of Double-Heterozygous Null Melanocortin-4 Receptor and Leptin Genes on Diet-Induced Obesity and Insulin Resistance in C57BL/6J Mice Endocrinology, January 1, 2008; 149(1): 174 - 184. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gelegen, D. A. Collier, I. C. Campbell, H. Oppelaar, and M. J. H. Kas Behavioral, physiological, and molecular differences in response to dietary restriction in three inbred mouse strains Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E574 - E581. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Beck Neuropeptide Y in normal eating and in genetic and dietary-induced obesity Phil Trans R Soc B, July 29, 2006; 361(1471): 1159 - 1185. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.L Johnston, T Grune, L.M Bell, S.J Murray, D.M Souter, S.S Erwin, J.M Yearsley, I.J Gordon, A.W Illius, I Kyriazakis, et al. Having it all: historical energy intakes do not generate the anticipated trade-offs in fecundity Proc R Soc B, June 7, 2006; 273(1592): 1369 - 1374. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Mitchell, D T Armstrong, R L Robker, and R J Norman Adipokines: implications for female fertility and obesity Reproduction, November 1, 2005; 130(5): 583 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. McMinn, S.-M. Liu, H. Liu, I. Dragatsis, P. Dietrich, T. Ludwig, C. N. Boozer, and S. C. Chua Jr. Neuronal deletion of Lepr elicits diabesity in mice without affecting cold tolerance or fertility Am J Physiol Endocrinol Metab, September 1, 2005; 289(3): E403 - E411. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |