help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1046
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Houk, C. P.
Right arrow Articles by Teixeira, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Houk, C. P.
Right arrow Articles by Teixeira, J.
Endocrinology Vol. 145, No. 3 1269-1275
Copyright © 2004 by The Endocrine Society

Feedback Inhibition of Steroidogenic Acute Regulatory Protein Expression in Vitro and in Vivo by Androgens

Christopher P. Houk, Elliot J. Pearson, Nina Martinelle, Patricia K. Donahoe and Jose Teixeira

Pediatric Surgical Research Laboratories, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts 02114

Address all correspondence and requests for reprints to: Jose Teixeira, Pediatric Surgical Research Laboratories, Massachusetts General Hospital, 32 Fruit Street, Boston, Massachusetts 02114. E-mail: teixeira{at}helix.mgh.harvard.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Müllerian-inhibiting substance (MIS) reduces testosterone synthesis in Leydig cells by inhibiting cytochrome P450C17 hydroxylase/C17–20 lyase expression. However, in mouse Leydig MA-10 cells, MIS also enhances the cAMP-induced expression of mRNA for steroidogenic acute regulatory protein (StAR), which transports cholesterol to the inner mitochondrial membrane for conversion to pregnenolone. We hypothesized that the MIS-induced StAR expression is the indirect result of reduced testosterone synthesis in Leydig cells caused by MIS. We show that, in addition to MIS, flutamide, an androgen receptor antagonist, enhanced StAR mRNA expression when added to cAMP-treated MA-10 cells, whereas dihydrotestosterone, a potent androgen receptor agonist, attenuated these responses. Progesterone, dexamethasone, and estradiol also inhibited StAR mRNA expression. Addition of MIS to cAMP-treated MA-10 cells transfected with a StAR-promoter luciferase reporter resulted in increased StAR promoter activity over cAMP alone; this effect was inhibited by dihydrotestosterone, suggesting that androgens inhibit StAR mRNA expression at the transcriptional level. Androgen-mediated inhibition of StAR expression was also observed in primary Leydig cell culture and in vivo using both hypophysectomized mice and mice treated with the GnRH antagonist, acyline. These results suggest that the induction of StAR expression by MIS occurs secondary to the MIS-mediated reduction in testosterone synthesis by relieving a hitherto uncharacterized androgen-dependent feedback inhibition on StAR expression. These findings may impact future treatment strategies aimed at reducing androgen; for example, in the treatment of prostatic cancer, antiandrogen treatment might benefit from adjuvant therapy to inhibit StAR expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
STEROIDS ARE A DIVERSE class of hormones/signaling molecules that are synthesized in nearly all tissue types. The majority of steroids are synthesized in a group of specialized tissues that include the gonads, adrenals, liver, placenta, and brain from a common precursor, cholesterol, which serves as the backbone of the steroid molecule. The transport of cholesterol to the inner mitochondrial membrane, in which the initial steps of steroid hormone synthesis occur, forms the rate-limiting step in this process. Once delivered to the inner mitochondrial membrane, cholesterol is enzymatically converted to pregnenolone by cytochrome P450 side-chain-cleavage enzyme, which in turn is sequentially modified by a group of specialized enzymes to produce the diversity of steroid hormones required for a normal phenotype. The rate of cholesterol delivery and the cellular complement of the modifying enzymes govern the type and quantity of steroid synthesized (1).

The outer mitochondrial membrane poses no barrier to cholesterol; however, the space between the outer and inner mitochondrial membrane is aqueous and allows only the passage of water-soluble molecules, thereby forming an effective barrier to lipophilic compounds such as cholesterol. The 37-kDa protein, steroidogenic acute regulatory protein (StAR), overcomes this barrier by transporting cholesterol to the inner mitochondrial membrane (2). Upon trophic hormone binding to its receptor on steroidogenic cells and subsequent cAMP second messenger signaling, steroid hormone synthesis is induced by the acute induction of cholesterol transfer to the inner mitochondrial membrane by StAR activity and subsequently by an increase in expression of steroidogenic enzymes, including StAR.

Induction of StAR expression appears to occur through distinct pathways involving arachidonic acid release (3), cAMP-stimulated extracellular signal-regulated kinase (4) and protein kinase A (5), estradiol (6), and progesterone (7). Negative regulation of StAR expression has also been described for a number of other diverse factors (8). We have previously shown that Müllerian inhibiting substance (MIS, also known as anti-Müllerian hormone or AMH (9)] appears to augment the cAMP-mediated induction of StAR mRNA expression in MA-10 cells, a mouse Leydig cell line (10). MIS alone had no detectable effect on StAR mRNA expression, suggesting that MIS might be inducing StAR expression indirectly.

MIS, a member of the TGFß family of cytokines (11), is produced by the fetal Sertoli cells of the differentiating testes once the bipotential embryo commits to male development. MIS initiates a series of classic morphological events characteristic of apoptosis, resulting in regression of the Müllerian ducts, the anlagen of the uterus, Fallopian tubes, and upper vagina. However, in males MIS continues to be produced at relatively high levels until puberty and then at lower levels in both males and females after puberty, suggesting a postnatal role for MIS. Several studies have shown that MIS can inhibit steroidogenesis (12, 13, 14, 15, 16), follicle recruitment (17, 18), and cancer cell proliferation (19, 20, 21). Here we report that MIS indirectly induces StAR mRNA expression by reducing androgen levels, which normally exert a feedback inhibition on StAR expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemicals and reagents
Radionucleotides were purchased from Perkin-Elmer (Boston, MA). Waymouth’s MB 752/1 medium, gentamicin, and horse serum were purchased from Invitrogen Life Technologies, Inc. (Carlsbad, CA). Acyline [acetyl-D2Nal-D4CIPhe-D3Pal-Ser-Aph(Ac)-D-Aph(Ac)-Leu-Lys(Ipr)- Pro-D-Ala-NH2] was kindly provided by Drs. H. K. Kim and R. Blye (Contraception and Reproductive Health Branch, Center for Population Research, National Institute of Child Health and Human Development, Rockville, MD). Recombinant human chorionic gonadotropin (hCG) and RU-486 (mifepristone) were purchased from the National Hormone and Peptide Program (Harbor-University of California, Los Angeles Medical Center, Torrance, CA). All other chemicals were obtained from Sigma Chemical Co. (St. Louis, MO) or Fisher Scientific (Pittsburgh, PA) unless otherwise noted. MA-10 cells were from Dr. Mario Ascoli (University of Iowa, Iowa City, Iowa) (22). The mouse StAR cDNA and promoter plasmids were provided by Dr. Douglas Stocco (Texas Tech University, Lubbock, TX). Recombinant human MIS was expressed in Chinese hamster ovary cells and secreted into and purified from chemically defined serum-free media (23). RIAs were performed by the Massachusetts General Hospital Reproductive and Endocrine Sciences RIA core facility.

Cell culture
Mouse Leydig MA-10 cells were cloned and cultured in Waymouth MB752/1 growth medium containing 15% horse serum at 37 C in 5% CO2 in a humidified chamber as previously described (10) and plated at 2 x 106 cells per 100-mm dish on d 0. Culture medium was changed before the following overnight treatments: no treatment; 50 µM 8-bromoadenosine-cAMP (8Br-cAMP); 35 nM MIS; 100 nM flutamide; 65 µM RU-486; and estradiol, progesterone, and dihydrotestosterone (DHT) at the indicated concentrations. The concentration of RU-486 was chosen as a midway point between the 50- and 100-µM concentrations used in recent reports (24, 25). The following day the cells were rinsed and RNA was isolated using Trizol (Invitrogen) according to the manufacturer’s instructions.

Primary Leydig cells were harvested from two 60- to 75-d-old rat testes for each of three experiments (26). Decapsulated testes were treated with collagenase (0.5 mg/ml) in MEM with BSA for 20 min at 37 C. Seminiferous tubules were separated mechanically, and crude cells were collected by centrifugation at 300 x g for 8 min. Cells were washed twice in Hank’s buffered saline with BSA, and the cell suspension was layered on top of a discontinuous Percoll gradient (20, 40, 60, and 90% Percoll in Hank’s buffered saline). The Leydig cell fraction was further purified by a 60% Percoll gradient and centrifugation at 20,000 x g for 30 min at 4 C. Purified Leydig cells were plated on d 0 in 6-well plates in DMEM/F12 with 0.1% BSA and penicillin-streptomycin. Media were changed on d 1 before treatment, and RNA was collected after overnight treatment using micro-to-midi total RNA purification system (Invitrogen) according to the manufacturer’s instructions.

In vivo experiments
Intact and hypophysectomized 20- to 25-g male CD-1 mice were purchased from Charles River Laboratories (Wilmington, MA) and caged separately at least 1 d before they were subjected to treatment. Hypophysectomized mice that were either untreated or injected with 250 µg testosterone propionate in benzyl alcohol/benzoate im the day before being injected with 10 IU hCG ip1 h before mice were anesthetized for collection of peripheral blood by cardiac puncture and euthanized for harvest of their testes. Intact mice were injected with acyline (75 mg/kg) im 2 d before termination of the experiment, testosterone was injected im the following day, and hCG was injected ip 1 h before blood and testes were harvested. RNA was extracted from the testes in a tissue homogenizer with Trizol. Testosterone was measured in peripheral blood by RIA to confirm treatment efficacy. All animal protocols were approved by the Massachusetts General Hospital Institutional Animal Care and Use Committee.

Northern blot analyses and quantitative RT-PCR
Total RNA (10 µg) samples were denatured with dimethylsulfoxide and glyoxal at 65 C, separated in a 1.5% phosphate-buffered agarose gel, blotted overnight onto nylon membranes, and UV cross-linked. Blots were prehybridized with 100 µg/ml sonicated salmon sperm DNA in 50% formamide hybridization solution and hybridized overnight at 42 C with 2 x 106 cpm/ml of a random-primed mouse StAR cDNA probe (27). Blots were washed at 65 C with 0.1x saline sodium citrate (SSC) (1x SSC = 150 mM sodium chloride and 15 mM sodium citrate)-0.1% sodium dodecyl sulfate and exposed to radiographic film with intensifying screens at -70 C. Blots were reprobed with a human ß-actin riboprobe at 65 C and washed at 65 C with 0.1x SSC/0.1% sodium dodecyl sulfate as a control. Signal intensities, when indicated, were measured with a BAS1800II phosphor imager (Fuji Medical, Stamford, CT). Significance was determined by one-way ANOVA using the Bonferroni posttest with GraphPad Prism Software (San Diego, CA).

RNA isolated from primary Leydig cells was analyzed by quantitative real-time PCR in a SmartCycler (Cepheid, Sunnyvale, CA) with Invitrogen-designed LUX-primers. The sequences for rat StAR were GAACTTTGCACGCCATTGGAAG(FAM)TC and TCACAGCTAGTGGGAGACACTGC; sequences for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were CACGCTCTGGAAAGCTGTGGCG6G-JOE and AGCTTCCCGTTCAGCTCTGG. The RT-PCR was carried out with reagents from the platinum quantitative real-time PCR Thermoscript one-step system (Invitrogen). Each multiplex reaction contained 50 ng total RNA and 200 nM of each primer for both StAR and GAPDH. The reverse transcriptase reaction was done for 30 min at 60 C followed by PCR with 40 cycles with 95 C for 15 sec, 60 C for 30 sec, and 72 C for 60 sec. The concentration of mRNA was determined by calculating the change in threshold concentration for StAR from that of the untreated cells and normalizing by subtracting the threshold concentration of GAPDH of each, respectively, to generate {Delta}{Delta}Ct. The comparative expression level is given by taking 2{Delta}{Delta}Ct.

Luciferase experiments
MA-10 cells were plated at a density of 7.5 x 104 on d 0 in six-well plates and transfected with 1 µg total DNA using Fugene 6 on d 2. Cells were transfected with a -966-bp mouse StAR promoter, firefly luciferase reporter construct (28) in conjunction with a thymidine kinase promoter Renilla luciferase reporter to control for transfection efficiency. The following day, cells were either untreated or treated overnight with 50 µM 8Br-cAMP, 100 nM DHT, and 35 nM MIS as indicated. Cell lysates were harvested on d 4 and luciferase activity was measured using the dual luciferase system from Promega (Madison, WI). Experiments were performed in triplicate and repeated twice more. StAR promoter-driven luciferase activity was normalized to the Renilla luciferase activity, averaged, and plotted. Luciferase results were analyzed by ANOVA on the repeated measurements followed by the Newman-Keuls post hoc test with GraphPad software.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Androgens inhibit StAR mRNA expression in MA-10 Leydig cells
Using Northern analysis, we previously observed that the addition of 35 nM MIS along with 50 µM 8Br-cAMP to MA-10 Leydig cells resulted in a reproducible increase in StAR mRNA expression over that seen with cAMP alone (10). However, in those same experiments, treatment with MIS alone appeared to have no detectable effect on StAR expression. We hypothesized that the effect of MIS was indirect either by synergizing with the cAMP-activated pathway or suppressing an inhibitor of StAR expression, perhaps testosterone, which is markedly reduced after addition of MIS to MA-10 cells. We tested the latter possibility by determining whether inhibition of androgen receptor activity by the nonsteroidal antiandrogen, flutamide, affected StAR mRNA expression (Fig. 1AGo). In the absence of cAMP, neither the 3.4- nor the 1.6-kb mRNAs, the major StAR mRNA isoforms in MA-10 cells, were detectable by Northern analyses, but following overnight incubation with 50 µM 8Br-cAMP, there was a striking increase in the expression of these StAR transcripts. In cDNA microarray experiments, the induction of StAR mRNA expression by cAMP can be as high as 35-fold, making StAR one of the most strongly induced (not shown) mRNAs detected in MA-10 cells. Addition of flutamide to the cAMP-stimulated cells resulted in a further increase in StAR mRNA expression over that of cAMP alone, similar to that observed with MIS treatment. Incubation of the cAMP-stimulated cells with both flutamide and MIS increased StAR mRNA expression further still. We observed that MIS lowers cAMP-stimulated testosterone synthesis in MA-10 cells to between 9 and 22% of that with cells stimulated with cAMP alone (10). These results suggest that flutamide acts by inhibiting the ability of the remaining testosterone to bind to its receptor and inhibit StAR expression.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 1. StAR mRNA expression in MA-10 Leydig cells is increased by MIS and flutamide and decreased by DHT. Cells were treated as indicated with (A) 100 nM flutamide, 35 nM MIS or both, (B) the indicated concentration of DHT, 2 h before overnight treatment with 50 µM 8Br-cAMP. C, Cells were pretreated with 100 nM DHT before addition of cAMP, MIS, and flutamide, as indicated. Total RNA was harvested for Northern analysis of StAR mRNA expression with a 32P-labeled murine random-primed DNA probe. A representative blot of at least three repeated experiments is shown with the sizes of the two major StAR mRNA transcripts as indicated. Blots reprobed with ß-actin as a control are shown below the StAR blots.

 
If flutamide can augment the cAMP-induced expression of StAR mRNA, then one would expect that addition of a potent androgen, such as DHT would have the opposite effect. Indeed, addition of cAMP to cells pretreated with increasing concentrations of DHT showed a decreasing expression of StAR mRNA (Fig. 1BGo). This effect was seen with concentrations as low as 1 nM DHT, which showed a more pronounced inhibitory effect on the 1.6-kb StAR mRNA transcript. Taken together, these results strongly suggest that the androgen-mediated effects on StAR mRNA expression involved the androgen receptor. We also examined whether DHT could affect the induction of StAR mRNA expression by MIS and flutamide (Fig. 1CGo). Addition of DHT to the cells before treatment with cAMP and MIS was able to inhibit the superinduction of StAR expression by MIS and flutamide to a level that was closer to that observed with cAMP alone. The reversal of the induction in StAR expression by MIS with addition of androgens suggests that MIS is affecting StAR expression by reducing androgen production and is not acting through an alternative pathway.

Regulation of StAR mRNA expression by other steroid hormones
To determine whether inhibition of StAR mRNA expression was specific to DHT, we also assessed whether the addition of progesterone, dexamethasone, or estradiol had any effect on StAR expression in MA-10 cells. The effect of these steroids on StAR expression has been previously reported by others in different systems (3, 6, 7), which persuaded us to examine their effect with overnight treatment of MA-10 cells. Overnight incubation of MA-10 cells with 100 nM progesterone alone had no effect on StAR mRNA expression but, when added in combination with cAMP, increasing concentrations of progesterone could have an increasingly negative effect on StAR expression (Fig. 2AGo). In contrast, RU-486, a progesterone receptor antagonist, mitigated the level of inhibition of StAR expression by progesterone, induced StAR expression if added alone, and greatly enhanced cAMP-induced StAR expression (Fig. 2BGo). In the presence of cAMP and RU-486, addition of 100 nM progesterone resulted in a decreased StAR mRNA. Inhibition of cAMP-induced StAR mRNA expression was observed with added dexamethasone (Fig. 2CGo) and more strongly with estradiol (Fig. 2DGo), neither of which resulted in a detectable change in StAR expression alone. These results suggest that feedback inhibition of StAR expression may be a common mechanism for many steroids.



View larger version (67K):
[in this window]
[in a new window]
 
FIG. 2. StAR mRNA expression in MA-10 cells is also regulated by other nuclear steroids. Cells were treated with the indicated concentrations of progesterone, P4 (A), 65 µM RU-486 (B), dexamethasone, Dex (C), or estradiol, E2 (D) 2 h before overnight treatment with 50 µM 8Br-cAMP. Total RNA was harvested for Northern analysis of StAR expression. A representative blot of at least three repeated experiments for each treatment is shown with the sizes of the two major StAR mRNA transcripts as indicated. As a control, blots reprobed with ß-actin are shown below the StAR blots.

 
StAR expression is inhibited by androgens at the transcriptional level
Classically, steroid hormones act by binding to their nuclear hormone receptors, which then bind to their cognate DNA elements and subsequently modulate transcription of regulated genes. Recently, however, a nongenomic role for some of these DNA binding receptors has been shown, most notably attributed to the estrogen receptors but also to the androgen and progesterone receptors (29, 30, 31). By sequence analysis, we detected three putative androgen-responsive elements (AREs) half-sites in the cAMP-responsive murine proximal StAR promoter (32), which suggested a potential mechanism for the observed androgen effect (Fig. 3Go). Therefore, we examined whether the inhibition of StAR mRNA expression occurred at the transcriptional level by using a -966-bp murine StAR promoter fragment to drive the expression of a firefly luciferase reporter (Fig. 3CGo). Addition of 50 µM 8Br-cAMP resulted in a variable increase in luciferase activity, which averaged 4.2-fold, over both untreated cells (not shown) and cells treated with ethanol, the vehicle control. Although the addition of 100 nM DHT to cAMP treatment lowered the fold induction of luciferase activity to approximately 2.8-fold, this difference was not statistically significant due to the variable degree of induction by cAMP. Corroborating the StAR mRNA Northern analyses, addition of 35 nM MIS to cAMP treatments induced a 10-fold increase in luciferase activity over untreated cells. This 10-fold induction was significantly inhibited when the cells were coincubated with DHT, indicating that DHT acts at the transcriptional level to repress StAR promoter activity.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 3. Androgens repress the MIS-mediated increase in cAMP-stimulated StAR expression at the transcriptional level. MA-10 cells were transiently transfected with a thymidine kinase promoter-driven Renilla luciferase control and a StAR/Luc-966 luciferase reporter construct, which is schematically depicted with steroidogenic factor-1 and putative ARE half-sites shown (A). The consensus ARE and the sequences and locations of the three putative sites are shown in B. Forty-eight hours after transfection, the medium was replaced and the cells were treated with 100 nM DHT, 35 nM MIS, or both 2 h before overnight treatment with 50 µM 8Br-cAMP. Protein lysates were harvested and StAR promoter activity was measured and normalized to the Renilla luciferase activity. Fold inductions were calculated by normalizing to ethanol-treated transfected cells. The results were plotted (C) and represent the mean values from three independent experiments performed in triplicate (error bars reflect SEM). *, Significantly different, P < 0.05.

 
Androgens inhibit testicular StAR mRNA expression in vivo directly on Leydig cells
We also evaluated whether the inhibition of StAR expression by androgens could also be observed in primary Leydig cell cultures (Fig. 4AGo). We observed a variable increase in StAR mRNA expression after overnight treatment of purified rat Leydig cells with cAMP, which ranged from 12- to greater than 30-fold but averaged approximately 20-fold. Addition of DHT to the cells also resulted in a variable effect on cAMP-induced StAR expression, which was lowered to approximately 14-fold. Because of the varying degrees of stimulation and inhibition, statistical significance between the treatments was not observed in these three replicates (P < 0.0523, Bonferroni-Dunn post hoc test).



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 4. Testosterone inhibits StAR expression in mouse primary Leydig cell culture and in testes. A, Primary Leydig cells were either untreated (NT) or treated overnight with 50 µM 8Br-cAMP alone or 100 nM DHT (C+DHT). Total RNA was collected and analyzed by quantitative RT-PCR for StAR and GAPDH mRNAs from three separate experiments. The resultant threshold values were normalized to untreated cells, converted to fold inductions, averaged, and plotted. B, Untreated hypophysectomized mice (NT) were compared with mice treated with 1 h exposure to recombinant hCG alone or overnight testosterone and 1 h exposure to hCG (T+hCG). RNA from the testes of individual mice is shown in each lane. Testes were harvested for isolation of total RNA, which was used for Northern analysis of StAR mRNA. Only the 3.4-kb StAR mRNA transcript is shown. Blots reprobed with actin to control for loading are shown below the StAR mRNA blots. C, The signal intensities of the Northern blots with RNA from the hypophysectomized mice experiment were analyzed by phosphorimaging. StAR mRNA values were normalized to their corresponding actin mRNA values, averaged, and the ratio plotted. D, Mice were injected with acyline (A) 2 d before hCG stimulation (A+hCG) and with testosterone the day before (A+T+hCG). Testes were harvested and analyzed by Northern analyses as above. E, The blots from the acyline-treated mice were also analyzed by phosphorimaging as above. Error bars represent SE and significant differences (P < 0.05) between values are shown with the same letter, a or b.

 
We then assessed the physiological significance of the in vitro androgen-mediated inhibition of StAR mRNA expression with MA-10 Leydig cells in vivo. In an animal with an intact hypothalamic-pituitary-gonadal axis, the GnRH pulse generator-regulated pituitary LH secretion is increased or decreased to compensate for any change in serum testosterone levels. To avoid the confounding effects of this compensatory mechanism, two different models, hypophysectomized mice and mice injected with the GnRH analog and antagonist acyline (33), were employed to study the effect of administered androgens on testicular StAR mRNA expression.

Hypophysectomized male mice were treated overnight with 250 µg testosterone and injected the following day with 10 IU hCG 1 h before testes were harvested. By Northern blot StAR mRNA expression in testes was detected and is shown as single band at approximately 3.4 kb (Fig. 4BGo). The other 1.6- and 2.7-kb bands were observed in the hCG-treated mice with a longer exposure of the blot but were not as prominent as in MA-10 cells (not shown). Hypophysectomized mice that were injected with hCG alone averaged a 10-fold higher level of StAR mRNA expression than did untreated mice. In mice that were previously injected with testosterone, hCG-stimulated StAR expression was lower than that in mice hCG alone and only 30% higher than in untreated mice (Fig. 4CGo).

To avoid the morbidity observed in some mice after hypophysectomy, we also used acyline-treated mice to inhibit pituitary gonadotropin secretion to assess the effects of exogenous testosterone on hCG-stimulated testicular StAR expression (Fig. 4DGo). Mice were injected with acyline 1 d before injection with testosterone and 2 d before injection with hCG. Mice that were injected with acyline showed approximately one tenth the average StAR mRNA expression of control untreated mice (not shown). StAR mRNA expression was significantly induced by an average greater than 3-fold in mice injected with acyline and hCG over those injected with acyline alone (Fig. 4EGo). If the mice were also injected with testosterone the day before hCG, then the average expression of StAR mRNA was significantly reduced and nearly equal to mice that were injected with acyline alone. Taken together, these results strongly suggest that testosterone acts directly on Leydig cells to inhibit the expression of StAR mRNA.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MIS and MIS type II receptor mRNA expression peak at stages VI and VII of the spermatogenic cycle in rat Sertoli cells (34), and MIS type II receptor knockout mice undergo focal atrophy of the germinal epithelium (35). We hypothesized that MIS influences androgen production and subsequent spermatogenesis by altering the local steroid environment in the seminiferous tubule. During the course of our studies examining the regulation of steroidogenesis by MIS, we observed that MIS induced cAMP-stimulated StAR mRNA expression in MA-10 cells but had no effect alone, which led us to suspect that the effect was indirect. This stimulatory effect on StAR expression stood in sharp contrast to the inhibitory effect of MIS on unstimulated and cAMP-stimulated Cyp17 mRNA expression. Here we show an androgen-dependent feedback inhibition on cAMP-stimulated StAR expression, which was unmasked by the reduction in testosterone caused by the MIS treatment of MA-10 cells (Fig. 5Go).



View larger version (7K):
[in this window]
[in a new window]
 
FIG. 5. Feedback inhibition of StAR mRNA expression. The inhibition of StAR expression by testosterone in Leydig cells, which can be alleviated by the inhibition of Cyp17 expression with added MIS, is shown schematically. Understanding the feedback effect of testosterone may influence future treatment strategies for prostate cancer and excess androgen states.

 
Our results with the StAR promoter/luciferase reporter experiments (Fig. 3Go) suggest that androgens inhibit StAR expression at the transcriptional level. We have identified three possible ARE half-sites in the proximal StAR promoter by sequence analysis and have begun to determine whether these sites are necessary for androgen- and possibly progesterone-mediated inhibition of StAR expression. However, natural AREs show a remarkable degree of divergence from the purported consensus (36) and identification of the androgen-responsive cis-region of the StAR promoter will likely require detailed deletion and mutation studies as well. Recent evidence suggests that the acute regulation of StAR expression requires a cAMP-responsive element binding protein family member to bind to the cAMP-responsive element half-sites within the proximal StAR promoter (5). Investigating the interplay between the activation of the StAR promoter by trophic hormones and its feedback inhibition by the end products of steroidogenesis should prove engaging.

Whereas steroid hormone-induced feedback inhibition on steroidogenic enzymes expression in Leydig cells has been known for some time (37), the effect of steroids on StAR expression has not been well characterized. The in vitro and in vivo demonstration that testosterone directly inhibits StAR expression in Leydig cells suggests an autocrine mechanism through which steroid hormones can regulate their own production at the crucial, rate-limiting step of cholesterol transfer to the inner mitochondrial membrane. This feedback may provide a local mechanism for modulating Leydig cell steroidogenesis in addition to the well-known feedback inhibition of sex steroids on the hypothalamic-pituitary axis to suppress gonadotropin secretion.

Our results showing inhibition of StAR expression with dexamethasone is consistent with previous reports (3, 24). We also observed that progesterone alone has no effect on basal StAR mRNA but can inhibit cAMP-stimulated StAR expression in MA-10 cells (Fig. 2AGo). In contrast to dexamethasone and estradiol, the degree of inhibition observed with added progesterone was variable and is likely dependent on the levels of endogenously produced progesterone, which can range greatly in MA-10 cells, from 15 to 450 nM in the medium (10). These findings are at odds with a recent report showing a progesterone-induced StAR expression in the absence of cAMP at a concentration of 10 µg/ml or 32 µM and no effect of progesterone on cAMP-stimulated StAR mRNA expression (7). Paradoxically but consistent with an inhibitory role for progesterone, RU-486, a progesterone receptor antagonist, also induced StAR expression (7), which we observed as well (Fig. 2Go). These different results between our respective laboratories may be due to a phenotypic change in the MA-10 cells in culture; more likely, however, they could reflect the overnight treatment with a much lower concentration of progesterone, compared with that used in the previous report, suggesting that the steroids might have biphasic effects that depend on concentrations or duration of exposure. A thorough investigation of these possibilities, including in vivo studies, would greatly advance our understanding of the roles played by steroid hormones in regulating StAR expression.

The increase in cAMP-mediated StAR expression observed in MA-10 cells after MIS treatment may also help explain the increase in progesterone measured in the media of these cells (10). The reduction in the normal androgen feedback inhibition of StAR expression in the presence of MIS may produce a compensatory increase in inner mitochondrial membrane cholesterol transport and the subsequent production of progesterone. Because we did not observe any significant change in hCG-stimulated serum or testicular progesterone concentrations in mice that were also treated with MIS (16), this increase in progesterone production may be an in vitro effect unique to MA-10 cells. Also, in male mice, serum progesterone appears to be synthesized largely by the adrenal (38). The effect, if any, of androgens on StAR expression in other steroidogenic tissues such as the adrenal has yet to be determined.

These studies may have broad implications for antiandrogen therapies that block either testosterone synthesis or androgen receptor activity and may also suggest a mechanism for development of androgen-independent prostatic cancer. If StAR expression is feedback inhibited by androgens in humans as we have shown in mice, then one might speculate that upon inhibition of Cyp17 activity, StAR expression might increase and result in greater pregnenolone and progesterone synthesis. The androgen receptor ligand-binding domain is promiscuous and can translocate to the nucleus to activate transcription of reporter genes in the presence of progesterone (39). Therefore, the inhibition of testosterone synthesis with its subsequent induction of StAR expression could still result in low-level androgen receptor-mediated transcriptional activity, particularly if relatively higher levels of progesterone ligand are required for inhibition of StAR expression. Similarly, inhibiting the androgen receptor with antiandrogens such as flutamide also results in increased StAR expression, progesterone synthesis, and the subsequent activation of other nuclear hormone receptors such as the progesterone or glucocorticoid receptor. Many androgen-responsive genes can also be induced by these receptors (36), mitigating the therapeutic value of antiandrogens and possibly rendering the proliferation of the cells androgen independent. Our studies suggest that, with the exception of cases with constitutively elevated cAMP, as is found in McCune-Albright syndrome, inhibiting LH production with GnRH antagonists, which would result in a lack of StAR expression, is a more effective method of controlling androgen signaling. Clearly, the possible role of StAR in the management of excess androgen states needs further investigation.


    Acknowledgments
 
We thank Dr. Douglas Stocco for his generosity in providing the murine StAR cDNA and -966 promoter luciferase reporter. We would also like to thank Dr. Frances Hayes (Massachusetts General Hospital) for the acyline, GnRH antagonist, and Dr. Patrick M. Sluss (Massachusetts General Hospital) for the RIA assays. We are grateful for the critical reviews of the manuscript by Drs. William Crowley and Shyamala Maheswaran.


    Footnotes
 
This work was supported by a fellowship from the National Institute of Child Health and Human Development (F32-HD41835) (to C.P.H.) through a cooperative agreement (U54 HD28138) as part of the Specialized Cooperative Centers Program in Reproduction Research (to J.T. and P.K.D.), by National Cancer Institute (R29-CA79459) (to J.T.) and (R01-HD32112) (to P.K.D.).

Abbreviations: ARE, Androgen-responsive element; 8Br-cAMP, 8-bromoadenosine-cAMP; Cyp17, cytochrome P450 C17 hydroxylase/C17–20 lyase; DHT, dihydrotestosterone; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hCG, human chorionic gonadotropin; MIS, Müllerian-inhibiting substance; SSC, saline sodium citrate; StAR, steroidogenic acute regulatory protein.

Received August 12, 2003.

Accepted for publication November 12, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. O’Malley BW, Strott CA 1999 Steroid hormones: metabolism and mechanism of action. In: Yen SCC, Jaffe RB, Barbieri RL, eds. Reproductive endocrinology. 4th ed. Philadelphia: WB Saunders Co.; 110–133
  2. Stocco DM 2001 Tracking the role of a star in the sky of the new millennium. Mol Endocrinol 15:1245–1254[Abstract/Free Full Text]
  3. Wang X, Walsh LP, Reinhart AJ, Stocco DM 2000 The role of arachidonic acid in steroidogenesis and steroidogenic acute regulatory (StAR) gene and protein expression. J Biol Chem 275:20204–20209[Abstract/Free Full Text]
  4. Gyles SL, Burns CJ, Whitehouse BJ, Sugden D, Marsh PJ, Persaud SJ, Jones PM 2001 ERKs regulate cyclic AMP-induced steroid synthesis through transcription of the steroidogenic acute regulatory (StAR) gene. J Biol Chem 276:34888–34895[Abstract/Free Full Text]
  5. Manna PR, Dyson MT, Eubank DW, Clark BJ, Lalli E, Sassone-Corsi P, Zeleznik AJ, Stocco DM 2002 Regulation of steroidogenesis and the steroidogenic acute regulatory protein by a member of the cAMP response-element binding protein family. Mol Endocrinol 16:184–199[Abstract/Free Full Text]
  6. Townson DH, Wang XJ, Keyes PL, Kostyo JL, Stocco DM 1996 Expression of the steroidogenic acute regulatory protein in the corpus luteum of the rabbit: dependence upon the luteotropic hormone, estradiol-17ß. Biol Reprod 55:868–874[Abstract]
  7. Schwarzenbach H, Manna PR, Stocco DM, Chakrabarti G, Mukhopadhyay AK 2003 Stimulatory effect of progesterone on the expression of steroidogenic acute regulatory protein in MA-10 Leydig cells. Biol Reprod 68:1054–1063[Abstract/Free Full Text]
  8. Stocco DM 2001 StAR protein and the regulation of steroid hormone biosynthesis. Annu Rev Physiol 63:193–213[CrossRef][Medline]
  9. Josso N, Cate RL, Picard JY, Vigier B, diClemente N, Wilson C, Imbeaud S, Pepinsky RB, Guerrier D, Boussin L, Legeai L, Carre-Eusebe D 1993 Anti-Müllerian hormone: the Jost factor. Recent Prog Horm Res 48:1–59
  10. Laurich VM, Trbovich AM, O’Neill FH, Houk CP, Sluss PM, Payne AH, Donahoe PK, Teixeira J 2002 Mullerian inhibiting substance blocks the protein kinase A-induced expression of cytochrome P450 17{{alpha}}-hydroxylase/C17–20 lyase mRNA in a mouse Leydig cell line independent of cAMP responsive element binding protein phosphorylation. Endocrinology 143:3351–3360[Abstract/Free Full Text]
  11. Teixeira J, Maheswaran S, Donahoe PK 2001 Mullerian inhibiting substance: an instructive developmental hormone with diagnostic and possible therapeutic applications. Endocr Rev 22:657–674[Abstract/Free Full Text]
  12. Lyet L, Louis F, Forest MG, Josso N, Behringer RR, Vigier B 1995 Ontogeny of reproductive abnormalities induced by deregulation of anti-Müllerian hormone expression in transgenic mice. Biol Reprod 52:444–454[Abstract]
  13. Racine C, Rey R, Forest MG, Louis F, Ferre A, Huhtaniemi I, Josso N, di Clemente N 1998 Receptors for anti-Müllerian hormone on Leydig cells are responsible for its effects on steroidogenesis and cell differentiation. Proc Natl Acad Sci USA 95:594–599[Abstract/Free Full Text]
  14. Rouiller-Fabre V, Carmona S, Merhi RA, Cate R, Habert R, Vigier B 1998 Effect of anti-Müllerian hormone on Sertoli and Leydig cell functions in fetal and immature rats. Endocrinology 139:1213–1220[Abstract/Free Full Text]
  15. Teixeira J, Fynn-Thompson E, Payne AH, Donahoe PK 1999 Müllerian-inhibiting substance regulates androgen synthesis at the transcriptional level. Endocrinology 140:4732–4738[Abstract/Free Full Text]
  16. Trbovich AM, Sluss PM, Laurich VM, O’Neill FH, MacLaughlin DT, Donahoe PK, Teixeira J 2001 Mullerian inhibiting substance lowers testosterone in luteinizing hormone-stimulated rodents. Proc Natl Acad Sci USA 98:3393–3397[Abstract/Free Full Text]
  17. Durlinger AL, Kramer P, Karels B, de Jong FH, Uilenbroek JT, Grootegoed JA, Themmen AP 1999 Control of primordial follicle recruitment by anti-Müllerian hormone in the mouse ovary. Endocrinology 140:5789–5796[Abstract/Free Full Text]
  18. Durlinger AL, Gruijters MJ, Kramer P, Karels B, Ingraham HA, Nachtigal MW, Uilenbroek JT, Grootegoed JA, Themmen AP 2002 Anti-Mullerian hormone inhibits initiation of primordial follicle growth in the mouse ovary. Endocrinology 143:1076–1084[Abstract/Free Full Text]
  19. Ha TU, Segev DL, Barbie D, Masiakos PT, Tran TT, Dombkowski D, Glander M, Clarke TR, Lorenzo HK, Donahoe PK, Maheswaran S 2000 Müllerian inhibiting substance inhibits ovarian cell growth through an Rb-independent mechanism. J Biol Chem 275:37101–37109[Abstract/Free Full Text]
  20. Segev DL, Hoshiya Y, Stephen AE, Hoshiya M, Tran TT, MacLaughlin DT, Donahoe PK, Maheswaran S 2001 Mullerian inhibiting substance regulates NF{kappa}B signaling and growth of mammary epithelial cells in vivo. J Biol Chem 276:26799–26806[Abstract/Free Full Text]
  21. Segev DL, Hoshiya Y, Hoshiya M, Tran TT, Carey JL, Stephen AE, MacLaughlin DT, Donahoe PK, Maheswaran S 2002 Mullerian-inhibiting substance regulates NF-{kappa}B signaling in the prostate in vitro and in vivo. Proc Natl Acad Sci USA 99:239–244[Abstract/Free Full Text]
  22. Ascoli M 1981 Regulation of gonadotropin receptors and gonadotropin responses in a clonal strain of Leydig tumor cells by epidermal growth factor. J Biol Chem 256:179–183[Abstract/Free Full Text]
  23. Lorenzo HK, Teixeira J, Pahlavan N, Laurich VM, Donahoe PK, MacLaughlin DT 2002 New approaches for high-yield purification of Mullerian inhibiting substance improve its bioactivity. J Chromatogr B Analyt Technol Biomed Life Sci 766:89–98[CrossRef][Medline]
  24. Huang TJ, Li PS 2001 Dexamethasone inhibits luteinizing hormone-induced synthesis of steroidogenic acute regulatory protein in cultured rat preovulatory follicles. Biol Reprod 64:163–170[Abstract/Free Full Text]
  25. VandeVoort CA, Overstreet JW, Lasley BL, Stewart DR 2000 Effects of progesterone receptor blockers on human granulosa-luteal cell culture secretion of progesterone, estradiol, and relaxin. Biol Reprod 62:200–205[Abstract/Free Full Text]
  26. Svechnikov KV, Sultana T, Soder O 2001 Age-dependent stimulation of Leydig cell steroidogenesis by interleukin-1 isoforms. Mol Cell Endocrinol 182:193–201[CrossRef][Medline]
  27. Clark BJ, Wells J, King SR, Stocco DM 1994 The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem 269:28314–28322[Abstract/Free Full Text]
  28. Caron KM, Ikeda Y, Soo SC, Stocco DM, Parker KL, Clark BJ 1997 Characterization of the promoter region of the mouse gene encoding the steroidogenic acute regulatory protein. Mol Endocrinol 11:138–147[Abstract/Free Full Text]
  29. Kousteni S, Bellido T, Plotkin LI, O’Brien CA, Bodenner DL, Han L, Han K, DiGregorio GB, Katzenellenbogen JA, Katzenellenbogen BS, Roberson PK, Weinstein RS, Jilka RL, Manolagas SC 2001 Nongenotropic, sex-nonspecific signaling through the estrogen or androgen receptors: dissociation from transcriptional activity. Cell 104:719–730[Medline]
  30. Lutz LB, Jamnongjit M, Yang WH, Jahani D, Gill A, Hammes SR 2003 Selective modulation of genomic and nongenomic androgen responses by androgen receptor ligands. Mol Endocrinol 17:1106–1116[Abstract/Free Full Text]
  31. Zhu Y, Rice CD, Pang Y, Pace M, Thomas P 2003 Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci USA 100:2231–2236[Abstract/Free Full Text]
  32. Stocco DM, Clark BJ, Reinhart AJ, Williams SC, Dyson M, Dassi B, Walsh LP, Manna PR, Wang XJ, Zeleznik AJ, Orly J 2001 Elements involved in the regulation of the StAR gene. Mol Cell Endocrinol 177:55–59[CrossRef][Medline]
  33. Herbst KL, Anawalt BD, Amory JK, Bremner WJ 2002 Acyline: the first study in humans of a potent, new gonadotropin-releasing hormone antagonist. J Clin Endocrinol Metab 87:3215–3220[Abstract/Free Full Text]
  34. Baarends WM, Hoogerbrugge JW, Post M, Visser JA, De Rooij DG, Parvinen M, Themmen AP, Grootegoed JA 1995 Anti-Mullerian hormone and anti-Mullerian hormone type II receptor messenger ribonucleic acid expression during postnatal testis development and in the adult testis of the rat. Endocrinology 136:5614–5622[Abstract]
  35. Mishina Y, Rey R, Finegold MJ, Matzuk MM, Josso N, Cate RL, Behringer RR 1996 Genetic analysis of the Mullerian-inhibiting substance signal transduction pathway in mammalian sexual differentiation. Genes Dev 10:2577–2587[Abstract/Free Full Text]
  36. Nelson CC, Hendy SC, Shukin RJ, Cheng H, Bruchovsky N, Koop BF, Rennie PS 1999 Determinants of DNA sequence specificity of the androgen, progesterone, and glucocorticoid receptors: evidence for differential steroid receptor response elements. Mol Endocrinol 13:2090–2107[Abstract/Free Full Text]
  37. Payne AH, Youngblood GL 1995 Regulation of expression of steroidogenic enzymes in Leydig cells. Biol Reprod 52:217–225[Abstract]
  38. Kananen K, Markkula M, Mikola M, Rainio EM, McNeilly A, Huhtaniemi I 1996 Gonadectomy permits adrenocortical tumorigenesis in mice transgenic for the mouse inhibin alpha-subunit promoter/simian virus 40 T-antigen fusion gene: evidence for negative autoregulation of the inhibin {alpha}-subunit gene. Mol Endocrinol 10:1667–1677[Abstract/Free Full Text]
  39. Kemppainen JA, Lane MV, Sar M, Wilson EM 1992 Androgen receptor phosphorylation, turnover, nuclear transport, and transcriptional activation. Specificity for steroids and antihormones. J Biol Chem 267:968–974[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
H. A. LaVoie and S. R. King
Transcriptional Regulation of Steroidogenic Genes: STARD1, CYP11A1 and HSD3B
Experimental Biology and Medicine, August 1, 2009; 234(8): 880 - 907.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Strauss, J. Kallio, N. Desai, P. Pakarinen, T. Miettinen, H. Gylling, M. Albrecht, S. Makela, A. Mayerhofer, and M. Poutanen
Increased Exposure to Estrogens Disturbs Maturation, Steroidogenesis, and Cholesterol Homeostasis via Estrogen Receptor {alpha} in Adult Mouse Leydig Cells
Endocrinology, June 1, 2009; 150(6): 2865 - 2872.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Lague and J. J. Tremblay
Antagonistic Effects of Testosterone and the Endocrine Disruptor Mono-(2-Ethylhexyl) Phthalate on INSL3 Transcription in Leydig Cells
Endocrinology, September 1, 2008; 149(9): 4688 - 4694.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. M. Eacker, N. Agrawal, K. Qian, H. L. Dichek, E.-Y. Gong, K. Lee, and R. E. Braun
Hormonal Regulation of Testicular Steroid and Cholesterol Homeostasis
Mol. Endocrinol., March 1, 2008; 22(3): 623 - 635.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y.-C. Chen, R. K Cochrum, M. T Tseng, D. T Ghooray, J. P Moore, S. J Winters, and B. J Clark
Effects of CDB-4022 on Leydig Cell Function in Adult Male Rats
Biol Reprod, December 1, 2007; 77(6): 1017 - 1026.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. M. Eacker, J. E. Shima, C. M. Connolly, M. Sharma, R. W. Holdcraft, M. D. Griswold, and R. E. Braun
Transcriptional Profiling of Androgen Receptor (AR) Mutants Suggests Instructive and Permissive Roles of AR Signaling in Germ Cell Development
Mol. Endocrinol., April 1, 2007; 21(4): 895 - 907.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
Y.-C. Chen, M. L Nagpal, D. M Stocco, and T. Lin
Effects of genistein, resveratrol, and quercetin on steroidogenesis and proliferation of MA-10 mouse Leydig tumor cells
J. Endocrinol., March 1, 2007; 192(3): 527 - 537.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
T. F. M. Mikkila, J. Toppari, and J. Paranko
Effects of Neonatal Exposure to 4-Tert-Octylphenol, Diethylstilbestrol, and Flutamide on Steroidogenesis in Infantile Rat Testis
Toxicol. Sci., June 1, 2006; 91(2): 456 - 466.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Q. Zhou, J. E. Shima, R. Nie, P. J. Friel, and M. D. Griswold
Androgen-Regulated Transcripts in the Neonatal Mouse Testis as Determined Through Microarray Analysis
Biol Reprod, April 1, 2005; 72(4): 1010 - 1019.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Houk, C. P.
Right arrow Articles by Teixeira, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Houk, C. P.
Right arrow Articles by Teixeira, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals