help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1248
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shepherdley, C. A.
Right arrow Articles by Kuiper, G. G. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shepherdley, C. A.
Right arrow Articles by Kuiper, G. G. J. M.
Endocrinology Vol. 145, No. 3 1255-1268
Copyright © 2004 by The Endocrine Society

An Ascidian Homolog of Vertebrate Iodothyronine Deiodinases

Caroline A. Shepherdley, Willem Klootwijk, Kazuhiro W. Makabe, Theo J. Visser and George G. J. M. Kuiper

Department of Internal Medicine (C.A.S., W.K., T.J.V., G.G.J.M.K.), Erasmus Medical Center, 3000 DR Rotterdam, The Netherlands; and Department of Zoology (K.W.M.), Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan

Address all correspondence and requests for reprints to: George Kuiper, Ph.D., Department of Internal Medicine, Room Ee 502, Erasmus Medical Center, Dr. Molewaterplein 40, 3015 GD Rotterdam, The Netherlands. E-mail: g.kuiper{at}erasmusmc.nl.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In all classes of vertebrates, the deiodination of the prohormone T4 to T3 represents an essential activation step in thyroid hormone action. The possible presence of iodothyronine deiodinase activity in protochordates has been demonstrated in vivo. Recent molecular cloning of the genomes and transcripts of several ascidian species allows further investigation into thyroid-related processes in ascidians. A cDNA clone from Halocynthia roretzi (hrDx) was found to have significant homology (30% amino acid identity) with the iodothyronine deiodinase gene sequences from vertebrates, including the presence of an in-frame UGA codon that might encode a selenocysteine (SeC) in the active site. Because it was not certain that the 3' untranslated region (UTR) contained a SeC insertion sequence (SECIS) element essential for SeC incorporation, a chimeric expression vector of the hrDx coding sequence and the rat deiodinase SECIS element was produced, as well as an expression vector containing the intact hrDx cDNA. COS, CHO, and HEK cells were transfected with these vectors, and deiodinase activity was measured in cell homogenates. Outer-ring deiodinase activity was detected using both T4 and reverse T3 as substrates, and activity was enhanced by the presence of the reductive cofactor dithiothreitol. The enzyme activity was optimal during incubation between 20 and 30 C (pH 6–7) and was strongly inhibited by gold-thioglucose. The Halocynthia deiodinase appears to be a high Michaelis-Menten constant (Km) enzyme (Km reverse T3, 2 µM; and Km T4, 4 µM). Deiodinase activity was completely lost upon the substitution of the SeC residue in the putative catalytic center by either cysteine or alanine. Transfection of the full-length hrDx cDNA produced deiodinase activity confirming the presence of a SECIS element in the 3'UTR, as revealed by the SECISearch program. In conclusion, our results show, for the first time, the existence of an ascidian iodothyronine outer-ring deiodinase. This raises the hypothesis that, in protochordates, the prohormone T4 is activated by enzymatic outer-ring deiodination to T3.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ASCIDIANS, OR SEA squirts, belong to the phylum Urochordata. They are often referred to as protochordates because during the larval stage they possess chordate characteristics, most notably the tail contains a notochord and a dorsal hollow nerve cord. After a free-swimming stage, the simple tadpole-like larvae attach to a substrate and undergo metamorphosis that includes tail loss and rearrangement of the internal organs. Subsequently, in the adult form, the similarities to chordates are lost. Although no clear role for thyroid hormones in adult ascidians has been established, studies showing that T4 may be involved in the metamorphosis stage suggest possible functions of thyroid hormones in larval ascidians (1, 2).

Indeed, the first evidence of an organ related to the vertebrate thyroid gland is found in protochordates. The ascidian endostyle is a mucus-secreting pharyngeal organ that facilitates filter feeding. The endostyle has iodine-concentrating activity (3, 4), and the biosynthesis of thyroid hormones by this organ is well documented (5, 6, 7, 8). Furthermore, T4 and T3 levels have been measured in ascidian blood and tissues (9, 10). Peroxidase activity is also present in the endostyle (11, 12), and thyroid peroxidase genes are correspondingly expressed in this tissue (13). Putative nuclear T3 receptors have been recognized (10), and a nuclear receptor cDNA clone has been isolated from Ciona intestinalis with a high degree of homology to vertebrate thyroid hormone receptor genes (14). An endostyle is also found in cephalochordates and in larval lamprey (ammocoetes), where it transforms into a follicular thyroid gland during metamorphosis (15).

In all classes of vertebrates, the monodeiodination of the prohormone T4 to the thyroid hormone receptor-active T3 plays an essential role in thyroid hormone action. In vivo, thyroid hormone deiodination has previously been demonstrated in ascidians. [125I]T4 added to sea water was converted to [125I]T3 and 125I-, which was detected in both the water and ascidian tissues (16). In vertebrates, the process of deiodination is catalyzed by a family of selenoenzymes called deiodinases (17, 18). Specifically, the main secretory product of the thyroid gland, T4, undergoes outer-ring deiodination (ORD) to produce T3. T4 and T3 are converted by inner-ring deiodination (IRD) to produce reverse T3 (rT3) and 3,3'-diiodothyronine (T2), respectively. Three distinct deiodinases are involved in these processes: D1 catalyzes both ORD and IRD, D2 catalyzes only ORD, and D3 catalyzes only IRD. The three deiodinase types have been extensively characterized and have been distinguished based on their biochemical characteristics. Deiodinase cDNA clones are available for many fish, amphibians, birds, and mammals (17, 18). This allows us to speculate about the phylogeny of these enzymes. As primitive chordates, ascidians provide a good system for exploring the evolutionary origins of the chordate lineage, from which all vertebrates are derived. Genome projects on ascidians are providing new insights into the origins of a number of key vertebrate systems and structures (19). The transcriptome of the ascidian, Halocynthia roretzi, is being sequenced by the Maboya gene and expressed sequence tag project (MAGEST database, National Institute of Genetics, Mishima, Japan) (20, 21). A cDNA clone was obtained that showed significant homology with the deiodinase gene sequences from vertebrates, including the presence of a putative selenocysteine (SeC) codon in the active site. We decided to investigate whether this clone was able to deiodinate thyroid hormones. In this article, we examine in detail the characteristics of the Halocynthia roretzi deiodinase homolog.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Nonradioactive iodothyronines were obtained from Henning (Berlin, Germany) or Calbiochem (San Diego, CA). [3'-125I]T3, [3',5'-125I]T4, and [3',5'-125I]rT3 (1500–2000 mCi/µmol) were either obtained from Amersham Pharmacia Biotech (Little Chalfont, Buckinghamshire, UK) or prepared by radioiodination of 3,5-T2, 3,3',5-T3, and 3,3'-T2, respectively, using the chloramine-T method, as previously described (22). Before each experiment, the radiolabeled iodothyronines were purified on Sephadex LH-20 columns (Amersham Pharmacia Biotech). Radioactive and nonradioactive sulfated rT3 (rT3S) and sulfated T3 (T3S) were prepared by reaction of rT3 or T3 with chlorosulfonic acid, as previously described (23). Radioactive N-bromoacetyl-T3 (BrAc[125I]T3) was synthesized from bromoacetylchloride and [3'-125I]T3, as previously described (24). Gold-thioglucose (GTG), iodoacetate (IAc), and reduced glutathione (GSH) were obtained from Sigma (St. Louis, MO). Dithiothreitol (DTT) was obtained from ICN Biochemicals Inc. (Costa Mesa, CA). Pyrococcus furiosus thermostable DNA polymerase (Pfu polymerase) and DpnI restriction endonuclease were obtained from Promega Corp. (Madison, WI). XL-10 ultracompetent Escherichia coli cells were obtained from Stratagene (La Jolla, CA). Synthetic oligonucleotides were ordered from Invitrogen-Life Technologies, Inc. (Paisley, UK). FuGENE 6 transfection reagent was obtained from Roche (Indianapolis, IN). Na2[75Se]O3 was purchased from the University of Missouri Research Reactor (Columbia, MO).

Halocynthia roretzi deiodinase (hrDx) cDNA
Two expressed sequence tag clones (148D06 and 194K18) were supplied by the National Institute of Genetics. These clones were produced as part of the MAGEST project (20, 21). The expressed sequence tag clones were contained in a pBluescript plasmid (Stratagene) and were sequenced to reveal two identical cDNAs of 1097 nucleotides each. An open reading frame of 780 nucleotides (259 amino acids) in length extended from nucleotide 15–794. Included in the open reading frame was an in-frame TGA (codon 133, nucleotides 411–413), which was predicted to code for SeC.

Construction of hrDx chimeric expression vector with rat D1 SeC insertion sequence (SECIS) element
The hrDx cDNA in pBluescript plasmid contained an in-frame HindIII restriction site at nucleotide 109–114, which was removed by site-directed mutagenesis without changing the deduced amino acid sequence.

The sense primer used was 5'-CTAGATACCTTGAAAGCGTACTATAAGAGATGGCGG (mutation underlined), and mutagenesis was performed according to the procedure described for the production of the cysteine (Cys) and alanine (Ala) enzyme mutants. Subsequently, the hrDx open reading frame was amplified with primers containing flanking HindIII sites (italicized), 5'-CAAGCTTGCCACCATGCATAACTTGTTGGAA (Kozak start consensus underlined) and 5'-CAAGCTTTTATTTCTTGAGAACAGC (stop codon underlined) and cloned in pGEM-T vector (Promega Corp.). To express and characterize the hrDx protein, we prepared chimeric constructs in which the hrDx coding region was inserted 5' to the SECIS element of the rat D1 gene. For this purpose, the G21-pcDNA3 rat D1 expression vector (25) was digested with HindIII, and the 6-kb DNA band containing vector DNA plus 0.7 kb of the rat D1 3' untranslated region (UTR; including the SECIS element) was isolated from a preparative agarose gel. The pGEM-T vector containing hrDx coding region was digested with HindIII, and the isolated fragment was cloned into the prepared rat D1-SECIS-pcDNA3 vector. The chimeric construct was sequenced (26) to verify that the hrDx coding region had been successfully inserted.

Construction of hrDx expression vector with endogenous SECIS element
Using the SECISearch 2.0 program (27), we identified a putative SECIS element in the 3'UTR (nucleotides 795-1097) of the hrDx cDNA. The hrDx cDNA was amplified with primers containing flanking EcoRI restriction sites (italicized), 5' CGAATTCGCCACCATGCATAACTTGTTGGAA (Kozak start consensus underlined) and 5' CGAATTCACTTCGTCTACTATTTGT, and cloned in pGEM-T vector. The pGEM-T vector was digested with EcoRI, and the isolated 1.1-kb fragment was cloned into the EcoRI site of the eukaryotic pSG5 (Stratagene) expression vector. The integrity of the construct was confirmed by plasmid sequencing (26).

Site-directed mutagenesis to produce Cys and Ala hrDx mutant enzymes
The chimeric expression vector containing the hrDx cDNA was used as a template for site-directed mutagenesis via the circular mutagenesis procedure, followed by selection for mutants by DpnI digestion (28). The hrDx wild-type sequence was changed using overlapping sense and antisense primers containing the nucleotide changes needed to produce the hrDxSeC133Cys (sense 5'-CGGATCTTGCTCCTGCCCCCCGTTTATGGCC) and the hrDxSeC133Ala (5'-CGGATCTTGCTCCGCACCCCCGTTTATGGCC) mutants (codon 133 underlined). Circular mutagenesis reactions were performed with 10 ng plasmid template and 2 U Pfu DNA polymerase (28). The cycling protocol consisted of 30 sec at 95 C, 1 min at 55 C, and 14 min at 68 C for 18 cycles using a model 480 PCR machine (Perkin-Elmer, Norwalk, CT). The products were incubated with 10 U DpnI for 2 h at 37 C and transformed to competent E. coli XL-10 cells according to manufacturer’s instructions. Plasmid DNA, which was isolated from several clones, was sequenced (26) to verify that the desired mutation had been generated and that no unwanted mutations were introduced. Plasmids were maintained in E. coli DH5{alpha} cells and purified for transfection with QIAfilter cartridges (Qiagen, Hilden, Germany).

Expression of hrDx protein
The wild-type and mutant hrDx enzymes were expressed in COS-1 cells (65 cm2 dishes) after diethylaminoethyl (DEAE)-dextran-mediated transfection (8 µg/dish) of the expression vectors (29). COS-1 cells were grown in DMEM-Ham’s F-12 medium containing 10% fetal calf serum (Life Technologies, Inc.) and 40 nM sodium selenite. Two days after transfection, the cells were rinsed with PBS and collected in 0.5 ml of 0.1 M phosphate (pH 7.2) and 2 mM EDTA buffer (P100E2 buffer), to which was added either no DTT or 1 mM DTT. Harvested cells were sonicated, aliquoted, and stored at -80 C. Protein concentrations were determined with the Bradford method (30) using the Bio-Rad (München, Germany) protein assay reagent and BSA as a standard. Alternatively, COS-1, CHO, and HEK-293 cells were transfected using FuGENE 6, a multicomponent lipid-based transfection reagent (31). Transfection reagent (12 µl) and plasmid DNA (4 µg) were incubated for 20 min at room temperature in serum-free medium (total volume, 200 µl). The mixture was then added to cell cultures in medium with 10% fetal calf serum. After 24 h, the cells were harvested as earlier described.

Subcellular localization of deiodinase activity
Two dishes of transfected cells were each harvested, as previously described, in hypotonic P10E2D1 buffer (10 mM phosphate, 2 mM EDTA, and 1 mM DTT; pH 7.2). The resulting cell suspensions (1 ml) were combined in a Potter tube, and the cells were homogenized on ice. An aliquot of this homogenate (0.2 ml) was removed and stored at -80 C. The remaining homogenate was spun at 1000 x g for 15 min at 4 C in a benchtop centrifuge. The resulting supernatant was spun at 100,000 x g for 60 min at 8 C in a tabletop ultracentrifuge (Beckman Optima TLX, TLA 120.1 rotor at 55,000 rpm; Global Medical Instrumentation, Inc., Albertville, MN). The pellets (1,000 g pellet = nuclear fraction and 100,000 g pellet = microsomal fraction) were resuspended in 0.25 ml P10E2D1 and were stored, as were the supernatants, at -80 C.

Assay of ORD activity in cell homogenates
Deiodinase activities were analyzed by quantitation of radioiodide released by ORD of [3',5'-125I]rT3 or [3',5'-125I]T4. Incubations contained about 100,000 cpm labeled rT3 or T4 with varying amounts of unlabeled substrate and cell homogenate in a final volume of 0.1 ml P100E2 buffer and varying amounts of DTT (1–10 mM). In some experiments, a pH profile was obtained using 0.1 M phosphate/2 mM EDTA buffers of pH 6.0, 7.0, and 8.0. Mixtures were incubated in duplicate for 60 min at 10, 20, or 37 C. Protein was adjusted to consume less than 30% of substrate, and in control experiments, it was determined that the deiodination rate was linear up to 60 min of incubation. Blank incubations were carried out with homogenates of nontransfected cells (protein blank). Reactions were stopped by the addition of 0.1 ml of 5% (wt/vol) BSA in water followed by the addition of 0.5 ml of 10% (wt/vol) trichloroacetic acid in water. After pelleting of the precipitated [125I]iodothyronines, [125I]iodide was further isolated from the supernatant by chromatography on LH-20 minicolumns, equilibrated, and eluted with 0.1 M HCl. Deiodinase activities were corrected for nonenzymatic deiodination observed in the protein blanks.

Assay of IRD activity in cell homogenates
This assay is based on the determination of product formation (125I-labeled rT3 or 3,3'-T2) by reverse-phase HPLC analysis of reaction mixtures containing outer-ring labeled [3'-125I]T3 or [3',5'-125I]T4 (32). Incubations contained about 200,000 cpm of labeled T3 or T4 with varying amounts of unlabeled substrate and cell homogenate in a final volume of 0.1 ml P100E2 buffer and varying amounts of DTT (1–10 mM). Mixtures were incubated for 60 min at 20 C; the reaction was then stopped by the addition of 0.1 ml ice-cold methanol. After centrifugation, the extract was mixed (1:1) with 0.02 M ammonium acetate (pH 4), and 0.1 ml (equivalent to 25 µl reaction volume) of the mixture was applied to a 250 x 4.6 mm Symmetry C18 column connected to an Alliance HPLC system (Waters Chromatography Division, Millipore Corp., Milford, MA) and eluted with a 15-min linear gradient of acetonitrile (25–42%) in 0.02 M ammonium acetate (pH 4) at a flow rate of 1.2 ml/min. Radioactivity in the eluate was monitored online using a Radiomatic A-500 flow scintillation detector (Packard, Meriden, CT).

Assay of deiodinase activity in intact transfected cells
COS or HEK cells were cultured in six-well plates (10 cm2/well) and were transfected with 2 µg plasmid per well either with the FuGENE method (31) or the DEAE-dextran method (29). One day after transfection, cell monolayers were washed with serum-free DMEM/F-12 medium and cultured for an additional 24 h at 37 C in serum-free DMEM/F-12 supplemented with 40 nM sodium selenite, to which was added 10 nM or 100 nM [3',5'-125I]T4, [3'-125I]T3, [3',5'-125I]rT3, or [3'-125I]T3S, and 106 cpm/ml of the respective tracer. After 21 h, the medium was harvested and extracted in ice-cold methanol (1:1). After centrifugation, the extract was mixed with 0.1 ml of 0.02 M ammonium acetate (pH 4), and 0.1 ml of the mixture was analyzed with the same HPLC system as described earlier. The column was eluted with a 20-min gradient of 24–29% acetonitrile, followed by a 6-min gradient of 29–50% acetonitrile in 0.02 M ammonium acetate (pH 4). This gradient provided improved separation of sulfated from nonsulfated iodothyronines.

Affinity labeling of hrDx protein with BrAc[125I]T3
BrAc[125I]T3 (1500 mCi/µmol) was synthesized as previously described (24), and HPLC analysis demonstrated that the purity was at least 85%, with unreacted [125I]T3 as the main contaminant. A solution of BrAc[125I]T3 (200,000 cpm, 0.06 pmol) in ethanol was pipetted into microcentrifuge tubes, and the solvent was evaporated under a stream of nitrogen. After the addition of 25 µl P100E2 buffer with 0–10 mM DTT and vortexing, the cell homogenates (100–150 µg protein) were added to a total volume of 50 µl P100E2 with no or 10 mM DTT. The mixtures were incubated for 20 min at 20 or 37 C. Reactions were stopped by the addition of SDS-PAGE gel-loading buffer, and samples were analyzed by SDS-PAGE (12% gel) followed by autoradiography to BioMax MS film (Kodak, Rochester, NY) at -70 C with intensifying screen.

Metabolic labeling of proteins with 75Se
HEK cells were cultured in DMEM/F-12 medium containing 10% fetal calf serum, without the usually added sodium selenite. After three passages, the cells were considered selenium depleted. HEK cells were cultured in six-well plates (10 cm2/well) and transfected with 2 µg chimeric expression vector plasmid using the FuGENE transfection reagent. Na2[75Se]O3 (1 µCi/well; specific activity, 6 Ci/mol) was added to transfected and nontransfected cells. After 24 h, the cells were washed with PBS and lysed by the addition of 450 µl SDS-PAGE gel-loading buffer with 10 mM DTT. Samples were vortexed and denatured for 5 min at 80 C, followed by centrifugation for 5 min at 1000 x g. Equal amounts of protein were loaded on 12% SDS-PAGE gels and processed for autoradiography to BioMax MS film (Kodak) at -70 C with intensifying screen (30-d exposure).

Assay of iodotyrosine deiodinase activity in tissue microsomal fractions and cell homogenates
This assay is based on the measurement of iodide (125I-) release from 125I-iodotyrosines by reduced nicotinamide adenine dinucleotide phosphate (NADPH)-dependent iodotyrosine deiodinase activity in thyroid or liver microsomal fractions (33, 34, 35, 36).

Labeled monoiodotyrosine (125I-MIT) was prepared by radioiodination of L-tyrosine by the chloramine-T method (22, 33, 37) and purified by chromatography on cation-exchange resin (Dowex 50WX2-200, Dow Chemical Co., Midland, MI), as previously described (33). Analysis by HPLC on a C18 reverse-phase column demonstrated that the preparation consisted of more than 98% 125I-MIT and trace amounts of 125I- and 125I-diiodotyrosine (DIT). Incubations contained 1 µM MIT (100,000 cpm of 125I-MIT) and porcine thyroid or liver microsomes (10–20 µg protein) in a final volume of 0.1 ml P100 buffer (0.1 M phosphate, pH 7.2). The reaction was started by the addition of NADPH (final concentration, 0.1 mM), and the mixture was incubated for 60 min at 37 C. The reaction was stopped by the addition of 0.1 ml of 5% BSA and 0.2 ml of 20% acetic acid on ice. The supernatant was applied to a 2-ml Dowex 50WX2-200 column, and the 125I- was eluted with 10% acetic acid as previously described (33). In several experiments, homogenates of hrDx-expressing cells (50–100 µg protein) were incubated with MIT at 20 or 37 C under similar conditions.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Halocynthia roretzi iodothyronine deiodinase homolog (hrDx)
The nucleotide and deduced amino acid sequences of the hrDx cDNA clone are shown in Fig. 1AGo, which shows an in-frame TGA stop codon probably encoding SeC incorporation. The core catalytic center of iodothyronine deiodinases is located in a region about 15 amino acids long, surrounding the essential SeC residue. This region is completely conserved between the vertebrate deiodinases and the ascidian hrDx (Fig. 1BGo). Alignment of hrDx with the partial deduced primary sequences of putative deiodinases from other ascidian species (Ciona intestinalis and Ciona savignyi) (19) also revealed high homology in the active site (Fig. 1CGo). To gain further insight into the evolutionary relationships between deiodinase proteins, an alignment and a phylogenetic tree were constructed using known full-length vertebrate deiodinase primary sequences as well as the full-length (hrDx) or partial ascidian sequences (Fig. 1Go, D and E). The phylogenetic tree shows distinct branches for the three vertebrate deiodinase subtypes (D1, D2, and D3). The ascidian deiodinase homologs are represented on a separate branch (Fig. 1EGo) due to the rather low (<30%) overall homology with the vertebrate deiodinases.




View larger version (120K):
[in this window]
[in a new window]
 
FIG. 1. Full-length cDNA and deduced amino acid sequence of Halocynthia iodothyronine deiodinase: comparisons with vertebrate iodothyronine deiodinases. A, Nucleotide and predicted amino acid sequence for the hrDx cDNA. The in-frame TGA codon is designated as coding for SeC incorporation. B, The deduced amino acid sequences comparing the core catalytic centers of human and Halocynthia roretzi iodothyronine deiodinases. C, Comparison of the deduced amino acid sequence of the hrDx protein with incomplete cDNA deiodinase homologs (19 ) from Ciona intestinalis (ciDx and ciDy) and Ciona savignyi (csDx and csDy). D, Comparison of the deduced amino acid sequence of the hrDx protein with the overall sequences of human (hsD1), chicken (ggD1), and tilapia (onD1) type I deiodinases, human (hsD2), chicken (ggD2), and killifish (fhD2) type II deiodinases, and human (hsD3), chicken (ggD3), and tilapia (onD3a) type III deiodinases. E, Phylogenetic tree of the known, complete deduced amino acid sequences of the vertebrate deiodinases and the hrDx deiodinase homolog prepared with the Clustal W program package. Abbreviations: xl, Xenopus laevis; gg, Gallus gallus; sm, Suncus murinus; cf, Canis familiaris; fc, Felis catus; hs, Homo sapiens; ss, Sus scrofa; rn, Rattus norvegicus; mm, Mus musculus; on, Oreochromis niloticus; om, Oncorhynchus mykiss; fh, Fundulus heteroclitus; tn, Tetraodon nigroviridis; tr, Takifugu rubripes; rc, Rana catesbiana; nf, Neoceratodus forsteri; dr, Danio rerio; cs, Ciona savignyi; ci, Ciona intestinalis; hr, Halocynthia roretzi.

 
Characterization of hrDx deiodinase chimeric construct after transfection of COS and HEK cells
Our initial experiments were performed with a chimeric expression vector construct consisting of the hrDx coding region and the rat D1 SECIS element (see Materials and Methods). To detect whether the hrDx protein was capable of deiodinating iodothyronines, COS cell homogenates (final, 0.17 mg protein/ml) were incubated with 1, 10, and 100 nM of the substrates T4, T3, and rT3 in P100E2 buffer with 10 mM DTT as reducing cofactor. Incubations were for 60 min at 37 or 20 C. Analysis by reverse-phase HPLC showed ORD of [125I]T4 to [125I]T3 and 125I-, and ORD of [125I]rT3 to [125I]3,3'-T2 and 125I- at 20 C, but not at 37 C. Deiodination amounted to 4–6% (data not shown). No significant IRD activity was detected. To further investigate the possibility of the presence of IRD activity, COS cell homogenates (final, 0.31 mg protein/ml) were incubated for 60 min with 1 and 100 nM of T4 or T3 at 20 C. At this higher protein concentration, analysis of the reaction products confirmed the presence of ORD activity and suggested a very small rate of IRD (<1% substrate consumption) of [125I]T4 to [125I]rT3 and [125I]T3 to [125I]3,3'-T2 (data not shown).

Because deiodinase activity appeared to be significant at 20 C and undetectable at 37 C after HPLC analysis of reaction products, the effect of incubation temperature on the hrDx enzyme activity was investigated in more detail. ORD of 0.1 µM rT3 was measured using incubation temperatures of 10, 20, 30, and 37 C by the release of 125I- (LH-20 assay; Fig. 2AGo). ORD activity was optimal between 20 and 30 C, and room temperature (20–22 C) was used for all further incubations. rT3 ORD was also measured at pH 6, 7, and 8 (Fig. 2BGo). Optimal deiodinase activity was measured with a 0.1-M phosphate buffer of pH 7, and this buffer was used for all further incubations.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 2. Effect of (A) temperature and (B) pH on deiodinase activity of the hrDx enzyme (COS cell expression) in the presence of 100 nM rT3 and 1 mM DTT. Each point is the mean of closely agreeing duplicate determinations, and the experiment was performed twice with similar results.

 
All iodothyronine deiodinases studied so far require a reducing cofactor for activity in vitro (17, 18). The identity of the endogenous cofactor is uncertain, but the most commonly used cofactor in vitro is the reductive compound DTT. COS cell extracts were incubated with 250 nM rT3 or 10 nM T4 and increasing concentrations of DTT (0, 1, and 10 mM; Fig. 3Go). Some net deiodinase activity was already measurable in the absence of added cofactor. Deiodinase activity was increased on incubation with 1 and 10 mM DTT, and there was little difference in activity between these two DTT concentrations. For further incubations, 1 mM DTT was used, and it was established that under these conditions (1 mM DTT, 20–22 C, pH 7) the deiodination rate is linear with time for at least 1 h.



View larger version (10K):
[in this window]
[in a new window]
 
FIG. 3. Effect of DTT on deiodinase activity of the hrDx enzyme (COS cell expression) in the presence of 250 nM rT3 and 10 nM T4. Each point is the mean of closely agreeing duplicate determinations, and the experiment was performed twice with similar results.

 
The presence of deiodinase activity in the absence of added cofactor could indicate that the hrDx enzyme is being stimulated by an endogenous cofactor still present in the cell homogenates. One such candidate for the endogenous cofactor (38, 39) of deiodinases is reduced GSH. Incubating COS cell homogenates with GSH (0.1–4 mM) resulted in a dose-dependent inhibition of deiodinase activity. Deiodination by hrDx with the lowest concentration of GSH (0.1 mM) was less than the deiodinase activity measured without added cofactor, and deiodinase activity was completely lost in the presence of 4 mM GSH (data not shown). Simultaneous addition of GSH, purified GSH reductase, and NADPH also did not increase deiodinase activity (not shown).

Selenoenzymes, such as iodothyronine deiodinases, are inhibited by organic gold compounds such as GTG, and the nucleophilic reagent IAc (17, 18, 38). The addition of 1–1000 nM GTG or 1–500 µM IAc induced dose-dependent inhibition of hrDx rT3 ORD activity (Fig. 4Go). Under the conditions used (0.1 µM rT3, 1 mM DTT), the IC50 value for GTG was about 80 nM, and the IC50 value for IAc was about 40 µM. Thiouracils, such as 6-n-propyl-2-thiouracil (PTU), irreversibly inactivate D1 from most species (17, 18, 40, 41). However, ORD of rT3 by hrDx enzyme was not inhibited by PTU (up to 1 mM PTU tested, data not shown).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. Sensitivity of the hrDx enzyme (COS cell expression) to the inhibitory effects of (A) IAc and (B) GTG on rT3 deiodination (100 nM rT3, 1 mM DTT). Values of 100% represent the results of control incubations performed on enzyme preparations in the absence of inhibitors.

 
Measurement of kinetics of rT3 ORD and T4 ORD
Increasing concentrations (0.1–4 µM) of unlabeled rT3 and T4 saturated hrDx ORD activity in COS cell homogenates. Similar results were obtained for the two substrates. Fifty percent inhibition of activity was achieved at about 4 µM. The enzyme kinetic parameters were calculated from Lineweaver-Burk plots (Fig. 5Go), and the results from individual transfections are summarized in Table 1Go. The apparent Km value was 2–3 µM for rT3 and 3–4 µM for T4. Transfection of cells using the FuGENE transfection reagent and subsequent analysis of rT3 and T4 ORD kinetics resulted in increased maximum velocity values, compared with the corresponding values after DEAE-dextran-mediated transfection.



View larger version (10K):
[in this window]
[in a new window]
 
FIG. 5. Kinetic analysis of hrDx deiodinase activity after transfection of the hrDx chimeric expression vector. Analysis by double reciprocal plot of rT3 or T4 deiodination and DEAE-mediated transfection of COS cells and of rT3 deiodination using FuGENE-mediated transfection of COS cells (all incubations in the presence of 1 mM DTT).

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Kinetic characterization of hrDx enzyme using the chimeric expression vector

 
Alternative iodothyronine substrates investigated
The IRD activity observed by reverse-phase HPLC analysis was too small to be characterized in detail using outer-ring labeled T4 or T3. Sulfate conjugates of iodothyronines are more efficiently deiodinated in the inner ring than the parent iodothyronines by D1 (38, 43). Therefore, the sulfated substrates [125I]T3S and [125I]rT3S were synthesized and tested for potential IRD activity. No IRD by the hrDx enzyme was detected using these sulfated substrates (0.01–0.1 µM T3S; 0.1–2 µM rT3S tested).

Other possible substrates for the hrDx that we tested included the T4 and T3 side-chain analogs tetraiodothyroacetic acid (Tetrac) and triiodothyroacetic acid (Triac). Tetrac and Triac are readily deiodinated by D1, especially in the inner ring (44). The ORD of [125I]rT3 (0.1 µM) by hrDx enzyme was not inhibited by 0.1–1 µM Tetrac or Triac.

Possible deiodination of the iodotyrosine deiodinase substrate MIT by hrDx
MIT and DIT, the main intermediates in thyroid hormone synthesis, are known to be deiodinated in the thyroid by a NADPH-dependent iodotyrosine deiodinase (33). Because MIT and DIT are present in extracts of the endostyle of ascidians (8), we decided to investigate whether hrDx could deiodinate MIT apart from the iodothyronine substrates T4 and rT3. Using established procedures (33, 34, 35, 36), NADPH-dependent deiodinase activity was demonstrated in porcine thyroid microsomal fractions (about 14 pmol I- released/mg·min) with 1 µM of 125I-MIT as substrate at 37 C. This activity was inhibited almost completely with 10 µM 3,5-dinitrotyrosine, as described previously (36). However, under similar conditions, no deiodination of MIT could be detected in homogenates made from cells expressing the hrDx enzyme during incubation at 20 or 37 C. Additionally, MIT was not deiodinated by hrDx in the presence of DTT.

Mutagenesis of the SeC residue in hrDx protein
To determine the importance of the SeC residue in the putative active site of the hrDx enzyme, we generated mutants in which Cys (hrDx Cys) or Ala (hrDx Ala) replaced SeC. The substitution of Cys for SeC essentially replaces the selenium of SeC with sulfur. Cells were transfected with expression vectors encoding the hrDx wild-type, hrDx Cys, or hrDx Ala proteins, and homogenates were analyzed for deiodinase activity. The hrDx Cys and hrDx Ala proteins were both inactive using rT3 (0.1–4 µM) as substrate, either after DEAE-dextran- or FuGENE-mediated transfection of COS cells.

75Se incorporation
Because no antiserum is yet available, we used incorporation of 75Se as an alternative approach to demonstrate synthesis of a full-length protein by transfected cells. After incubation of hrDx-transfected selenium-deficient HEK cells with Na275SeO3, followed by SDS-PAGE and autoradiography, several proteins labeled with 75Se were observed in the total cell lysate (Fig. 6Go). A labeled protein with a molecular mass of 30 kDa, which was not present in nontransfected cells, was observed in transfected HEK cells, indicating synthesis of full-length hrDx protein (predicted molecular mass = 29.6 kDa).



View larger version (72K):
[in this window]
[in a new window]
 
FIG. 6. Labeling patterns obtained by SDS-PAGE of homogenates prepared after incubation of transfected HEK 293 cells with Na275SeO3. Homogenates from nontransfected cells (lane 1) or cells transfected with the chimeric expression vector (lane 2) were analyzed. Molecular mass markers (kDa) are indicated.

 
Fractionation of cells expressing hrDx enzyme
Mammalian iodothyronine deiodinases are integral membrane proteins containing a single transmembrane domain in the N-terminal part (17, 18, 48).

The same computer programs that correctly predicted the transmembrane helix in the N terminus of mammalian deiodinases did not predict the presence of a transmembrane helix in hrDx enzyme (49), suggesting that the hrDx protein is a cytosolic enzyme.

To investigate this point, we fractionated COS and HEK cells expressing hrDx or rat D1 protein. Measurement of deiodinase activity in the crude homogenate, the nuclear fraction (1,000-g pellet), the mitochondrial/microsomal fraction (100,000-g pellet), and the cytosolic fraction consistently revealed that most deiodinase activity is associated with the nuclear and mitochondrial/microsomal fractions, whereas very little deiodinase activity was associated with the cytosolic fraction (Fig. 7Go). These results suggest that, like D1 (17, 18), hrDx protein is associated with the endoplasmic reticulum and/or plasma membrane.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 7. Subcellular localization of deiodinase activity in (A) hrDx transfected (chimeric construct) COS and HEK cells and (B) rat D1 transfected COS and HEK cells. The cells were fractionated as described in Materials and Methods. The deiodinase activity was measured in the homogenate, nuclear fraction (1,000-g pellet), mitochondrial/microsomal fraction (100,000-g pellet), and cytosolic fraction (100,000-g supernatant) after appropriate dilution.

 
Presence of SECIS element in 3'UTR of hrDx cDNA
Initially, it was thought that the 3'UTR of the hrDx cDNA did not contain a SECIS element, and therefore, a chimeric construct with the rat D1 SECIS element was produced. However, while these studies were underway, a new search program (SECISearch 2.0) became available (27). This program predicted the presence of a SECIS element in the 3'UTR (Fig. 8AGo). The SECIS element displayed the characteristic adenosine preceding the quartet of non-Watson-Crick base pairs, a UGA_GA motif in the quartet, and two adenosines in the apical loop, together forming the AUGA_AA_GA pattern (27, 50, 51). A second expression vector construct was made in which the full-length hrDx cDNA was inserted.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 8. A, SECIS element structure present in the hrDx gene 3'UTR between nucleotides 939-1030, as predicted by SECISearch analysis (27 ). The SECIS element displays the characteristic adenosine preceding the quartet of non-Watson-Crick base pairs, a UGA_GA motif in the quartet, and two adenosines in the apical loop. B, Lineweaver-Burk plots of T4 deiodination data in homogenates of COS, HEK, or CHO cells transfected (FuGENE method) with the hrDx full-length cDNA expression vector (endogenous SECIS). Deiodination occurred in the presence of 1 mM DTT. C, Lineweaver-Burk plots of rT3 deiodination at increasing DTT concentrations in homogenates of COS cells (FuGENE method of transfection with expression vector containing endogenous SECIS element). The maximum velocity and Km values at increasing DTT concentrations (0.1, 0.3, 1, and 3 mM) are 179, 277, 300, and 373 pmol/min·mg, respectively, and 1.2, 1.9, 2.0, and 2.6 µM, respectively.

 
The expression vector with the endogenous SECIS was transfected in COS-1, HEK293, and CHO cells, and homogenates were analyzed for ORD of T4 and rT3 (Fig. 8BGo and Table 2Go). It is clear that the hrDx protein expression vector with the endogenous hrDx SECIS element supports the synthesis of a functional deiodinase with similar kinetic characteristics as the hrDx protein expression vector with the rat D1 SECIS element (Tables 1Go and 2Go). It should be noted that for technical reasons different expression vectors were used (pcDNA3 or pSG5), so that a direct comparison of the efficiency of the rat D1 SECIS element vs. the Halocynthia Dx SECIS element in the various cell lines is not possible.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Kinetic characterization of hrDx enzyme obtained using the expression vector with endogenous SECIS

 
The deiodination reaction catalyzed by D1 follows ping-pong kinetics, indicating that the enzyme exists in two alternating forms induced by the reactions with substrate and reducing cofactor (38, 40). Deiodination by D2 and D3 follow sequential reaction kinetics, suggesting that the substrate and reducing cofactor must combine coincidentally with the enzyme to produce a reaction (29, 32, 40, 42). It is possible to differentiate between both mechanisms via analysis of kinetic data obtained at different reducing cofactor concentrations by Lineweaver-Burk plots (40). To determine the reaction mechanism of the hrDx enzyme, the cell homogenates were incubated with 0.1–3 mM DTT and increasing concentrations of rT3 (0.1–2 µM). Kinetic analysis (Fig. 8CGo) yielded a set of parallel lines, indicating that ORD of rT3 by hrDx enzyme follows ping-pong-type reaction kinetics.

By reverse-phase HPLC analysis of cell homogenates incubated with 1 µM 125I-T4, only 125I-T3 and 125I-, but no 125I-rT3, were detected. This indicates that the hrDx enzyme has no significant inner-ring deiodinase activity with T4 as the substrate.

The hrDx enzyme is most active in vitro in the presence of excess iodothyronine substrate and DTT when incubated at a temperature of 20 C (Fig. 2AGo). Considering that the cells are maintained and transfected with the hrDx expression vectors at 37 C, an important question is whether there is deiodinase activity in situ in intact cells. No deiodination products were detected by HPLC analysis of the cell culture medium after incubation of transfected COS cells (DEAE-dextran method with chimeric construct) for 24 h at 37 C with either 10 nM or 100 nM of [125I]T4, [125I]T3, [125I]rT3, and [125I]T3S. These experiments were repeated with the expression vector containing the endogenous hrDx SECIS (FuGENE transfection method). Upon incubation of cells with 10 nM or 100 nM [125I]-T4, deiodination products (125I- and [125I]T3, total deiodination < 10%) could be detected, indicating that the hrDx enzyme is active in situ (results not shown).

Affinity labeling with BrAc[125I]T3 has been used to specifically identify D1 and quantify expression levels in tissue microsomes and homogenates of transfected cells (45, 46, 47). Therefore, we investigated the possibility of using BrAc[125I]T3 or BrAc[125I]T4 to specifically label hrDx protein in cell homogenates. In several experiments using cell homogenates of DEAE-dextran or FuGENE transfected cells (chimeric construct) and incubation with BrAcT3/BrAcT4 at 20 or 37 C, no specific labeling could be detected. Only when using homogenates of COS cells transfected with the expression vector containing the endogenous SECIS element, a faint band of 30 kDa was detected after prolonged (5 d) exposure (data not shown). In control experiments performed by reverse-phase HPLC analysis of reaction products, as described previously (32), it was established that BrAc[125I]T3 was not deiodinated by hrDx enzyme (data not shown). Both with regard to the in situ deiodination and the BrAcT3/BrAcT4 labeling, the relatively high expression level obtained in COS cells using the pSG5 expression vector with the endogenous SECIS element (Table 2Go) was essential for the successful completion of these experiments.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ascidians have small, nonduplicated genomes that can be regarded as basic sets of chordate genes (19, 52). This makes their genomes an important focus in gene comparisons with the vertebrate lineage to gain more insight in the origins and evolution of chordates. Ascidians have the ability to concentrate iodine (3, 4) and synthesize thyroid hormones (5, 6, 7, 8), and thyroid hormone levels have been measured in tissues and blood (9, 10). Thyroid hormones might be involved in the metamorphosis of larvae into adults (1, 2). The genes that encode thyroid hormone-related functions, such as thyroid hormone deiodination, are of particular interest considering the important role thyroid hormones play in the development of vertebrates. The aim of the present study was to investigate the characteristics of iodothyronine deiodinase activity of a deiodinase homolog from the ascidian Halocynthia roretzi. This homolog was identified through the MAGEST database, which was created to examine maternal mRNA tag sequences and their expression in fertilized Halocynthia eggs (20, 21). Examination of the deduced amino acid sequence of hrDx showed that the overall homology of hrDx with other deiodinase proteins was not high (~30%). Approximately the same levels of homology can be found if one compares any one of the vertebrate deiodinases with any of the other vertebrate deiodinases. The catalytic center around the SeC residue was completely conserved, as it is in all deiodinase cDNA sequences known to date. Using the data for sequences from all known, complete deiodinase sequences, it was possible to construct a phylogenetic tree of the deiodinases. The tree resolves into three main clusters, containing the three vertebrate deiodinase subtypes. These clusters then further branch showing evolutionary distances between deiodinases within the vertebrate groups. The deiodinase sequence from Halocynthia roretzi forms a separate deiodinase group, branching close to the origin of the tree, highlighting the distance of this clone to other deiodinase sequences. The availability of the genomic sequences of two other ascidian species, Ciona intestinalis and Ciona savignyi, enabled us to search for homologs to the hrDx in these genomes. We have identified two partial sequences from each species that have high homology with hrDx, especially in the active site around the SeC residue. Interestingly, two deiodinase homologs have been identified in the genomes of the ascidians Ciona intestinalis (ciDx and ciDy) and Ciona savignyi (csDx and csDy), but no Dy variant has so far been identified in the Halocynthia roretzi genome. The fact that the ascidian enzymes are more closely related to each other than to the vertebrate enzymes suggests that the original deiodinase may have multiplied independently in the ascidian and vertebrate lineages.

Construction of a chimeric construct of the hrDx coding sequence with the rat D1 SECIS element successfully produced an enzyme that deiodinated iodothyronines. The use of chimeric constructs has previously been successful in a number of deiodinase cloning and expression studies (29, 41). The catalytic properties of hrDx expressed in COS cells were a mix of those characterizing D1 and D2. Like D2, the hrDx displayed predominantly ORD activity. However, both the substrate preference for rT3, followed by T4, and apparent Km values in the µM range (rT3, 2–3 µM and T4, 3–4 µM) were more like D1 properties. Like all vertebrate selenodeiodinases, the hrDx homolog was susceptible to inhibition by IAc and GTG, and the relatively high sensitivity to IAc in particular is a characteristic shared with D1 (53). However, the hrDx enzyme was insensitive to PTU, a characteristic of D2 and D3, although some D1’s, namely from fish, are also insensitive to inhibition by PTU (54, 55).

Various iodothyronine substrates were tested (rT3, T4, T3S, rT3S, Tetrac, and Triac), and only ORD activity with rT3 and T4 could be detected. In contrast to D1, sulfation did not stimulate deiodination. Also, the iodotyrosine substrates MIT and DIT are not substrates for hrDx enzyme. Recently, a preliminary report appeared describing a candidate iodotyrosine deiodinase gene cloned from human thyroid (56). This protein has no homology with the hrDx enzyme or vertebrate deiodinases.

The deiodinase activity of the hrDx enzyme was stimulated by the addition of the reducing cofactor DTT. Some deiodinase activity was detected in the absence of DTT, and it was thought that this was due to the presence of an endogenous cofactor in the cell homogenates. A naturally occurring monothiol compound, GSH, although much less effective as a deiodinase cofactor than dithiol compounds, also supports the deiodination of T4 by D1 in vitro (38, 39). In various experiments, we could not show stimulation of T4 or rT3 ORD by hrDx enzyme after the addition of up to 4 mM GSH. The nature of the in vivo cofactor remains elusive.

Under our in vitro assay conditions, the hrDx enzyme does follow the characteristic ping-pong (bi)substrate reaction kinetics that have been described for D1 (17, 18, 40). This is most apparent at rT3 concentrations of 0.5 µM or higher or, in other words, when more enzyme molecules become occupied with substrate. It is remarkable that the hrDx enzyme reaches maximal activity at much lower DTT concentrations (1 mM DTT) than the mammalian D1 enzyme (10 mM DTT).

The SeC residue in the catalytic center is essential for maximal catalytic efficiency of deiodinases (29, 32, 47, 55). To investigate the role of the SeC residue in the catalytic center of the hrDx enzyme, the SeC was replaced by Ala or Cys. Replacement of SeC with Ala resulted in the elimination of deiodinase activity. This result has been previously described for D1 (47), D2 (57), and D3 (32). An unexpected result was that substitution of Cys for SeC also inactivated the hrDx enzyme. The SeC to Cys mutants of vertebrate deiodinases are all enzymatically active, albeit much less and with different kinetic characteristics. In the case of D1, substitution of Cys for SeC results in a 3-fold increase in the apparent Km for rT3 and reduces the substrate turnover 100-fold (47). The mutation of SeC to Cys in D2 results in a 1000-fold increase in the Km for T4 and a 10-fold decrease in the substrate turnover (29, 57). For D3, it has been found that substitution of SeC with Cys results in a 100-fold increase in the apparent Km for T4 and a 2-fold decrease in the substrate turnover (32). The apparent inactivation of the hrDxCys mutant could be due to either a strong reduction in the substrate turnover number or a substantial increase in the apparent Km, resulting in activity beyond the sensitivity of our assay. It may be possible to demonstrate activity after overexpression and purification of the hrDx protein. Meanwhile, the inactivation of the hrDxCys enzyme highlights the importance of the SeC residue in the catalytic center of this enzyme.

Further evidence that hrDx is a selenoprotein was found after incubation of transfected cells with Na275SeO3. A labeled protein with an apparent molecular mass of 30 kDa was observed in transfected HEK cells, which corresponds in size to the predicted molecular mass. The presence of selenoprotein homologs have been recently identified in the genomes of the ascidians Ciona intestinalis and Ciona savingyi (27, 58). It was initially thought that the hrDx cDNA did not contain a SECIS element. However, while the experiments with the chimeric expression vector were underway, the possibility that the 3'UTR of the hrDx gene contains a SECIS element was raised after analysis with a newly developed SECIS search program (27). The significant ORD activity measured in homogenates of cells transfected with the hrDx expression vector containing the predicted Halocynthia SECIS element instead of the rat D1 SECIS element shows that the hrDx cDNA encodes a bona fide selenodeiodinase rather than an artificial enzyme, which could have been concluded from experiments with the chimeric expression vector.

An interesting feature of hrDx deiodinase activity was that the temperature optimum was 20–25 C, and almost no activity was measurable at 37 C. Even in tissue preparations from several poikilothermic animals, deiodinase activity is present at assay incubation temperatures as high as 37 C. In several tropical fish species, such as killifish (Fundulus heteroclitus), nile tilapia (Oreochromus niloticus), African catfish (Clarias gariepinus), and blue tilapia (Oreochromus aureus), maximal D1 and D3 activity is observed at 35–37 C (59, 60, 61, 62). In cold-water fishes, such as rainbow trout (Oncorhynchus mykiss) and turbot (Scophthalmus maximus), maximal D1 activity was observed at 25–30 C in liver and kidney homogenates (62). In reptiles, such as the turtle (Trachemys scripta) and the Mexican lizard (Sceloporus grammicus), deiodinase activity is stable over a wide thermal range (63, 64), or as in the case of the saltwater crocodile (Crocodylus porosus), it is maximal at narrow ranges of 25–30 C (D2) or 30–35 C (D1) (65). Stability of deiodinase activity over a wide thermal range in certain reptiles is in keeping with the thermal ranges in which these animals live. The phenomenon of maximal deiodinase activity at temperatures of 25 C or higher in the tissues of several fish species is as yet unexplained because these optima are usually higher than the temperature at which the fish are living. Because fish are poikilothermic, the in vivo catalytic activity is not only limited by substrate availability but also by water temperature. The same is probably true for Halocynthia roretzi, although the optimum temperature (20–25 C) is slightly lower. Nevertheless, all experiments were done at the optimum temperature under our in vitro conditions (20–22 C) because this provides maximum velocity values that are a true reflection of the activity with different substrates.

The hydropathy plot did not indicate that there were any hydrophobic membrane spanning domains in the N-terminal region of the hrDx protein. This suggested that the protein was not anchored in the plasma membrane or the membrane of the endoplasmic reticulum. The vertebrate deiodinases are membrane-integrated enzymes; for example, studies of the mammalian D1 have suggested that the N terminus is hidden in the lumen of the endoplasmic reticulum, with the major part of the protein exposed to the cytoplasm (48). The lack of transmembrane domains in the hrDx protein indicated that this enzyme may be soluble and a potential tool for overexpression of soluble protein and subsequent crystallographic studies. However, attempts to localize the deiodinase activity of hrDx by fractionation of transfected cells revealed that, like the rat D1, most of the deiodinase activity was associated with the nuclear fraction (1,000-g pellet) and the mitochondrial/microsomal fraction (100,000-g pellet). Negligible deiodinase activity was measured in the cytosolic fraction, indicating that the hrDx is a membrane-bound or membrane-associated protein. At the moment, we cannot exclude the possibility that this particular subcellular localization is an artifact of the overexpression in COS and HEK cells. We have not investigated the subcellular distribution pattern of hrDx protein by fractionation of Halocynthia tissue homogenates, and therefore, it is unknown whether the hrDx protein is also membrane bound in Halocynthia cells.

In this study, we have characterized enzyme activity in a deiodinase cDNA clone from Halocynthia roretzi. Important and interesting data may be collected on the distribution of the expression of this gene in the ascidian and at which life stages the gene is expressed. At the moment, hrDx-specific antibodies are not available, and therefore, detailed immunohistochemical studies of larva and adult animals are not possible. An obvious site for hrDx expression would be the endostyle. The ascidian endostyle is an iodine-sequestering strip of cells that secretes mucus into the pharyngeal feeding apparatus. Homologs of vertebrate thyroid peroxidase and thyroglobulin genes are expressed in the endostyle (3, 4, 6, 7, 8, 9, 11, 12, 13, 19). Given the significant homology with vertebrate deiodinases, especially in the catalytic site, as well as the ORD activity toward T4, it is likely that the hrDx enzyme is involved in the activation of the prohormone T4. Various studies have described the presence of T4 in ascidian larvae and its involvement in larval metamorphosis, as well as the presence of specific thyroid hormone receptors (1, 2, 14, 19). Experiments in which larval thyroid hormone receptor and/or iodothyronine deiodinase expression is blocked by RNA interference techniques (66) could provide more detailed insight in the role of T4 in Halocynthia metamorphosis.


    Acknowledgments
 
We thank Hans van Toor for synthesis of radiolabeled iodothyronines and Ronald van der Wal for assistance with DNA sequencing of plasmids.


    Footnotes
 
This work was supported by the Quality of Life Research Program of the European Union (Grant QLG3-CT-2000–00930).

The nucleotide sequence reported in this article has been submitted to the GenBank database with accession no. AY377937.

Abbreviations: BrAc[125I]T3, Radioactive N-bromoacetyl-T3; DEAE, diethylaminoethyl; DIT, diiodotyrosine; DTT, dithiothreitol; GSH, glutathione; GTG, gold-thioglucose; IAc, iodoacetate; IRD, inner-ring deiodination; MIT, monoiodotyrosine; NADPH, reduced nicotinamide adenine dinucleotide phosphate; ORD, outer-ring deiodination; PTU, 6-n-propyl-2-thiouracil; rT3, reverse T3; rT3S, sulfated rT3; SeC, selenocysteine; SECIS, selenocysteine insertion sequence; T2, diiodothyronine; T3S, sulfated T3; Tetrac, tetraiodothyroacetic acid; Triac, triiodothyroacetic acid; UTR, untranslated region.

Received September 18, 2003.

Accepted for publication November 26, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Patricolo E, Cammarata M, D’Agati P 2001 Presence of thyroid hormones in ascidian larvae and their involvement in metamorphosis. J Exp Zool 290:426–430[CrossRef][Medline]
  2. Patricolo E, Ortolani G, Cascio A 1981 The effect of l-thyroxine on the metamorphosis of Ascidia malaca. Cell Tissue Res 214:289–301[Medline]
  3. Thorpe A, Thorndyke MC, Barrington EJ 1972 Ultrastructural and histochemical features of the endostyle of the ascidian Ciona intestinalis with special reference to the distribution of bound iodine. Gen Comp Endocrinol 19:559–571[CrossRef][Medline]
  4. Dunn AD 1974 Ultrastructural autoradiography and cytochemistry of the iodine-binding cells in the ascidian endostyle. J Exp Zool 188:103–123[CrossRef][Medline]
  5. Kennedy GR 1966 The distribution and nature of iodine compounds in ascidians. Gen Comp Endocrinol 7:500–511[CrossRef][Medline]
  6. Suzuki S, Kondo Y 1971 Demonstration of thyroglobulin-like iodinated proteins in the branchial sac of tunicates. Gen Comp Endocrinol 17:402–406[CrossRef][Medline]
  7. Dunn AD 1980 Properties of an iodinating enzyme in the ascidian endostyle. Gen Comp Endocrinol 40:484–493[CrossRef][Medline]
  8. Barrington EJW, Thorpe A 1965 The identification of monoiodotyrosine, diiodotyrosine and thyroxine in extracts of the endostyle of the ascidian, Ciona intestinallis. Proc R Soc Lond B Biol Sci 163:136–149[Medline]
  9. Dunn AD 1980 Studies on iodoproteins and thyroid hormones in ascidians. Gen Comp Endocrinol 40:473–483[CrossRef][Medline]
  10. Fredriksson G, Lebel JM, Leloup J 1993 Thyroid hormones and putative nuclear T3 receptors in tissues of the ascidian, Phallusia mammillata cuvier. Gen Comp Endocrinol 92:379–387[CrossRef][Medline]
  11. Kobayashi H, Tsuneki K, Akiyoshi H, Kobayashi Y, Nozaki M, Ouji M 1983 Histochemical distribution of peroxidase in ascidians with special reference to the endostyle and the branchial sac. Gen Comp Endocrinol 50:172–187[CrossRef][Medline]
  12. Fujita H, Sawano F 1979 Fine structural localization of endogeneous peroxidase in the endostyle of ascidians, Ciona intestinalis. A part of phylogenetic studies of the thyroid gland. Arch Histol Jpn 42:319–326[Medline]
  13. Ogasawara M, Di Lauro R, Satoh N 1999 Ascidian homologs of mammalian thyroid peroxidase genes are expressed in the thyroid-equivalent region of the endostyle. J Exp Zool 285:158–169[CrossRef][Medline]
  14. Carosa E, Fanelli A, Ulisse S, Di Lauro R, Rall JE, Jannini EA 1998 Ciona intestinalis nuclear receptor 1: a member of steroid/thyroid hormone receptor family. Proc Natl Acad Sci USA 95:11152–11157[Abstract/Free Full Text]
  15. Wright GM, Youson JH 1976 Transformation of the endostyle of the anadromous sea lamprey, Petromyzon marinus L., during metamorphosis. I. Light microscopy and autoradiography with 125I. Gen Comp Endocrinol 30:243–257[CrossRef][Medline]
  16. Leloup J, Seugnet I 1989 In vivo thyroxine monodeiodination in the ascidian, Phallusia mamillata. Gen Comp Endocrinol 74:276–277
  17. Kohrle J 2002 Iodothyronine deiodinases. Methods Enzymol 347:125–167[Medline]
  18. Bianco AC, Salvatore D, Gereben B, Berry MJ, Larsen PR 2002 Biochemistry, cellular and molecular biology, and physiological roles of the iodothyronine selenodeiodinases. Endocr Rev 23:38–89[Abstract/Free Full Text]
  19. Dehal P, Satou Y, Campbell RK, Chapman J, Degnan B, De Tomaso A, Davidson B, Di Gregorio A, Gelpke M, Goodstein DM, Harafuji N, Hastings KE, Ho I, Hotta K, Huang W, Kawashima T, Lemaire P, Martinez D, Meinertzhagen IA, Necula S, Nonaka M, Putnam N, Rash S, Saiga H, Satake M, Terry A, Yamada L, Wang HG, Awazu S, Azumi K, Boore J, Branno M, Chin-Bow S, DeSantis R, Doyle S, Francino P, Keys DN, Haga S, Hayashi H, Hino K, Imai KS, Inaba K, Kano S, Kobayashi K, Kobayashi M, Lee BI, Makabe KW, Manohar C, Matassi G, Medina M, Mochizuki Y, Mount S, Morishita T, Miura S, Nakayama A, Nishizaka S, Nomoto H, Ohta F, Oishi K, Rigoutsos I, Sano M, Sasaki A, Sasakura Y, Shoguchi E, Shin-i T, Spagnuolo A, Stainier D, Suzuki MM, Tassy O, Takatori N, Tokuoka M, Yagi K, Yoshizaki F, Wada S, Zhang C, Hyatt PD, Larimer F, Detter C, Doggett N, Glavina T, Hawkins T, Richardson P, Lucas S, Kohara Y, Levine M, Satoh N, Rokhsar DS 2002 The draft genome of Ciona intestinalis: insights into chordate and vertebrate origins. Science 298:2157–2167[Abstract/Free Full Text]
  20. Kawashima T, Kawashima S, Kanehisa M, Nishida H, Makabe KW 2000 MAGEST: Maboya gene expression patterns and sequence tags. Nucleic Acids Res 28:133–135[Abstract/Free Full Text]
  21. Kawashima T, Kawashima S, Kohara Y, Kanehisa M, Makabe KW 2002 Update of MAGEST: Maboya gene expression patterns and sequence tags. Nucleic Acids Res 30:119–120[Abstract/Free Full Text]
  22. Visser TJ, Docter R, Hennemann G 1977 Radioimmunoassay of reverse tri-iodothyronine. J Endocrinol 73:395–396[Abstract/Free Full Text]
  23. Mol JA, Visser TJ 1985 Synthesis and some properties of sulfate esters and sulfamates of iodothyronines. Endocrinology 117:1–7[Abstract/Free Full Text]
  24. Mol JA, Docter R, Kaptein E, Jansen G, Hennemann G, Visser TJ 1984 Inactivation and affinity-labeling of rat liver iodothyronine deiodinase with N-bromoacetyl-3, 3', 5-triiodothyronine. Biochem Biophys Res Commun 124:475–483[CrossRef][Medline]
  25. Berry MJ, Banu L, Larsen PR 1991 Type I iodothyronine deiodinase is a selenocysteine-containing enzyme. Nature 349:438–440[CrossRef][Medline]
  26. Sheibani N, Frazier WA 1997 Miniprep DNA isolation for automated sequencing of multiple samples. Anal Biochem 250:117–119[CrossRef][Medline]
  27. Kryukov GV, Castellano S, Novoselov SV, Lobanov AV, Zehtab O, Guigo R, Gladyshev VN 2003 Characterization of mammalian selenoproteomes. Science 300:1439–1443[Abstract/Free Full Text]
  28. Sambrook J, Russell DW 2001 In vitro mutagenesis using double stranded DNA templates: selection of mutants with DpnI. In: Molecular cloning, a laboratory manual. Cold Spring Harbour, NY: Cold Spring Harbour Laboratory Press; 13.19–13.25
  29. Kuiper GG, Klootwijk W, Visser TJ 2002 Substitution of cysteine for a conserved alanine residue in the catalytic center of type II iodothyronine deiodinase alters interaction with reducing cofactor. Endocrinology 143:1190–1198[Abstract/Free Full Text]
  30. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  31. Faneca H, Simoes S, Pedroso de Lima MC 2002 Evaluation of lipid-based reagents to mediate intracellular gene delivery. Biochim Biophys Acta 1567:23–33[Medline]
  32. Kuiper GGJM, Klootwijk W, Visser TJ 2003 Substitution of cysteine for selenocysteine in the catalytic center of type III iodothyronine deiodinase reduces catalytic efficiency and alters substrate preference. Endocrinology 144:2505–2513[Abstract/Free Full Text]
  33. Rosenberg IN, Goswami A 1984 Iodotyrosine deiodinase from bovine thyroid gland. Methods Enzymol 107:488–500[Medline]
  34. Goswami A, Rosenberg IN 1979 Characterization of a flavoprotein iodotyrosine deiodinase from bovine thyroid. J Biol Chem 254:12326–12330[Abstract/Free Full Text]
  35. Goswami A, Rosenberg IN 1977 Studies on a soluble thyroid iodotyrosine deiodinase: activation by NADPH and electron carriers. Endocrinology 101:331–341[Abstract/Free Full Text]
  36. Green WL 1968 Inhibition of thyroidal iodotyrosine deiodination by tyrosine analogues. Endocrinology 83:336–347[Abstract/Free Full Text]
  37. Hussain AA, Jona JA, Yamada A, Dittert LW 1995 Chloramine-T in radiolabeling techniques. II. A nondestructive method for radiolabeling biomolecules by halogenation. Anal Biochem 224:221–226[CrossRef][Medline]
  38. Visser TJ 1988 Metabolism of thyroid hormone. In: Cooke BA, King RJB, van der Molen HJ, eds. Hormones and their action, part 1. Chap 6. Amsterdam: Elsevier Science Publishers; 81–103
  39. Visser TJ 1980 Deiodination of thyroid hormone and the role of glutathione. Trends Biochem Sci August:222–224
  40. Visser TJ, Kaplan MM, Leonard JL, Larsen PR 1983 Evidence for two pathways of iodothyronine 5'-deiodination in rat pituitary that differ in kinetics, propylthiouracil sensitivity, and response to hypothyroidism. J Clin Invest 71:992–1002
  41. Kuiper GGJM, Wassen F, Klootwijk W, Van Toor H, Kaptein E, Visser TJ 2003 Molecular basis for the substrate selectivity of cat type I iodothyronine deiodinase. Endocrinology 144:5411–5421[Abstract/Free Full Text]
  42. Kaplan MM, Visser TJ, Yaskoski KA, Leonard JL 1983 Characteristics of iodothyronine tyrosyl ring deiodination by rat cerebral cortical microsomes. Endocrinology 112:35–42[Abstract/Free Full Text]
  43. Visser TJ, Mol JA, Otten MH 1983 Rapid deiodination of triiodothyronine sulfate by rat liver microsomal fraction. Endocrinology 112:1547–1549[Abstract/Free Full Text]
  44. Rutgers M, Heusdens FA, Visser TJ 1989 Metabolism of triiodothyroacetic acid in rat liver. I. Deiodination of TA3 and TA3 sulfate by microsomes. Endocrinology 125:424–432[Abstract/Free Full Text]
  45. Kohrle J, Rasmussen UB, Ekenbarger DM, Alex S, Rokos H, Hesch RD, Leonard Jl 1990 Affinity labeling of rat liver and kidney type I 5'-deiodinase. Identification of the 27-kDa substrate binding subunit. J Biol Chem 265:6155–6163[Abstract/Free Full Text]
  46. Schoenmakers CH, Pigmans IG, Visser TJ 1992 Species differences in liver type I iodothyronine deiodinase. Biochim Biophys Acta 1121:160–166[CrossRef][Medline]
  47. Berry MJ, Maia AL, Kieffer JD, Harney JW, Larsen PR 1992 Substitution of cysteine for selenocysteine in type I iodothyronine deiodinase reduces the catalytic efficiency of the protein but enhances its translation. Endocrinology 131:1848–1852[Abstract/Free Full Text]
  48. Toyoda N, Berry MJ, Harney JW, Larsen PR 1995 Topological analysis of the integral membrane protein, type I iodothyronine deiodinase (D1). J Biol Chem 270:12310–12318[Abstract/Free Full Text]
  49. Tusnady GE, Simon I 2001 The HMMTOP transmembrane topology prediction server. Bioinformatics 17:849–850[Abstract/Free Full Text]
  50. Lescure A, Gautheret D, Carbon P, Krol A 1999 Novel selenoproteins identified in silico and in vivo by using a conserved RNA structural motif. J Biol Chem 274:38147–38154[Abstract/Free Full Text]
  51. Martin GW, Harney JW, Berry MJ 1998 Functionality of mutations at conserved nucleotides in eukaryotic SECIS elements is determined by the identity of a single non-conserved nucleotide. RNA 4:65–73[Abstract]
  52. Seo HC, Kube M, Edvardsen RB, Jensen MF, Beck A, Spriet E, Gorsky G, Thompson EM, Lehrach H, Reinhardt R, Chourrout D 2001 Miniature genome in the marine chordate Oikopleura dioica. Science 294:2506[Free Full Text]
  53. Visser TJ 1996 Pathways of thyroid hormone metabolism. Acta Med Austriaca 23:10–16[Medline]
  54. Orozco A, Villalobos P, Jeziorski MC, Valverde RC 2003 The liver of Fundulus heteroclitus expresses deiodinase type I mRNA. Gen Compar Endocrinol 130:84–91[CrossRef][Medline]
  55. Sanders JP, Van der Geyten S, Kaptein E, Darras V, Kuhn ER, Leonard JL, Visser TJ 1997 Characterization of a propylthiouracil-insensitive type I iodothyronine deiodinase. Endocrinology 138:5153–5160[Abstract/Free Full Text]
  56. Moreno JC 2003 Novel thyroid specific transcripts identified by SAGE: implications for congenital hypothyroidism, Thesis, University of Amsterdam, Amsterdam, The Netherlands (see also GenBank accession no. AY259176)
  57. Buettner C, Harney JW, Larsen PR 2000 The role of selenocysteine 133 in catalysis by the human type 2 iodothyronine deiodinase. Endocrinology 141:4606–4612[Abstract/Free Full Text]
  58. Gladyshev VN 2001 Identity, evolution and function of selenoproteins and selenoprotein genes. In: Hatfield DL, ed. Selenium, its molecular biology and role in human health. Boston: Kluwer Academic Publishers; 99–114
  59. Valverde C, Croteau W, Lafleur GJ, Orozco A, St Germain DL 1997 Cloning and expression of a 5'-iodothyronine deiodinase from the liver of Fundulus heteroclitus. Endocrinology 138:642–648[Abstract/Free Full Text]
  60. Sanders JP, Van der Geyten S, Kaptein E, Kuhn ER, Darras V, Visser TJ 1999 Cloning and characterization of type III iodothyronine deiodinase from the fish Oreochromis niloticus. Endocrinology 140:3666–3673[Abstract/Free Full Text]
  61. Mol KA, Van Der Geyten S, Darras VM, Visser TJ, Kuhn ER 1997 Characterization of iodothyronine outer ring and inner ring deiodinase activities in the blue tilapia, Oreochromis aureus. Endocrinology 138:1787–1793[Abstract/Free Full Text]
  62. Mol K 1996 A study of peripheral deiodination of thyroid hormones in fish, Thesis, Catholic University of Leuven, Leuven, Belgium
  63. Hugenberger JL, Licht P 1999 Characterization of thyroid hormone 5'-monodeiodinase activity in the turtle (Trachemys scripta). Gen Comp Endocrinol 113:343–359[CrossRef][Medline]
  64. Fenton B, Valverde RC 2000 Hepatic outer-ring deiodinase in a Mexican endemic lizard (Sceloporus grammicus). Gen Comp Endocrinol 117:77–88[CrossRef][Medline]
  65. Shepherdley CA, Richardson SJ, Evans BK, Kuhn ER, Darras VM 2002 Characterization of outer ring iodothyronine deiodinases in tissues of the saltwater crocodile (Crocodylus porosus). Gen Comp Endocrinol 125:387–398[CrossRef][Medline]
  66. Nagy A, Perrimon N, Sandmeyer S, Plasterk R 2003 Tailoring the genome: the power of genetic approaches. Nat Genet 33:276–284



This article has been cited by other articles:


Home page
EndocrinologyHome page
G. G. J. M. Kuiper, W. Klootwijk, G. Morvan Dubois, O. Destree, V. M. Darras, S. Van der Geyten, B. Demeneix, and T. J. Visser
Characterization of Recombinant Xenopus laevis Type I Iodothyronine Deiodinase: Substitution of a Proline Residue in the Catalytic Center by Serine (Pro132Ser) Restores Sensitivity to 6-Propyl-2-Thiouracil
Endocrinology, July 1, 2006; 147(7): 3519 - 3529.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
A. Heyland and L. L. Moroz
Cross-kingdom hormonal signaling: an insight from thyroid hormone functions in marine larvae
J. Exp. Biol., December 1, 2005; 208(23): 4355 - 4361.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shepherdley, C. A.
Right arrow Articles by Kuiper, G. G. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shepherdley, C. A.
Right arrow Articles by Kuiper, G. G. J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals