help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1254
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.
Endocrinology Vol. 145, No. 4 1594-1601
Copyright © 2004 by The Endocrine Society

Constitutive Expression of CYP1A1 in Bovine Cumulus Oocyte-Complexes in Vitro: Mechanisms and Biological Implications

Paola Pocar, Robert Augustin and Bernd Fischer

Department of Anatomy and Cell Biology, Martin Luther University, Faculty of Medicine, D-06097 Halle (Saale), Germany

Address all correspondence and requests for reprints to: Dr. Paola Pocar, Department of Anatomy and Cell Biology, Martin Luther University Halle-Wittenberg, Grosse Steinstrasse 52, D-06097 Halle (Saale), Germany. E-mail: paola.pocar{at}medizin.uni-halle.de.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The arylhydrocarbon receptor (AhR) is known to mediate toxic responses to dioxin (2,3,7,8-tetrachlorodibenzo-p- dioxin) and related compounds and has been extensively characterized from a toxicological viewpoint. However, it has recently been reported that the AhR may have a central role in ovarian physiology. To investigate the role of AhR during oocyte maturation, we analyzed the expression of AhR, its nuclear partner AhR nuclear translocator, and the major target gene CYP1A1, in bovine cumulus-oocyte complexes (COCs) by semiquantitative RT-PCR and Western blot. Coexpression of AhR and AhR nuclear translocator was observed in both oocytes and surrounding cumulus cells before and after in vitro maturation (IVM). Furthermore, after IVM, both cell types showed a clear up-regulation of AhR mRNA compared with the expression at 0 h. Constitutive expression of CYP1A1 mRNA was observed in immature oocytes at the background level, whereas no expression was observed in the surrounding cumulus cells. Interestingly, a significant increase in CYP1A1 expression level was observed in both oocytes and cumulus cells after IVM. To further investigate the role of AhR in CYP1A1 up-regulation and oocyte maturation, COCs were treated throughout IVM with the AhR antagonists, {alpha}-naphthoflavone and resveratrol. Both antagonists decreased the level of CYP1A1 in COCs compared with controls. Furthermore, CYP1A1 down-regulation was accompanied by a reduced ability of oocytes to complete in vitro maturation until metaphase II stage. These results suggest that CYP1A1 induction in COCs is necessary for correct proceeding of in vitro oocyte maturation in bovine and suggest a physiological role of AhR during resumption of meiosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE BASIC LOOP helix/Per, arylhydrocarbon receptor (AhR), arylhydrocarbon receptor nuclear translocator (ARNT), Sim (bHLH/PAS) proteins comprise a class of transcriptional regulators that control a variety of developmental and physiological events, including neurogenesis, trachea and salivary duct formation, toxin metabolism, circadian rhythms, response to hypoxia, and hormone receptor function (1). The AhR appears to be the only member that requires ligand binding for activation. Ligand binding induces conformational changes to the receptor, dissociation of the receptor complex, nuclear translocation of the ligand-bound receptor, and its subsequent dimerization with the ARNT to activate or inhibit transcription of target genes (2, 3). The first gene identified whose expression is regulated directly by AhR, and thus by far the most extensively characterized, is cytochrome P450 1A1. Currently, ligands for the AhR include a large family of chemicals known as halogenated aromatic hydrocarbons, of which 2,3,7,8-tetrachlorodibenzo-p-dioxin is the most potent representative (4).

Due to its role in mediating responses to environmental contaminants, the biology of the AhR has been extensively characterized from a toxicological viewpoint. Although its ability to bind a variety of xenobiotic ligands is of great interest, it is reasonable to suppose that the AhR did not evolve to respond to manufactured chemicals, and several observations suggest an additional role for the AhR in vertebrate development. First, a phylogenetic survey indicates that the AhR arose 450 million yr ago, with functional orthologs found in species that have evolved in various aquatic and terrestrial environments (5). These observations suggest that the AhR has conferred a selective advantage throughout vertebrate evolution, in a variety of chemical environments and before environmental pollution by anthropogenic compounds. Secondly, the AhR is expressed in a variety of tissues and developmental time points, making a singular role as part of a metabolic defense against environmental chemicals unlikely (6, 7, 8). Finally, mice with a homozygous deletion of the AhR locus (Ah-/-) were generated by different laboratories and provided preliminary evidence that the AhR affect reproduction, survival, and growth (9, 10, 11, 12, 13). Based on these observations, it is reasonable to hypothesize that natural ligands must exist for the AhR. Recently, several groups have reported putative natural ligands (14, 15, 16), but whether they are true physiological ligands has not yet been resolved.

Most of the existing data suggest that the AhR is important for the development and function of the liver and immune system (10, 13, 17). However, Nebert et al. (18) showed that a high affinity AhR isoform was associated with greater fertility and longer life span than was a lower affinity receptor in mice; therefore, it has been suggested that the AhR may be involved in the physiology of the female reproductive system. The expression of AhR and its nuclear partner, ARNT, has been described in the ovary of different species [rat (19), rabbit (20), human (21), and mouse (22)]. Furthermore, recent findings indicate that the AhR may have a central role in regulating oocyte and follicular growth during pre- and postnatal life (22, 23, 24). In support of this hypothesis, CYP1A1 constitutive expression has been described in the mouse ovary and oocyte (22, 25). Finally, a marked increase in constitutive expression of CYP1A1 has been observed in the fertilized ovum in the mouse (26).

The purpose of the current study is to further explore the role of the AhR in the female reproductive system. Specifically, we address the hypothesis that the AhR may be involved in the resumption of meiosis of mammalian oocytes. To test this hypothesis, we examined the stage-specific expression of the AhR-signaling pathway components and its target gene, CYP1A1, in bovine cumulus-oocyte complexes (COCs) throughout in vitro maturation (IVM). Furthermore, the effects of the inhibitors of AhR activity, resveratrol and {alpha}-naphthoflavone ({alpha}NF), on the expression of AhR target genes and on IVM outcome were studied. Collectively, our study indicates that the AhR may modulate the IVM of mammalian oocytes, providing an experimental basis for further investigation of the role of AhR in female reproductive function.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Unless otherwise stated, all reagents were purchased from Sigma-Aldrich Corp. (St. Louis, MO).

COC collection
Ovaries were collected from a local slaughterhouse and transported, within 2 h, to the laboratory in Dulbecco’s PBS, supplemented with 100,000 IU penicillin, 100 mg streptomycin, and 250 µg amphotericin B/liter, maintained at 32–34 C. All subsequent procedures were conducted at a constant temperature of 36 C.

COCs were collected from ovarian follicles by slicing with razor blades (27) in modified Dulbecco’s PBS (catalog no. D6650) supplemented with 2 IU heparin and 0.1% BSA (fraction V). Intact COCs were collected in tissue culture medium 199 (catalog no. M 5017) supplemented with 0.4% BSA (catalog no. A3156), 25 mM HEPES, and 10 µg/ml heparin. COCs were then washed three times in the same medium. Only COCs with at least three complete layers of cumulus cells (CCs) and finely granulated homogeneous ooplasm were selected as suitable for IVM and used for the following experiments, as previously described (28).

IVM
The basic maturation medium (bMM) was tissue culture medium 199, supplemented with 0.68 mM L-glutamine, 25 mM NaHCO3, 10% (vol/vol) fetal calf serum (FCS), 10 IU/ml pregnant mare serum gonadotropin, 5 IU/ml human chorionic gonadotropin (Suigonan, Intervet, Wiesbaden, Germany), and 1 µg/ml 17ß-estradiol. Groups of 25–35 COCs were matured in 500 µl bMM in four-well dishes (Nunc, Roskilde, Denmark). Resveratrol and {alpha}NF were diluted in ethanol (Merck & Co., Darmstadt, Germany); controls received ethanol alone. COCs were incubated for 24 h at 39 C in a humid atmosphere of 5% CO2 in air. At the end of the maturation period, oocyte morphology was assessed by observing cumulus expansion, the size of the perivitelline space, and the presence of an intact oolemma.

Evaluation of nuclear maturation
To assess the rate of meiosis at the end of IVM, a total of 373 oocytes, separated in groups according to treatment, were analyzed. Each oocytes was completely denuded of CCs by repeated pipetting, recovered under a stereomicroscope, and transferred onto a glass slide in a small drop of fluid. Silicone was used to maintain a coverslip in contact with the oocytes without exerting excessive pressure. The slides were immersed in a 3:1 fixative solution of ethanol/acetic acid for a minimum of 24 h. Nuclear morphology was assessed by staining with 1% lacmoid, and specimens were examined under a phase contrast microscope. Oocytes were classified as immature (germinal vesicle and germinal vesicle breakdown stage), intermediate (anaphase I and metaphase I), and matured (telophase I and metaphase II). Oocytes showing multipolar meiotic spindle, irregular chromatin clumps, or no chromatin were considered degenerated (29).

mRNA isolation and cDNA synthesis
Polyadenylated [poly(A)+] RNA from pooled COCs was extracted using the Dynabeads mRNA DIRECT kit (Deutsche Dynal, Hamburg, Germany). Briefly, pools of 30–40 COCs were lysed for 10 min at room temperature in 200 µl lysis buffer [100 mmol Tris-HCl (pH 8.0), 500 mmol LiCl, 10 mmol EDTA, 1% (wt/vol) sodium dodecyl sulfate, and 5 mmol dithiothreitol]. After lysis, 10 µl prewashed Dynabeads-oligo(deoxythymidine)25 were pipetted into the tube, and binding of poly(A)+ RNAs to oligo(deoxythymidine) was allowed for 5 min at room temperature. The beads were then separated with a Dynal MPC-E magnetic separator and washed twice with 30 µl washing buffer A [10 mmol Tris-HCl (pH 8.0), 0.15 mmol LiCl, 1 mmol EDTA, and 0.1% (wt/vol) sodium dodecyl sulfate] and three times with 30 µl washing buffer B [10 mmol Tris-HCl (pH 8.0), 0.15 mmol LiCl, and 1 mmol EDTA]. Poly(A)+RNAs were then eluted from the beads by incubation in 11 µl diethylpyrocarbonate-treated sterile water at 65 C for 2 min. Aliquots were immediately used for RT using the PCR Core Kit (PerkinElmer, Wellesley, MA), using 2.5 µmol random hexamers to obtain the widest array of cDNAs. The RT reaction was carried out in a final volume of 20 µl at 25 C for 10 min and 42 C for 1 h, followed by a denaturation step at 99 C for 5 min and immediate cooling on ice.

Oligonucleotide primers for PCR reactions
Based on the mRNA sequences available at the EMBL databank, the following specific primer pairs were designed: ß-actin (accession no. U39357): sense primer, CCAAGGCCAACCGTGAGAAG; antisense primer, CCATCTCCTGCTTCGAAGTCC; AhR (accession no. AY078127): sense primer, AGAGAGTGGCATGATAGTGTTC; antisense primer, GCCTAGGTGTTTCATAATGTTG; ARNT (accession no. AB053954): sense primer, TTACCTGCAGTCTGCCAATGG; antisense primer, AGACAGGCCGGGTGGTATATG; CYP1A1 (accession no. AB060696): sense primer, TCGGGCACATGCTGATGTTG; antisense primer, GCACAGATGACATTGGCCACTG; and CYP1B1 (accession no. NM_000104): sense primer, TCAACCGCAACTTCAGCAAC; antisense primer, GTCATGATTCACAGACCACT. PCR products were sequenced to verify their identity and homology to corresponding mRNA sequences in the EMBL databank.

Semiquantitative PCR
To normalize signals from different RNA samples, ß-actin transcripts were coamplified as an internal standard. The amplification reaction was stopped before leaving the exponential phase. Amplifications were performed on 2 µl first strand cDNA in a 30-µl final volume containing 0.2 µM of the primer combinations listed above, 1 U Taq polymerase (Life Technologies, Karlsruche, Germany), 0.2 mM deoxy-NTPs, 1.5 mM MgCl2, and 1x PCR buffer. Amplification cycles comprised a 30-sec step at 94 C for denaturation, a 30-sec step at 57 C for annealing, and a 45-sec step at 72 C for elongation. A water control was included to identify possible contamination. In addition, all samples were amplified with an intron-exon spanning primer pair to detect possible genomic DNA contamination.

A volume of 20 µl/reaction was subjected to electrophoresis on a 1.5% agarose gel in Tris-acetate-EDTA buffer, containing 0.2 µg/ml ethidium bromide. After separation, the fragments were visualized on a 312-nm UV transilluminator. The image of each gel was digitalized using a CCD camera, and the intensity of each band was quantified by densitometric analysis using a computer-assisted image analysis system (BioProfil, LTF software, LTF Labortechnik, Wasserburg/B, Germany). The relative amount of the mRNA of interest was calculated as a percentage of the intensity of the ß-actin band for the corresponding sample. For each mRNA, experiments were replicated at least three times.

Western blot
Pools of 20 COCs were homogenized in ice-cold radioimmunoprecipitation assay buffer in the presence of phosphatase inhibitor (catalog no. P 5726) and a commercial mixture of protease inhibitor (catalog no. P 2714). Total extract proteins (50 µg) were submitted to denaturing PAGE. The gel was electrically blotted on a nitrocellulose membrane (Amersham Pharmacia Biotech, Braunschweig, Germany). The membrane was saturated with 5% nonfat dry milk and incubated with various antibodies, including a mouse monoclonal antibody against the AhR (Dianova, Hamburg, Germany), a mouse monoclonal antibody against ARNT (Dianova), and a rabbit polyclonal antibody against cytochrome P-450 1A1 (Dianova), all diluted 1:500 in 5% nonfat dry milk. Immune complexes were detected by chemiluminescence with the enhanced chemiluminescence kit (Amersham Pharmacia Biotech) following the manufacturer’s protocol.

Experimental design
In experiment I, the relative abundance of AhR, ARNT, and their target gene CYP1A1 mRNAs and proteins in oocytes and surrounding CCs either freshly isolated or after 24-h in vitro culture in bMM was compared.

In experiment II, COCs were cultured in vitro in bMM supplemented with the AhR antagonists, {alpha}NF (10 µM) and resveratrol (concentration range, 10–40 µM), to evaluate their effects on the level of CYP1A mRNA expression and on the rate of oocyte maturation.

In experiment III, the relative abundance of CYP1A1 mRNA and the outcome of oocyte IVM in bovine COCs cultured in medium supplemented with either 10% FCS or 0.1% BSA were compared.

Statistical analysis
Data for in vitro culture were analyzed using a binary logistic regression. Controls were assumed as reference group. Experiments were replicated at least three times, and each replicate was fitted as a factor. The log likelihood ratio statistic was used to detect between-treatment differences using the SPSS statistical package (SPSS Institute, Inc., Chicago, IL). Data for cell number and gene expression were assessed using ANOVA, followed by Fisher’s protected least significant difference test. In all cases the criterion for significance was set at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experiment I: expression of AhR signaling pathway and its target genes in bovine COCs during IVM
The expression of the AhR was examined in bovine oocytes and CCs by semiquantitative RT-PCR. AhR mRNA was detected in both oocytes and CCs before IVM (0 h). Furthermore, after 24 h of IVM, both cell types showed a clear up-regulation of AhR mRNA compared with the initial expression at 0 h (Fig. 1AGo).



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 1. Expression of AhR mRNA in bovine COCs before and after IVM. AhR and ß-actin mRNA were evidenced using specific RT-PCR in the same samples of oocytes (A) and CCs (B) harvested at 0 and 24 h of culture. The AhR/ß-actin densitometric ratio is shown (mean ± SE).

 
Because the activated AhR must first dimerize with ARNT before interaction with the regulatory sequences of its target genes, ARNT mRNA expression was evaluated in oocyte and surrounding CCs before and after IVM. Semiquantitative RT-PCR showed a fairly constant level of expression of ARNT mRNA in each cell type tested regardless of culture period (data not shown). mRNA expression data were confirmed by Western blot analysis (data not shown).

To test the functionality of AhR in bovine COCs, CYP1A1 mRNA expression was examined. Therefore, the expression of the CYP1A1 gene, normalized to the expression of ß-actin, was measured by semiquantitative RT-PCR. Constitutive expression of CYP1A1 mRNA was detected in bovine oocytes at 0 h, before initiation of maturation, whereas CYP1A1 transcript was virtually absent in the CCs. However, an overall effect of maturation time on CYP1A1 mRNA expression was observed in both oocytes and CCs. CYP1A1 expression was increased by approximately 4-fold in oocytes after 24 h of IVM compared with that in freshly isolated, immature oocytes (Fig. 2AGo). Furthermore, time-course studies showed that CCs exhibited a rapid and robust increase in CYP1A1 expression beginning 1 h after the start of culture that peaked at approximately 15 h. CYP1A1 in the CCs remained at this higher level throughout the remaining culture period (Fig. 2BGo). However, precise kinetic definition requires further analysis. To investigate whether the increase in the steady state CYP1A1 mRNA observed in CCs after 24 h of IVM led to an increase in CYP1A1 protein, Western blot analysis was performed. Whole cell lysates prepared from immature and matured CCs showed an increase in cellular CYP1A1 protein concordant with mRNA data (Fig. 2CGo). Furthermore, the other AhR target gene, CYP1B1, was analyzed in whole COCs before and after maturation. Similar to CYP1A1 expression, an overall effect of maturation was observed, revealing a clear increase in transcription after 24 h of culture (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2. Expression of CYP1A1 in bovine oocytes and surrounding CCs before and after IVM. A, CYP1A1 and ß-actin mRNA were evidenced using specific RT-PCR in the same samples of oocytes harvested at 0 and 24 h of culture. The CYP1A1/ß-actin densitometric ratio is shown (mean ± SE). B, Time course of induction of CYP1A1 expression in bovine CCs during IVM. CYP1A1 mRNA and ß-actin were detected by specific RT-PCR in the same samples of CCs. The CYP1A1/ß-actin densitometric ratio is shown (mean ± SE). C, CYP1A1 protein was detected by Western blot analysis (see Fib. 3b). Lanes 1 and 2, Solubilized CC extracts corresponding to 20 COCs harvested at 0 and 24 h of culture, respectively.

 
Experiment II: effects of exposure to {alpha}NF and resveratrol on CYP1A1 induction and IVM
To investigate the possible function of AhR activation on bovine oocyte maturation, COCs were treated throughout IVM with {alpha}NF, a flavonid that inhibits AhR activity via a classical competitive binding mechanism.

Maturation-mediated induction of CYP1A1 mRNA was reduced to 13.5% of the control value when COCs were treated with 10 µM {alpha}NF (Fig. 3AGo), suggesting that this antagonist prevented agonist binding to the AhR to cause CYP1A1 induction during IVM. Western blot analysis revealed a similar decrease also at the protein level (Fig. 4Go). Exposure of bovine oocytes to {alpha}NF during IVM significantly affected the outcome of oocyte IVM. As shown in Table 1Go, the maturation rate of COCs cultured in the presence of 10 µM {alpha}NF was significantly lower than that in controls (P < 0.05). About half (50.1%) of the COCs cultured in the presence of {alpha}NF were arrested at anaphase I and metaphase I.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 3. Effect of exposure to AhR antagonists during IVM on CYP1A1 mRNA expression in bovine COCs. CYP1A1 and ß-actin mRNA were evidenced using specific RT-PCR in the same samples of COCs harvested at 24 h of culture in the presence of bMM alone (ctrl) or supplemented with 10 µM {alpha}NF (A) or 10, 20, and 40 µM resveratrol (B).

 


View larger version (42K):
[in this window]
[in a new window]
 
FIG. 4. Effect of exposure to AhR antagonists during IVM on CYP1A1 protein expression in bovine COCs. CYP1A1 and ß-actin proteins were detected by Western blot analysis. Lanes 1–3, Solubilized extracts corresponding to 20 COCs harvested at 24 h of culture in presence of bMM alone (ctrl) or supplemented with 40 µM resveratrol (R) or 10 µM {alpha}NF. The CYP1A1/ß-actin densitometric ratio is shown (mean ± SE).

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Effects of AhR antagonists on IVM of bovine oocytes

 
To confirm the role of AhR activation in bovine oocyte maturation, COCs were treated throughout IVM with resveratrol, an inhibitor of AhR activity, acting downstream from the complex binding to the regulatory regions of target genes.

The increase in CYP1A1 mRNA was inhibited by resveratrol in a dose-dependent manner. The addition of 20 or 40 µM resveratrol resulted in a reduction of CYP1A1 expression to 22.0% and 7.3% of the control level, respectively, whereas the level of CYP1A1 mRNA expression in the 10 µM group did not significantly differ from that in controls (Fig. 3BGo). As observed after exposure to {alpha}NF, CYP1A1 protein expression was decreased in parallel to mRNA expression (Fig. 4Go).

The effect of incubating bovine COCs with various concentrations of resveratrol during IVM is shown in Table 1Go. Statistical analysis revealed a significant effect of resveratrol concentration on maturation rates after IVM (P < 0.05). Resveratrol concentrations of 20 and 40 µM significantly reduced the percentage of oocytes that reached the metaphase II stage after 24 h of culture. However, treatment with 10 µM resveratrol did not induce significant differences compared with the control group. Similarly, as previously observed after exposure to {alpha}NF, although the number of immature and degenerated oocytes did not show a treatment effect, resveratrol concentrations of 20 and 40 µM significantly increased the proportion of oocytes arrested in intermediate stages (anaphase I and metaphase I).

Experiment III: effects of serum supplementation on CYP1A1 mRNA expression
Several groups have recently hypothesized that serum supplementation of the culture medium may be involved in CYP1A1 induction in vitro (14, 30, 31). To evaluate the effect of serum supplementation in the regulation of CYP1A1 expression in bovine COCs, IVM was performed in the absence of FCS and in the presence of 0.1% BSA as protein source. In the BSA-treated groups a slight down-regulation of CYP1A1 was observed (to 71.0% of the control value; Fig. 5Go). However, no effect on oocyte maturation outcome was observed (TableGo 2).



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 5. Influence of medium supplementation on CYP1A1 mRNA expression level in bovine COCs after IVM. CYP1A1 and ß-actin mRNA were evidenced using specific RT-PCR in the same samples of COCs harvested at 24 h of culture in the presence of bMM supplemented with FCS (ctrl) or 0.1% BSA. The CYP1A1/ß-actin densitometric ratio is shown (mean ± SE).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The presence of AhR and ARNT in the mammalian ovary suggests a functional role of this transcription factor in ovarian processes and, hence, regulation by factors associated with the reproductive system (32, 33). Consistent with this view is the observation that homozygous disruption of the mouse AhR gene was shown to result in abnormal ovarian development and to have a dramatic impact on fetal ovarian cell survival (22, 23). To date, the physiological significance of the AhR/ARNT complex during the final stages of oocyte maturation is not yet known. The current study provides initial evidence for the regulation of AhR and ARNT activity by factors associated with bovine oocyte maturation.

In the present study we demonstrated that bovine COCs express AhR and ARNT mRNA throughout IVM, demonstrating that this physiological unit possesses all the components for activation of the AhR signaling pathway. These results are in agreement with several studies showing the expression of these molecules in rodent (22, 33, 34), primate (32), rabbit (20), and human (21) ovaries. Furthermore, our results indicate that IVM of bovine COCs leads to an increase in steady state AhR mRNA in both somatic and germ cells. An increase in AhR mRNA has been previously described during the activation process of other cell types (35, 36); this suggests that the AhR may play a role in cell cycle regulation and/or cell differentiation.

CYP1A1 expression is transcriptionally regulated through AhR binding to multiple dioxin-responsive elements consensus recognition motifs present in its promoter enhancer region. We observed that CYP1A1 is tightly regulated in the COC. In fact, after IVM, both oocytes and CCs exhibited a significant increase in CYP1A1 expression. Induction of CYP1A1 expression in the absence of exogenous ligands has been observed previously in animals and in cultured cells (35, 37, 38). Assuming that AhR activation requires ligand, these observations can be interpreted as indirect evidence of the existence of endogenous AhR ligand(s). Interestingly, the studies mentioned above not only suggest the existence of an endogenous AhR activator(s), but also indicate a role for AhR involvement in cell proliferation and differentiation and in cell cycle programming. At the same time, a variety of compounds have been shown to induce CYP1A1 expression. Although their mechanism of action has not been thoroughly investigated, many of these compounds (e.g. omeprazole, carbamine, and primaquine), despite being inducers of CYP1A1, are not ligands of the AhR (39, 40, 41). Therefore, it may be hypothesized that some of these molecules could activate a signal transduction pathway other than AhR. To test this hypothesis in the present study, we exposed the maturing COCs to {alpha}NF, a compound known to interfere with the AhR by competitively binding to the receptor-binding site and eliciting a protein conformation that has very low affinity for DNA (42). We demonstrate that {alpha}NF exposure results in a marked decrease in the expression level of CYP1A1. {alpha}NF has been shown to inhibit the induction of CYP1A1 produced by the major AhR ligands, such as 2,3,7,8-tetrachlorodibenzo-p- dioxin (43) and 3-methylcholantrene (40, 41). However, this molecule did not inhibit CYP1A1 induction produced by omeprazole, an AhR-independent CYP1A1 inducer. Overall, our results strongly suggest an AhR-dependent pathway for cytochrome P450 1A1 induction in bovine COCs.

Interestingly, in parallel with CYP1A1 down-regulation, after {alpha}NF exposure, a decreased percentage of oocytes able to complete the maturation process until the metaphase 2 stage was observed. To rule out the possibility that maturation incompetence and CYP1A1 down-regulation are due to toxic effects of {alpha}NF, we exposed bovine COCs to resveratrol, another antagonist of AhR activity with a different mechanism of action. In contrast to {alpha}NF, resveratrol does not compete with the binding of agonists to the cytosolic AhR, translocation to the nucleus, and binding to dioxin-responsive elements, but subsequent trans-activation of AhR target genes does not take place (44). Similarly to {alpha}NF, we observed a dose-dependent down-regulation of CYP1A1 induction during IVM and a reduced ability of the oocyte to complete IVM after exposure to resveratrol. Taken together, our results suggest that activation of the AhR signaling pathway may play a role in the correct progressing of in vitro resumption of meiosis in bovine oocytes.

FCS is commonly used as a supplement to standard bovine maturation medium. It provides a variety of macromolecular proteins, low molecular weight nutrients, carrier proteins for water-insoluble components, and other components, such as hormones and attachment factors. Several groups have recently investigated the role of serum in CYP1A1 induction in vitro. However, final results and mechanisms of action are still controversial. Adachi et al. (14) reported the presence of the putative AhR endogenous ligand, indirubin, in FCS at levels sufficiently high to activate the AhR, whereas in other studies Guigal et al. (30, 31) reported that serum could induce CYP1A1 expression in an AhR-independent manner in various cell lines. Finally, results published by Feng et al. (45) did not prove that serum could induce CYP1A1 expression in vitro. The results obtained in the present study exclude serum components as the major AhR- and CYP1A1-inducing factor in our system. Indeed, despite the fact that substitution of serum supplementation with BSA as a protein source led to a slight down-regulation of the CYP1A1 mRNA level, this is not comparable with that observed in the presence of AhR antagonists. Furthermore, no effect on the ability of oocytes to complete the maturation process was observed, suggesting that serum was not the main CYP1A1-inducing factor in our model system.

Why should the matured COCs contain excess amounts of constitutive CYP1A1? Autoregulation of endogenous substrates by metabolizing enzymes is an important mechanism to maintain homeostasis in biological systems (46). A putative endogenous substrate for the CYP1A1 enzyme was postulated to be an endogenous ligand for the AhR (47, 48). Hence, in cells expressing CYP1A1, this substrate would be maintained at a low concentration, and the AhR would be relatively inactive. However, in cells lacking CYP1A1 activity, the substrate would accumulate, and the AhR would be constantly activated, leading to up-regulation of all of the AhR target genes (47, 48, 49). It is notable that constitutive CYP1A1 mRNA expression has been previously detected in mouse oocytes, and a marked increase in transcription was observed after fertilization (26). In addition, basal and inducible expressions of CYP1A1 were observed in the early embryo (26, 50), a stage at which cells continuously face decision checkpoints for proliferation and/or differentiation. Activation of the AhR by endogenous ligand(s) might be a critical event at any of these decision checkpoints. During its growth in the follicle, an oocyte exhibits high transcriptional and protein synthesis activities. Toward the end of the growth phase, the nucleolus function in the oocyte is inactivated, and the transcriptional activity of the oocyte is decreased (51). However, germinal vesicle breakdown and meiotic resumption are preceded by a short burst of transcriptional activity (52, 53, 54). This transcription seems functionally important, because its inhibition by {alpha}-amanitin (an RNA polymerase II inhibitor) impairs the maturation process (55). Thus, it is tempting to speculate that the abundance of constitutive CYP1A1 in the maturing oocyte is designed to maintain sufficient amount of functional CYP1A1 enzyme during critical phases of maturation, fertilization, and early cleavage until the transition from maternal to zygotic control occurs. However, it is also possible that changes in polyadenylation of mRNA molecules observed during IVM of bovine oocytes (56) may simply increase the efficiency of the RT by oligo(deoxythymidine), and the increase in constitutive CYP1A1 mRNA of the maternal transcript may be the result of mRNA stabilization rather than transcription. However, it is also important to consider that the COC is comprised of two cellular compartments, the oocyte and the surrounding CCs, and it is not possible to exclude that the latter may actively influence transcription in the oocyte. It has been shown that CCs maintain intimate connections with the oocyte through numerous intracellular processes, which penetrate the zona pellucida and communicate with the oocyte via gap junctions (57). Cumulus-oocyte coupling changes dynamically during maturation, and in the second half of maturation the cooperation between somatic cells and the oocyte becomes restricted to the corona radiata, where the outer CCs are uncoupled (58, 59). It has also been shown that CCs are capable of affecting the metabolic activity of the oocyte and providing beneficial support during IVM (60, 61) and that they require a transcriptional event for IVM to ensue (62, 63). Furthermore, it has been recently demonstrated that CCs may play a critical role in protecting oocytes against oxidative stress (64). In fact, in vitro culture is maintained at higher concentrations of O2 than those present in the in vivo environment, resulting in increased production of reactive oxygen species (65). Induction of CYP1A1 has been described after stress conditions, including hyperoxia (66). Thus, is possible to speculate that the induction of CYP1A1 in the CCs may be involved in protecting oocytes against irremediable cell damage encompassed by oxidative stress during oocyte maturation. Further analysis will be required to test this hypothesis.

In conclusion, the results of this study indicate a role for AhR activation and CYP1A1 induction in the bovine COCs. It needs to be established whether the phenomenon observed is directly or indirectly involved in the progressing of oocyte IVM. In addition, it is important to understand how this regulation is coordinated with somatic follicular cells. Finally, although AhR signal transduction appears to be present in bovine COCs in vitro, it is crucial to determine the significance of this signaling pathway for oocyte maturation in vivo, and a better understanding of the specific mechanisms involved in CYP1A1 expression in the COCs should be the focus of future research before final conclusions can be drawn.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Effect of serum supplementation on CYP1A1 mRNA expression

 

    Acknowledgments
 
We gratefully thank Dr. Sabine Hombach-Klonisch for the critical reading of the manuscript. The expert technical assistance of Mrs. Michaela Kirstein and Mrs. Rosmarie Rappold with the in vitro bovine oocyte culture procedures is sincerely appreciated.


    Footnotes
 
This work was supported by European Union Marie Curie Fellowship Program Grant QLK-CT-2000-52163 and the Wilhelm Roux Program-Martin Luther University Halle/Wittenberg.

Abbreviations: AhR, Arylhydrocarbon receptor; ARNT, arylhydrocarbon receptor nuclear translocator; bMM, basic maturation medium; CC, cumulus cell; COC, cumulus-oocyte complex; FCS, fetal calf serum; IVM, in vitro maturation; {alpha}NF, {alpha}-naphthoflavone; poly(A)+, polyadenylated.

Received September 19, 2003.

Accepted for publication December 19, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Crews ST 1998 Control of cell lineage-specific development and transcription by bHLH-PAS proteins. Genes Dev 12:607–620[Free Full Text]
  2. Reyes H, Reisz-Porszasz S, Hankinson O 1992 Identification of the Ah receptor nuclear translocator protein (Arnt) as a component of the DNA binding form of the Ah receptor. Science 256:1193–1195[Abstract/Free Full Text]
  3. Rowlands JC, Gustafsson JA 1997 Aryl hydrocarbon receptor-mediated signal transduction. Crit Rev Toxicol 27:109–134[Medline]
  4. Poland A, Knutson JC 1982 2,3,7,8-Tetrachlorodibenzo-p-dioxin and related halogenated aromatic hydrocarbons: examination of the mechanism of toxicity. Annu Rev Pharmacol Toxicol 22:517–554[CrossRef][Medline]
  5. Hahn ME, Poland A, Glover E, Stegeman JJ 1994 Photoaffinity labeling of the Ah receptor: phylogenetic survey of diverse vertebrate and invertebrate species. Arch Biochem Biophys 310:218–228[CrossRef][Medline]
  6. Abbott BD, Probst MR, Perdew GH, Buckalew AR 1998 AH receptor, ARNT, glucocorticoid receptor, EGF receptor, EGF, TGF{alpha}, TGFß1, TGFß2, and TGFß3 expression in human embryonic palate, and effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Teratology 58:30–43[CrossRef][Medline]
  7. Jain S, Maltepe E, Lu MM, Simon C, Bradfield CA 1998 Expression of ARNT, ARNT2, HIF1{alpha}, HIF2{alpha} and Ah receptor mRNAs in the developing mouse. Mech Dev 73:117–123[CrossRef][Medline]
  8. Kuchenhoff A, Seliger G, Klonisch T, Tscheudschilsuren G, Kaltwasser P, Seliger E, Buchmann J, Fischer B 1999 Arylhydrocarbon receptor expression in the human endometrium. Fertil Steril 71:354–360[CrossRef][Medline]
  9. Abbott BD, Schmid JE, Pitt JA, Buckalew AR, Wood CR, Held GA, Diliberto JJ 1999 Adverse reproductive outcomes in the transgenic Ah receptor-deficient mouse. Toxicol Appl Pharmacol 155:62–70[CrossRef][Medline]
  10. Fernandez-Salguero P, Pineau T, Hilbert DM, McPhail T, Lee SS, Kimura S, Nebert DW, Rudikoff S, Ward JM, Gonzalez FJ 1995 Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding Ah receptor. Science 268:722–726[Abstract/Free Full Text]
  11. Lahvis GP, Bradfield CA 1998 Ahr null alleles: distinctive or different? Biochem Pharmacol 56:781–787[CrossRef][Medline]
  12. Mimura J, Yamashita K, Nakamura K, Morita M, Takagi TN, Nakao K, Ema M, Sogawa K, Yasuda M, Katsuki M, Fujii-Kuriyama Y 1997 Loss of teratogenic response to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice lacking the Ah (dioxin) receptor. Genes Cells 2:645–654[Abstract]
  13. Schmidt JV, Su GH, Reddy JK, Simon MC, Bradfield CA 1996 Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci USA 93:6731–6736[Abstract/Free Full Text]
  14. Adachi J, Mori Y, Matsui S, Takigami H, Fujino J, Kitagawa H, Miller CA, III, Kato T, Saeki K, Matsuda T 2001 Indirubin and indigo are potent aryl hydrocarbon receptor ligands present in human urine. J Biol Chem 276:31475–31478[Abstract/Free Full Text]
  15. Schaldach CM, Riby J, Bjeldanes LF 1999 Lipoxin A4: a new class of ligand for the Ah receptor. Biochemistry 38:7594–7600[CrossRef][Medline]
  16. Song J, Clagett-Dame M, Peterson RE, Hahn ME, Westler WM, Sicinski RR, DeLuca HF 2002 A ligand for the aryl hydrocarbon receptor isolated from lung. Proc Natl Acad Sci USA 99:14694–14699[Abstract/Free Full Text]
  17. Gottlicher M, Cikryt P 1987 Induction of ornithine decarboxylase by aromatic amines in rat liver. Cancer Lett 35:65–70[CrossRef][Medline]
  18. Nebert DW, Brown DD, Towne DW, Eisen HJ 1984 Association of fertility, fitness and longevity with the murine Ah locus among (C57BL/6N) (C3H/HeN) recombinant inbred lines. Biol Reprod 30:363–373[Abstract]
  19. Chaffin CL, Trewin AL, Hutz RJ 2000 Estrous cycle-dependent changes in the expression of aromatic hydrocarbon receptor (AHR) and AHR-nuclear translocator (ARNT) mRNAs in the rat ovary and liver. Chem Biol Interact 124:205–216[CrossRef][Medline]
  20. Hasan A, Fischer B 2003 Epithelial cells in the oviduct and vagina and steroid-synthesizing cells in the rabbit ovary express AhR and ARNT. Anat Embryol 207:9–18[CrossRef][Medline]
  21. Khorram O, Garthwaite M, Golos T 2002 Uterine and ovarian aryl hydrocarbon receptor (AHR) and aryl hydrocarbon receptor nuclear translocator (ARNT) mRNA expression in benign and malignant gynaecological conditions. Mol Hum Reprod 8:75–80[Abstract/Free Full Text]
  22. Robles R, Morita Y, Mann KK, Perez GI, Yang S, Matikainen T, Sherr DH, Tilly JL 2000 The aryl hydrocarbon receptor, a basic helix-loop-helix transcription factor of the PAS gene family, is required for normal ovarian germ cell dynamics in the mouse. Endocrinology 141:450–453[Abstract/Free Full Text]
  23. Benedict JC, Lin T-M, Loeffler IK, Peterson RE, Flaws JA 2000 Physiological role of the aryl hydrocarbon receptor in mouse ovary development. Toxicol Sci 56:382–388[Abstract/Free Full Text]
  24. Matikainen TM, Moriyama T, Morita Y, Perez GI, Korsmeyer SJ, Sherr DH, Tilly JL 2002 Ligand activation of the aromatic hydrocarbon receptor transcription factor drives bax-dependent apoptosis in developing fetal ovarian germ cells. Endocrinology 143:615–620[Abstract/Free Full Text]
  25. Dey A, Jones JE, Nebert DW 1999 Tissue- and cell type-specific expression of cytochrome P450 1A1 and cytochrome P450 1A2 mRNA in the mouse localized in situ hybridization. Biochem Pharmacol 58:525–537[CrossRef][Medline]
  26. Dey A, Nebert DW 1998 Markedly increased constitutive CYP1A1 mRNA levels in the fertilized ovum of the mouse. Biochem Biophys Res Commun 251:657–661[CrossRef][Medline]
  27. Eckert J, Tao T, Niemann H 1997 Ratio of inner cell mass and trophoblastic cells in blastocysts derived from porcine 4- and 8-cell embryos and isolated blastomeres cultured in vitro in the presence or absence of protein and human leukemia inhibitory factor. Biol Reprod 57:552–560[Abstract]
  28. Gandolfi F, Luciano AM, Modina S, Ponzini A, Pocar P, Armstrong DT, Lauria A 1997 The in vitro developmental competence of bovine oocytes can be related to the morphology of the ovary. Theriogenology 48:1153–1160
  29. Luciano AM, Pocar P, Milanesi E, Modina S, Rieger D, Lauria A, Gandolfi F 1999 Effect of different levels of intracellular cAMP on the in vitro maturation of cattle oocytes and their subsequent development following in vitro fertilization. Mol Reprod Dev 54:86–91[CrossRef][Medline]
  30. Guigal N, Seree E, Bourgarel-Rey V, Barra Y 2000 Induction of CYP1A1 by serum independent of AhR pathway. Biochem Biophys Res Commun 267:572–576[CrossRef][Medline]
  31. Guigal N, Seree E, Nguyen QB, Charvet B, Desobry A, Barra Y 2001 Serum induces a transcriptional activation of CYP1A1 gene in HepG2 independently of the AhR pathway. Life Sci 68:2141–2150[CrossRef][Medline]
  32. Chaffin CL, Peterson RE, Hutz RJ 1996 In utero and lactational exposure of female Holtzman rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin: modulation of the estrogen signal. Biol Reprod 55:62–67[Abstract]
  33. Chaffin C, Trewin A, Watanabe G, Taya K, Hutz R 1997 Alterations to the pituitary-gonadal axis in the peripubertal female rat exposed in utero and through lactation to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Biol Reprod 56:1498–1502[Abstract]
  34. Davis BJ, McCurdy EA, Miller BD, Lucier GW, Tritscher AM 2000 Ovarian tumors in rats induced by chronic 2,3,7,8-tetrachlorodibenzo-p-dioxin treatment. Cancer Res 60:5414–5419[Abstract/Free Full Text]
  35. Crawford RB, Holsapple MP, Kaminski NE 1997 Leukocyte activation induces aryl hydrocarbon receptor up-regulation, DNA binding, and increased Cyp1a1 expression in the absence of exogenous ligand. Mol Pharmacol 52:921–927[Abstract/Free Full Text]
  36. Hayashi S, Okabe-Kado J, Honma Y, Kawajiri K 1995 Expression of Ah receptor (TCDD receptor) during human monocytic differentiation. Carcinogenesis 16:1403–1409[Abstract/Free Full Text]
  37. Monk SA, Denison MS, Rice RH 2001 Transient expression of CYP1A1 in rat epithelial cells cultured in suspension. Arch Biochem Biophys 393:154–162[CrossRef][Medline]
  38. Sadek C, Allen-Hoffmann B 1994 Cytochrome P450IA1 is rapidly induced in normal human keratinocytes in the absence of xenobiotics. J Biol Chem 269:16067–16074[Abstract/Free Full Text]
  39. Backlund M, Weidolf L, Ingelman-Sundberg M 1999 Structural and mechanistic aspects of transcriptional induction of cytochrome P450 1A1 by benzimidazole derivatives in rat hepatoma H4IIE cells. Eur J Biochem 261:66–71[Medline]
  40. Fontaine F, Delescluse C, de Sousa G, Lesca P, Rahmani R 1999 Cytochrome 1A1 induction by primaquine in human hepatocytes and HepG2 cells: absence of binding to the aryl hydrocarbon receptor. Biochem Pharmacol 57:255–262[CrossRef][Medline]
  41. Ledirac N, Delescluse C, de Sousa G, Pralavorio M, Lesca P, Amichot M, Berge JB, Rahmani R 1997 Carbaryl induces CYP1A1 gene expression in HepG2 and HaCaT cells but is not a ligand of the human hepatic Ah receptor. Toxicol Appl Pharmacol 144:177–182[CrossRef][Medline]
  42. Gasiewicz T, Rucci G 1991 {alpha}-Naphthoflavone acts as an antagonist of 2,3,7,8-tetrachlorodibenzo-p-dioxin by forming an inactive complex with the Ah receptor. Mol Pharmacol 40:607–612[Abstract]
  43. Kikuchi H, Hossain A, Yoshida H, Kobayashi S 1998 Induction of cytochrome P-450 1A1 by omeprazole in human HepG2 cells is protein tyrosine kinase-dependent and is not inhibited by {alpha}-naphthoflavone. Arch Biochem Biophys 358:351–358[CrossRef][Medline]
  44. Casper RF, Quesne M, Rogers IM, Shirota T, Jolivet A, Milgrom E, Savouret J-F 1999 Resveratrol has antagonist activity on the aryl hydrocarbon receptor: implications for prevention of dioxin toxicity. Mol Pharmacol 56:784–790[Abstract/Free Full Text]
  45. Feng Q, Kumagai T, Nakamura Y, Uchida K, Osawa T 2002 Induction of cytochrome P4501A1 by autoclavable culture medium change in HepG2 cells. Xenobiotica 32:1033–1043[CrossRef][Medline]
  46. Nebert D 1991 Proposed role of drug-metabolizing enzymes: regulation of steady state levels of the ligands that effect growth, homeostasis, differentiation, and neuroendocrine functions. Mol Endocrinol 5:1203–1214[Abstract/Free Full Text]
  47. Chang C-Y, Puga A 1998 Constitutive activation of the aromatic hydrocarbon receptor. Mol Cell Biol 18:525–535[Abstract/Free Full Text]
  48. Robertson JA, Hankinson O, Nebert DW 1987 Autoregulation plus positive and negative elements controlling transcription of genes in the [Ah] battery. Chem Scr 27A:83–87
  49. RayChaudhuri B, Nebert DW, Puga A 1990 The murine Cyp1a-1 gene negatively regulates its own transcription and that of other members of the aromatic hydrocarbon-responsive [Ah] gene battery. Mol Endocrinol 4:1773–1781[Abstract/Free Full Text]
  50. Kimura S, Smith HH, Hankinson O, Nebert DW 1987 Analysis of two benzo[a]pyrene-resistant mutants of the mouse hepatoma Hepa-1 P(1)450 gene via cDNA expression in yeast. EMBO J 6:1929–1933[Medline]
  51. Fair T, Hyttel P, Greve T, Boland M 1996 Nucleus structure and transcriptional activity in relation to oocyte diameter in cattle. Mol Reprod Dev 43:503–512[CrossRef][Medline]
  52. Sirard M, Florman H, Leibfried-Rutledge M, Barnes F, Sims M, First N 1989 Timing of nuclear progression and protein synthesis necessary for meiotic maturation of bovine oocytes. Biol Reprod 40:1257–1263[Abstract]
  53. Kastrop PM, Hulshof SC, Bevers MM, Destree OH, Kruip TA 1991 The effects of {alpha}-amanitin and cycloheximide on nuclear progression, protein synthesis, and phosphorylation during bovine oocyte maturation in vitro. Mol Reprod Dev 28:249–254[CrossRef][Medline]
  54. Memili E, First NL 1998 Developmental changes in RNA polymerase II in bovine oocytes, early embryos, and effect of {alpha}-amanitin on embryo development. Mol Reprod Dev 51:381–389[CrossRef][Medline]
  55. Dalbies-Tran R, Mermillod P 2003 Use of heterologous complementary DNA array screening to analyze bovine oocyte transcriptome and its evolution during in vitro maturation. Biol Reprod 68:252–261[Abstract/Free Full Text]
  56. Brevini-Gandolfi TA, Favetta LA, Mauri L, Luciano AM, Cillo F, Gandolfi F 1999 Changes in poly(A) tail length of maternal transcripts during in vitro maturation of bovine oocytes and their relation with developmental competence. Mol Reprod Dev 52:427–433[CrossRef][Medline]
  57. de Loos F, Kastrop P, Van Maurik P, Van Beneden TH, Kruip TA 1991 Heterologous cell contacts and metabolic coupling in bovine cumulus oocyte complexes. Mol Reprod Dev 28:255–259[CrossRef][Medline]
  58. Sutovsky P, Flechon J, Flechon B, Motlik J, Peynot N, Chesne P, Heyman Y 1993 Dynamic changes of gap junctions and cytoskeleton during in vitro culture of cattle oocyte cumulus complexes. Biol Reprod 49:1277–1287[Abstract]
  59. Mattioli M, Barboni B 2000 Signal transduction mechanism for LH in the cumulus-oocyte complex. Mol Cell Endocrinol 161:19–23[CrossRef][Medline]
  60. Brackett BG, Younis AI, Fayrer-Hosken RA 1989 Enhanced viability after in vitro fertilization of bovine oocytes matured in vitro with high concentrations of luteinizing hormone. Fertil Steril 52:319–324[Medline]
  61. Zuelke K, Brackett B 1993 Increased glutamine metabolism in bovine cumulus cell-enclosed and denuded oocytes after in vitro maturation with luteinizing hormone. Biol Reprod 48:815–820[Abstract]
  62. Farin CE, Yang L 1994 Inhibition of germinal vesicle breakdown in bovine oocytes by 5,6-dichloro-1-ß-D-ribofuranosylbenzimidazole (DRB). Mol Reprod Dev 37:284–292[CrossRef][Medline]
  63. Tatemoto H, Sakurai N, Muto N 2000 Protection of porcine oocytes against apoptotic cell death caused by oxidative stress during in vitro maturation: role of cumulus cells. Biol Reprod 63:805–810[Abstract/Free Full Text]
  64. Luvoni GC, Keskintepe L, Brackett BG 1996 Improvement in bovine embryo production in vitro by glutathione-containing culture media. Mol Reprod Dev 43:437–443[CrossRef][Medline]
  65. Okamoto T, Mitsuhashi M, Fujita I, Sindhu RK, Kikkawa Y 1993 Induction of cytochrome P450 1A1 and 1A2 by hyperoxia. Biochem Biophys Res Commun 197:878–885[CrossRef][Medline]
  66. Hazinski TA, Noisin E, Hamon I, DeMatteo A 1995 Sheep lung cytochrome P4501A1 (CYP1A1): cDNA cloning and transcriptional regulation by oxygen tension. J Clin Invest 96:2083–2089



This article has been cited by other articles:


Home page
EndocrinologyHome page
S. Tonack, K. Kind, J. G. Thompson, A. M. Wobus, B. Fischer, and A. N. Santos
Dioxin Affects Glucose Transport via the Arylhydrocarbon Receptor Signal Cascade in Pluripotent Embryonic Carcinoma Cells
Endocrinology, December 1, 2007; 148(12): 5902 - 5912.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. J. McMillan and C. A. Bradfield
The Aryl Hydrocarbon Receptor sans Xenobiotics: Endogenous Function in Genetic Model Systems
Mol. Pharmacol., September 1, 2007; 72(3): 487 - 498.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
D. Nestler, M. Risch, B. Fischer, and P. Pocar
Regulation of aryl hydrocarbon receptor activity in porcine cumulus-oocyte complexes in physiological and toxicological conditions: the role of follicular fluid
Reproduction, May 1, 2007; 133(5): 887 - 897.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
U. A. Bussmann, L. E. Bussmann, and J. L. Baranao
An Aryl Hydrocarbon Receptor Agonist Amplifies the Mitogenic Actions of Estradiol in Granulosa Cells: Evidence of Involvement of the Cognate Receptors
Biol Reprod, February 1, 2006; 74(2): 417 - 426.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
P. Pocar, D. Nestler, M. Risch, and B. Fischer
Apoptosis in bovine cumulus-oocyte complexes after exposure to polychlorinated biphenyl mixtures during in vitro maturation
Reproduction, December 1, 2005; 130(6): 857 - 868.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
P Pocar, B Fischer, T Klonisch, and S Hombach-Klonisch
Molecular interactions of the aryl hydrocarbon receptor and its biological and toxicological relevance for reproduction
Reproduction, April 1, 2005; 129(4): 379 - 389.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals