help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1509
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lall, S.
Right arrow Articles by Robinson, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lall, S.
Right arrow Articles by Robinson, I.
Endocrinology Vol. 145, No. 4 1602-1611
Copyright © 2004 by The Endocrine Society

Physiological Studies of Transgenic Mice Overexpressing Growth Hormone (GH) Secretagogue Receptor 1A in GH-Releasing Hormone Neurons

Sabrina Lall, Nina Balthasar, Danielle Carmignac, Charamboulos Magoulas, Abdul Sesay, Pamela Houston, Kathleen Mathers and Iain Robinson

Division of Molecular Neuroendocrinology, National Institute for Medical Research, London NW7 1AA, United Kingdom; Beth Israel Deaconess Medical Center, Division of Endocrinology, Harvard Medical School (N.B.), Boston, Massachusetts 02215; Department of Neurosurgery, Barts, and The London School of Medicine and Dentistry, Queen Mary, University of London (C.M.), London E1 4NS, United Kingdom; and Imperial College London, Department of Neuroendocrinology, Hammersmith Hospital (P.H.), London W12 ONN, United Kingdom

Address all correspondence and requests for reprints to: Prof. Iain C. A. F. Robinson, Division of Molecular Neuroendocrinology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, United Kingdom. E-mail: irobins{at}nimr.mrc.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The type 1A GH secretagogue (GHS) receptor (GHSR) has been proposed to mediate the effects of ghrelin on GH release, food intake, and body composition. We have overexpressed GHSR in GH-producing GC cells and GHRH neurons in an attempt to enhance signaling via this pathway selectively, in the GH axis. Constitutive overexpression of human GHSR in rat GC cell lines resulted in increased basal phosphoinositol turnover and rendered them responsive to GHS ligands. We then generated transgenic mice overexpressing human GHSR in GHRH neurons using a 38-kb rat GHRH cosmid promoter. GHRH-GHSR transgenic mice showed increased hypothalamic GHRH expression, pituitary GH contents, and postweaning growth rates. Body weights of the transgenic mice became similar in adulthood, whereas adipose mass was reduced, particularly so in female GHRH-GHSR mice. Organ and muscle weights of transgenic mice were increased despite chronic exposure to a high fat diet. These results suggest that constitutive overexpression of GHSR in GHRH neurons up-regulates basal activity in the GHRH-GH axis. However, GHRH-GHSR mice showed no evidence of increased sensitivity to acute or chronic treatment with exogenous GHS ligands. Food intake and adipose tissue responses to chronic high fat feeding and treatment with GHS ligands were unaffected, as were locomotor and anxiety behaviors, although GHRH-GHSR mice remained significantly leaner than wild-type littermates. Thus, constitutive overexpression of GHSR can up-regulate basal signaling activity in the GHRH/GH axis and reduce adiposity without affecting other GHSR-mediated signals.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GHRELIN IS A recently discovered gastrointestinal hormone (1) that promotes both GH release and fat accumulation and has been proposed to be an important factor linking ingestive behavior with endocrine regulation of metabolism and energy expenditure (2, 3). Ghrelin is thought to act via a G protein-coupled receptor known as the GH secretagogue receptor (GHSR) type 1A, initially identified (4) as the target of action of synthetic GH secretagogues (GHS). GHSR 1A transcripts are expressed at low levels in many tissues, but are most strongly expressed in the hypothalamic arcuate (ARC) and ventromedial nuclei (5), which are thought to be major sites of action of ghrelin and GHS analogs (6, 7).

Although ghrelin and GHS can release GH directly from pituitary GH cells, their major effects are exerted in the hypothalamus, in part via the release of GHRH, as the levels of GHRH in hypophysial portal blood increase acutely after GHS injections (8). The full effects of GHSs on GH secretion require an intact GHRH axis (9, 10, 11). Although some GHRH neurons express GHSR, most GHSR+ cells in ARC express neuropeptide Y (NPY) and agouti-related peptide (AGRP) (12, 13, 14), which are more likely targets for the effects of ghrelin on food intake and metabolism (15, 16, 17, 18).

Although ghrelin and GHSs are powerful pharmacological agents for stimulating GH release, the physiological importance of the ghrelin/GHSR system for regulating GH remains unclear. Chronic GHSR activation leads to a paradoxical increase in fat accumulation despite increased GH release, and ghrelin-mediated increases in adiposity occur in GH-deficient animals (2, 19), suggesting that ghrelin plays a GH-independent role in regulating food intake and body composition, and deletion of the genes for ghrelin or the GHSR do not lead to noticeable changes in growth (20, 21).

To study the physiological role of the GHSR in activating GH release, we have generated transgenic mice with overexpression of GHSR in GHRH neurons in an attempt to increase GHSR signaling selectively in the GHRH/GH axis. Stable lines of GH-producing cells overexpressing human GHSR type 1A (hGHSR 1A) were generated, which showed enhanced basal and GHS-stimulated GHSR signaling. We then used a 38-kb rat GHRH cosmid promoter, previously shown to specifically target hypothalamic GHRH neurons (22, 23), to increase GHSR expression in these neurons in transgenic mice, and tested the effects on GHRH expression, GH production and release, growth, food intake, and fat accumulation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GC cells expressing hGHSR 1A
Stable GHSR+ GC cell lines were generated by Lipofectamine-mediated transfection of the hGHSR 1A cDNA (4), provided by Andy Howard, Merck Research Laboratories, Rahway, NJ) cloned into a pcDNA3 vector containing a cytomegalovirus (CMV) promoter and a bovine GH polyadenylation signal. Cells were selected in G418-supplemented medium (250 µg/ml), and stable lines were frozen.

Measurements of phosphoinositol (PI) hydrolysis
PI hydrolysis was measured as described by Adams et al. (24). Briefly, 80% confluent GC cell cultures were incubated overnight in DMEM (Life Technologies Inc., Paisley, UK), containing 0.5% fetal calf serum and 5 µCi [3H]inositol (Amersham Pharmacia Biotech, Little Chalfont, UK). Cells were then washed in serum-free DMEM containing 10 mM LiCl and 10 mM inositol and incubated in triplicate wells with test substances for 2 h at 37 C, after which the medium was removed, and the cells were extracted in 3.3% perchloric acid. After the addition of 10 M KOH, the supernatants were applied to anion exchange columns (Dowex AG1-X8, Bio-Rad Laboratories, Hemel Hempstead, UK), and the PIs were eluted in 1 M ammonium formate. Membrane-bound PI was determined similarly by dissolving the cell remnants with 1 M NaOH and 1 M HCl. PI hydrolysis was expressed as: % free PI ÷ (% free + % bound PI) x 100.

Construction of a GHRH-GHSR transgene
We used a rat genomic GHRH cosmid vector with a unique MluI restriction site created in the 5'-untranslated region (5'UTR) of the GHRH hypothalamic exon 1 into which an MluI-linked hGH fragment had been cloned (22). To replace the hGH-coding sequences with GHS-R sequences, an MluI-linked fragment was generated with the hGHS-1A cDNA sequences directly flanked by short hGH 5' and 3'UTR sequences that give efficient expression and processing of transgene RNAs (22) and could be used subsequently to distinguish transgene hGHSR and endogenous mouse GHSR transcripts (23). This fragment was then inserted into the MluI site of the GHRH cosmid and packaged (Gigapack III XL, Stratagene, Amsterdam, The Netherlands) as previously described (22). The final cosmid insert was a 38-kb NotI fragment containing 16 kb of 5' and 14 kb of 3' rat GHRH genomic sequences driving expression of the hGHSR cDNA flanked by short 3'- and 5'UTR hGH sequences.

Generation of GHRH-GHSR transgenic mice
All animal experiments were carried out in accordance with the relevant institutional and national guidelines. The 38-kb cosmid insert was released by NotI digestion, purified, and microinjected into fertilized (CBa/CaxC57BL/10)F1 mouse oocytes, which were transferred into the oviducts of pseudopregnant recipients. Tail-tip DNA from the offspring was tested for the presence of the GHRH-GHSR transgene using PCR and Southern blotting.

PCR and Southern blotting
For PCR genotyping, three primers were used. Primers 1 (5'-AAC CAC TCA GGG TCC TGT GGA CA-3') and 2 (5'-CCG AGA ACT TTC ATC TTT CAG-3') amplified a 506-bp hybrid hGH/hGHSR fragment only present in the transgene, whereas primer 1 and a third hGH primer (5'-CCT CTT GAA GCC AGG GCA GGC A-3') amplified an endogenous 300-bp mouse GH product as an internal control. For Southern blotting, DNA was digested with BglII and probed with a full-length hGHSR probe after random-prime 32P labeling using standard procedures.

RT-PCR
RNA was extracted using TRIzol reagent (Life Technologies, Inc.), and 500 ng were transcribed with 200 U Moloney murine leukemia virus reverse transcriptase (Roche Diagnostics, Lewes UK) in 1x Moloney murine leukemia virus reverse transcriptase buffer (Roche Diagnostics) supplemented with 1 µg random primers (Life Technologies, Inc.), deoxy-NTPs (Amersham Pharmacia Biotech; 0.3 mM), 40 U ribonuclease (RNase) inhibitor (Promega Corp., Southampton, UK), and 5 mM dithiothreitol. The mixture was incubated at 37 C for 2 h, and cDNAs were amplified by PCR using appropriate primer pairs. For mouse GHRH these were: forward, TGTTGAGCCCGTTACCGACC; and reverse, TGTCAGCACCTTTGCCGC. For hGHSR, the primer pairs were: forward, TTCGTCAGTGAGAGCTGCACCTAC; and reverse, AAATATCGCCCTACGTGGAAGG. For controls, mouse ß-actin transcripts were amplified using the following primers: forward, TGTAACCAACTGGGACGATATGG; and reverse, GATCTTGATCTTCATGGTGCTAGG.

RNase protection assays (RPAs)
RPAs were performed using the RPA III kit (Ambion, Inc., Huntingdon, UK). [32P]UTP-labeled RNA probes were purified by gel electrophoresis and incubated (1 x 105cpm) with 10 µg hypothalamic RNA samples at 42 C overnight. After hybridization, samples were treated with RNase, and protected fragments were separated on 5% acrylamide gels. Gels were analyzed using ImageQuant (Molecular Dynamics, Sunnyvale, CA), and the amount of protected sample RNA was normalized to ß-actin RNA, measured by RPA in the same samples. Mouse GHRH probes were generated from IMAGE clone 1496474 (HGMP Resource Center, Cambridge, UK) as previously described (23).

In situ hybridization
Coronal frozen brain sections (12 µm) were thaw-mounted onto gelatin- and chrome alum-coated slides and stored at -70 C until use. Sections throughout the ARC were hybridized with full-length [35S]UTP-labeled antisense or sense riboprobes and exposed to x-ray films, all as previously described (25). Because rodent and hGHSR sequences are highly homologous, two sets of probes were used. To compare total GHSR expression between transgenic and nontransgenic brains, a riboprobe corresponding to a full-length rat GHSR receptor cDNA was used. To identify transgene transcripts specifically, we used an oligonucleotide probe corresponding to the 5'UTR sequence of hGH uniquely present in the transgene transcript.

Immunocytochemical detection of Fos protein
Ninety minutes after injection of GHS or saline, mice were terminally anesthetized with pentobarbitone (60 mg/kg, ip) and perfused transcardially with heparinized isotonic saline, followed by 4% paraformaldehyde in 0.1 M phosphate buffer (PB). Brains were incubated in the same fixative containing 15% sucrose, transferred to a 30% sucrose solution in PB overnight, and then stored at -70 C. Coronal sections (30 µm) were cut through the ARC, and every third section was collected into PB. Endogenous peroxidases were inactivated by incubating in PB containing 20% methanol, 0.2% Triton X-100, and 1.5% hydrogen peroxide for 15 min. Sections were then incubated with a rabbit polyclonal anti-Fos antibody (PC38; Merck Biosciences Ltd., Nottingham UK; 1:40,000 in 1% normal sheep serum/0.3% Triton X-100/0.1 M PB) for 24 h at 4 C. After washing, bound antibody was localized using a peroxidase-labeled antirabbit IgG (Vector Laboratories, Inc., Peterborough, UK; 1:200 for 2 h at room temperature) and visualized using a nickel-intensified diaminobenzidine reaction (26), giving a purple/black precipitate. For each brain the number of Fos-positive nuclei was counted blind and bilaterally on each section (15–20 sections/brain) for each region (arcuate, suprachiasmatic, retrochiasmatic, paraventricular, dorsomedial, and ventromedial nuclei; medial and ventromedial preoptic areas; and lateral and anterior hypothalamic area). The number of nuclei per section was averaged for each region of every brain, and the data for each treatment group were pooled and presented as nuclei per section per mouse.

Physiological studies in GHRH-GHSR transgenic mice
Plasma GH responses to GHSs were tested in groups of 5-month-old male or female GHRH-GHSR mice. Under anesthesia (60 mg/kg; Sagatal, Rhone Merieux, Harlow, UK), a jugular vein was catheterized, and blood samples (50 µl) were collected into heparinized tubes before and 5 min after iv injection of either 10–50 ng GHRH [hGHRH-(1–29)NH2] or 50–250 ng GH-releasing peptide-6 (GHRP-6; Ferring AB, Malmo, Sweden) in 50 µl PBS containing 0.05% BSA. After a 90-min recovery period, a second sampling/injection/sampling procedure was carried out. Samples were centrifuged, and the plasma was stored frozen for GH measurements.

High fat feeding
Groups of GHRH-GHSR transgenic and nontransgenic mice (3.5-month-old females; n = 6) were housed in groups and fed a normal (<4% fat) chow diet (3.4% fat, 18.8% protein, 3.7% fiber, 3.8% ash, and 60.3% carbohydrate; 15.6 MJ/kg; Special Diet Services, Witham, UK) or a fat-enriched (30%) diet (protein content maintained at 18.8%; gross energy content, 21.7 MJ/kg) for 2 months. Body weight and daily food intake were measured for 24 d, after which bilateral inguinal, ovarian, and renal fat depots and mesenteric fat were all dissected and weighed.

Chronic treatment with GHRP-6
Two groups of individually housed, 3- to 4-month-old female GHRH-GHSR and wild-type (WT) mice were injected sc twice daily with GHRP-6 (0.5 mg/kg·d in 100 µl saline) or saline vehicle for 3 wk. All mice were fed the 30% high fat diet, and body weight and food intake were recorded. Measurements of food intake in individual mice were also obtained at 1, 2, and 4 h after one of the injections of GHRP-6. At the end of the study, fat pad, muscle, and heart weights were recorded, and right tibial lengths were measured with calipers.

Anxiety and activity analysis of GHRH-GHSR mice
Male and female GHRH-GHSR and WT mice were tested on elevated plus maze (27, 28). The maze has two open arms and two closed arms, and the amount of time spent in the open arm is negatively correlated with anxious behavior. Mice were placed in the maze for 5 min, and the amount of time spent in the open arms was recorded. In a separate study activity was measured in an open field test by recording the number of quadrants entered within a 5-min period.

RIAs
Plasma samples or pituitary homogenates were assayed for mouse GH and mouse prolactin (PRL) contents by specific RIAs, using reagents supplied by Dr. A. L. Parlow (National Hormone and Peptide Program, NIH, Bethesda, MD). Pituitaries were homogenized in PBS and assayed at several dilutions. Plasma was assayed directly for GH; the limit of detection was 0.2 ng/ml.

Statistical analysis
Unless otherwise stated, results are the mean ± SE. For body weight data, a two-way ANOVA was performed, with time and treatment as independent variables, followed by Bonferroni or Newman-Keuls tests. In vitro data were analyzed by one-way ANOVA and t test. Nonparametric data were analyzed using Kruskal-Wallis and Mann-Whitney tests, with P < 0.05 considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GHSR+ GC cells
Several stable GC cell lines were established after transfection with the CMV-hGHSR type 1a construct (Fig. 1AGo). RT-PCR analysis using primers for the hGHSR readily amplified the expected 495-bp transcript in GHSR+ GC cells (Fig. 1BGo), but did not detect hGHSR transcripts in untransfected GC cells. The membranes of these cells could be stained with an antibody against the C-terminal domain of hGHSR (not shown), suggesting that they were generating and translocating GHSR protein. To test whether the hGHSR was functionally coupled, two lines (no. 2 and 13) of GHSR+ GC cells and an untransfected GC cell line were incubated with or without GHRP-2 (100 nM) for 2 h, and effects on PI turnover were measured.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 1. GC cells stably expressing the hGHSR. A, GC cells were transfected with a CMV construct driving expression of the hGHSR 1a cDNA with a bovine GH polyadenylation signal (bGH pA). B, RT-PCR of 0.5 µg cDNA using hGHSR primers (1F and 2R) amplified the expected 495-bp product from a rat GHSR cDNA (lane 1) and GC-GHSR cells (lane 4), but not from untransfected cells (lane 3) or from GC-GHSR cell extracts without addition of reverse transcriptase (lane 2). M, Size marker lane. C, Untransfected GC cells (control) and two lines of GC-GHSR+ cells (nos. 2 and 13; n = 3) were prelabeled with [3H]inositol and then incubated with or without 100 nM GHRP-2, and their percent PI turnover was measured. Data shown are the mean ± SEM. *, P < 0.05; **, P < 0.001; ***, P < 0.001.

 
Basal PI turnover was low in the untransfected GC cells, and GHRP-2 treatment had no effect (Fig. 1CGo). In contrast, basal PI turnover was increased in the absence of ligand in both GHSR+ GC cell lines, and both showed a marked increase after GHRP-2 stimulation (Fig. 1CGo). These experiments were replicated four times with GHSR+ GC cells exposed to different doses of GHRP-2 (0.1–100 mM) and showed a consistently higher basal PI turnover in GHSR+ vs. untransfected GC cells (2.20 ± 0.15% vs. 1.5 0 ± 0.14%; P < 0.01; n = 9), increasing to 5.3 ± 0.34% upon GHRP-2 stimulation (P < 0.001 vs. basal), with a maximal response at 1 mM GHRP-2. Other peptidyl (GHRP-6) and nonpeptidyl (L-163,255) GHS ligands also increased PI turnover (P < 0.01 vs. basal) in these stable GHSR+ GC cell lines (data not shown).

GHRH-GHSR transgenic mice
From fertilized oocytes microinjected with the GHRH-GHSR construct (see Materials and Methods; Fig. 2AGo) and transferred into pseudopregnant recipients, 42 live pups were obtained, and their tail tip DNA was analyzed by PCR for the presence of the transgene (Fig. 2BGo). A founder pup with a transgene copy number approximately 8-fold greater than that of WT animals (as estimated by Southern blotting) was used to establish a line of GHRH-GHSR transgenic mice on a CBa/CaxC57BL/10 background. The mice were fully fertile, litter sizes were normal, and the line was maintained hemizygous to obtain equal numbers of WT littermate controls for physiological experiments.



View larger version (84K):
[in this window]
[in a new window]
 
FIG. 2. Generation of GHRH-GHSR transgenic mice. A, The hGHSR 1a cDNA was fused to short 5'- and 3'UTR hGH sequences () and inserted into the first hypothalamic exon of the rGHRH gene in a 38-kb cosmid (exons shown as {blacksquare}, not drawn to scale). B, Genotyping of GHRH-GHSR mice by PCR of tail DNA (F, forward primer; R, reverse primer; see Materials and Methods) generated an endogenous 300-bp product in all mice and an additional 506-bp product in transgenic (T), but not WT, mice. C, In situ hybridization of hypothalamic sections using a rGHSR riboprobe. Upper panel, Brightfield showing GHSR mRNA in the ARC (arrows) of WT and transgenic (T) mice. Lower panel, The same sections were dipped in photographic emulsion and analyzed by darkfield microscopy (magnification, x40) to show more highly labeled neurons (arrowheads) in the ARC of GHRH-GHSR transgenic mice. D, RPA for mouse GHRH mRNA (top panels) and ß-actin (bottom panels) in pooled hypothalamic extracts from WT and GHRH-GHSR transgenic (T) littermates.

 
Using a hGHSR probe that detects both human and mouse GHSR transcripts, in situ hybridization analysis showed that total GHSR expression was higher in GHRH-GHSR mice than their WT littermates, with increased expression in individual cells obvious when sections were dipped into photographic emulsion and analyzed in darkfield (Fig. 2CGo). RPA and in situ hybridization with an oligonucleotide probe specific for GHRH-GHSR transgene transcripts confirmed the expression of GHRH-GHSR in transgenic, but not WT, littermates. No transgene expression was observed in a variety of other peripheral tissues (pancreas, stomach, pituitary, gut, spleen, kidney, liver, or heart; data not shown).

Mouse GHRH mRNA levels were measured by RPAs in hypothalamic extracts from WT and GHRH-GHSR mice. There was significantly higher GHRH expression in GHRH-GHSR transgenic mice than in WT littermate controls (4.2 ± 0.3 vs. 2.5 ± 0.5 arbitrary units normalized to actin; n = 4; P < 0.05; Fig. 2DGo).

Growth and pituitary GH and PRL contents in GHRH-GHSR mice
Male and female GHRH-GHSR transgenic mice were the same size as their WT littermates at weaning, but developed a slight growth acceleration postweaning (Fig. 3AGo). The difference became significant around 6 wk, but remained small (5–10%) and disappeared as the animals reached adulthood (weights at 230 d: male GHRH-GHSR, 40.9 ± 1.0 g; male WT, 39.7 ± 0.5 g; female GHRH-GHSR, 28.3 ± 0.9 g; female WT, 29.0 ± 1.8 g; P = NS). Pituitary GH and PRL contents were measured in groups of adult male and female GHRH-GHSR and WT mice (Fig. 3BGo). GH stores (micrograms per pituitary) were significantly higher in male, but not female, transgenic mice, whereas PRL stores (Fig. 3CGo) were indistinguishable between transgenic and WT animals.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 3. Growth curves and pituitary GH and PRL contents in GHRH-GHSR transgenic mice. A, Growth curves are shown from four litters of age-matched male ({blacksquare} and {square}) and female ({bullet} and {circ}) GHRH-GHSR transgenic (T) mice ({blacksquare} and {bullet}) and WT littermates ({square} and {circ}). B and C, Pituitary GH and PRL contents were measured in groups of GHRH-GHSR transgenic (T) and WT mice (n = 7–8/group). Data are the mean ± SEM. *, P < 0.05; **, P < 0.01 (vs. WT).

 
GH responses in GHRH-GHSR transgenic mice
GH responses to GHRH and GHRP-6 were measured in anesthetized male transgenic and WT mice, and the results are shown in Table 1Go. Basal GH levels were similar in GHRH-GHSR transgenic and WT mice, and GHRH injections elicited dose-related GH responses that were equivalent in both GHRH-GHSR transgenic and WT mice. In similar experiments performed with GHRP-6 injections, peak plasma GH responses were lower than in experiments with GHRH injections, but did not differ between GHRH-GHSR and WT mice (Table 1Go). Similar results were obtained in female mice (data not shown). These results suggested that overexpression of hGHSR in GHRH neurons did not confer increased responsiveness to acute injections of GH secretagogues.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Peak plasma GH responses to GHRH or GHRP-6 in GHRH-GHSR transgenic mice

 
Fos protein response after GHRP-6 injections in GHRH-GHSR transgenic mice
A more direct measure of hypothalamic responses to GHSR signaling is the induction of Fos responses in ARC neurons. Therefore, groups of conscious GHRH-GHSR or WT male mice were injected with GHRP-6 (0.5 mg/kg; n = 7–8) or saline (n = 7), and the number of Fos-immunopositive cells was counted in ARC and other brain regions. There was no difference in the number of Fos-positive cells in ARC in GHRH-GHSR vs. WT mice after saline injection. As expected, a marked increase in Fos-positive ARC nuclei was observed after GHRP-6 injection in WT mice, but this was clearly blunted in GHRP-6-injected GHRH-GHSR mice (Fig. 4Go). No differences were seen after saline or GHRP-6 injection in GHRH-GHSR vs. WT mice in any other brain region examined (see Materials and Methods).



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 4. Central activation of ARC cells by GHRP-6 in GHRH-GHSR transgenic mice. Fos-positive cells per section were counted in the hypothalamic ARC of GHRH-GHSR transgenic (T) and WT male mice after ip injection of saline ({square}) or GHRP-6 (50 µg; {blacksquare}). GHRP-6 administration increased the number of Fos-positive cells in WT, but not transgenic, mice. Data are the mean ± SEM. *, P < 0.05 vs. WT, by Mann-Whitney test.

 
Adiposity and diet-induced obesity in GHRH-GHSR transgenic mice
As noted above, the body weight differences reflecting a faster postweaning growth rate in the GHRH-GHSR transgenic mice were not maintained in adulthood. At 5 months of age there was no difference in nose-anus length (males: GHRH-GHSR, 103.4 ± 1.1; WT, 100.8 ± 0.8 mm; females: GHRH-GHSR, 96.4 ± 0.8 mm; WT, 95.1 ± 1.3 mm; n = 8–16/group; P = NS). However, there was less adipose tissue in the GHRH-GHSR mice, particularly so in females, which had consistently smaller ovarian, renal, inguinal, and mesenteric fat pads than WT females.

To document these differences and their sensitivity to dietary fat, groups of adult GHRH-GHSR and WT mice were either maintained on their normal low fat (<4%) chow diet or switched to a diet enriched to 30% fat for 2 months, after which their fat pad weights were measured. Over this period, both GHRH-GHSR and WT mice gained weight on normal chow, but the weight gain was significantly less for the GHRH-GHSR mice vs. WT mice (Fig. 5Go). As expected, both groups of animals switched to the 30% fat diet gained significantly more weight than those remaining on normal chow, but the increase was more variable in the transgenic group, and the difference between the fat-fed groups was not statistically significant (Fig. 5AGo).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 5. Body weight gain and fat pad weights in GHRH-GHSR mice on a 30% fat diet. Female GHRH-GHSR transgenic (T) and WT mice (n = 6/group) were fed ad libitum a 30% fat diet for 2 months. A, Total body weight gain. Ovarian (B), renal (C), inguinal (D), and mesenteric (E) fat depots were dissected and weighed. {square}, Chow diet; {blacksquare}, 30% fat diet. Data are expressed as the mean ± SEM percent body weight. *, P < 0.05; **, P < 0.01.

 
In this experiment the mice were group-housed by treatment (n = 6), so we could only record by group the daily food ingested. We then calculated the average calorie intake for the groups after accounting for the different calorific contents of the diets. The WT fat-fed group consumed a comparable amount of calories as the WT chow-fed group (WT fat-fed, 14.73 ± 0.67 kcal/mouse·d; WT chow-fed, 13.94 ± 0.28 kcal/mouse·d). However, the GHRH-GHSR fat-fed group consumed, on the average, one third more calories than the GHRH-GHSR chow-fed group (GHRH-GHSR fat-fed, 15.76 ± 0.55; GHRH-GHSR chow-fed, 11.69 ± 0.26).

These data were confirmed in another experiment in which food intake and fat pad weights were measured in individually housed transgenic and WT littermates. As expected, all fat-fed mice had larger fat pad weights than chow-fed mice, but the difference was only significant for the WT animals (P < 0.05). Regardless of the diet, the GHRH-GHSR transgenic mice tended to have smaller fat pads than their WT littermates (Fig. 5Go, B–E), but the differences were only statistically significant between the chow-fed GHRH-GHSR and WT mice.

Effects of GHRP-6 treatment on GHRH-GHSR and WT mice fed a high fat diet
We next tested whether chronic treatment with a GHSR ligand would differentially affect food intake and/or fat accumulation in GHRH-GHSR and WT mice fed the same 30% fat diet. Accordingly, groups of 3- to 4-month-old female GHRH-GHSR or WT mice were individually housed, offered the 30% fat diet ad libitum, and injected twice daily with either GHRP-6 (0.5 mg/kg·d, sc) or saline.

All mice gained weight significantly over the course of the study (Fig. 6Go). Animals receiving GHRP-6 gained more weight than those receiving saline injections (P < 0.05), and the increases were comparable between transgenic and WT mice (Fig. 6Go). Acute food intake responses after GHRP-6 or saline injection showed no significant differences [food intake (grams) expressed as percent body weight: GHRP-6-injected GHRH-GHSR, 0.40 ± 0.09%; saline-injected GHRH-GHSR, 0.29 ± 0.19%; GHRP-6-injected WT, 0.36 ± 0.17%; saline-injected WT, 0.10 ± 0.06%]. Again, fat pads were significantly smaller in saline-treated GHRH-GHSR transgenic mice compared with WT controls (fat weight expressed as percent body weight: GHRH-GHSR, 5.60 ± 0.91%; WT, 11.61 ± 1.54%; P < 0.01). GHRP-6 treatment had no differential effect on fat pad weight in GHRH-GHSR mice, but fat pads in GHRP-6-treated GHRH-GHSR mice remained significantly smaller than those in GHRP-6-treated WT mice (GHRH-GHSR, 6.42 ± 0.77%; WT, 12.03 ± 1.54%; P < 0.01).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 6. Weight gain in GHRH-GHSR mice treated with GHRP-6. Groups of WT (A; n = 4–5) and GHRH-GHSR transgenic mice (B; n = 6) transgenic mice were placed on a high fat diet (open arrow). Two weeks later, the mice were given twice daily injections (solid arrow) of saline ({circ} and {square}) or GHRP-6 (0.5 mg/kg·d; {bullet} and {blacksquare}). Body weights were recorded throughout. Data are shown as the mean ± SEM. *, P < 0.05, GHRP-6 vs. saline treatment, by two-way ANOVA and Newman-Keuls test.

 
Tibial length was similar in transgenic and WT mice and was unaffected by GHRP-6 treatment (Table 2Go). Heart weight was greater in GHRH-GHSR mice than in WT mice both in absolute terms and when expressed as a percentage of body weight (0.70 ± 0.03% vs. 0.47 ± 0.02%; P < 0.01) and was increased by GHRP-6 treatment in WT, but not GHRH-GHSR, mice (Table 2Go). Gastrocnemius muscle weight was also increased in GHRH-GHSR mice compared with WT controls, both in absolute terms and as a proportion of body weight (GHRH-GHSR, 0.60 ± 0.01%; WT, 0.50 ± 0.02%; P < 0.01), but GHRP-6 treatment only marginally increased gastrocnemius weight in WT mice (P = 0.06) and not in transgenic mice (Table 2Go).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Tibia length and gastrocnemius muscle and heart weights in GHRH-GHSR transgenic mice treated with GHRP-6

 
Anxiety and activity tests in GHRH-GHSR mice
As both GHRH and GHS ligands have been implicated in inducing differences in activity or wakefulness, GHRH-GHSR mice were examined in elevated plus maze and open field locomotor tests. No significant differences between GHRH-GHSR and WT mice were observed in either test. In the elevated plus maze test, time spent in the open arms were: male GHRH-GHSR, 40 ± 11 sec; male WT, 32 ± 7 sec; female GHRH-GHSR, 68 ± 9 sec; and female WT, 67 ± 17 sec. Exploratory locomotor activity in an open field test were: male GHRH-GHSR, 69 ± 19 quadrants/5 min; male WT, 42 ± 7 quadrants/5 min; female GHRH-GHSR, 88 ± 36 quadrants/5 min; and female WT, 84 ± 17 quadrants/5 min.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study we attempted to selectively increase the impact of the GHSR axis on the regulation of GH secretion by overexpressing the GHSR in GH cells and GHRH cells in vitro and in vivo, respectively. As somatotrophs respond directly to GH secretagogues and ghrelin, they must express some functional GHSR (4), but the abundance is much lower in the pituitary than in the hypothalamus (5, 29). To establish stable overexpression of hGHSR type 1a and to test its functional competence, we used GC cells, a readily transfectable GH-producing pituitary cell line that has undetectable basal expression of endogenous GHSR. For an in vivo model, we used transgenesis with a 38-kb rat GHRH cosmid promoter (22) to target overexpression of hGHSR to GHRH neurons, because these have been implicated as major downstream mediators of the hypothalamic effects of GHS on GH release (8, 10, 11, 30). Koch et al. (31) showed the viability of this approach using transgenic overexpression of ß-adrenergic receptors to enhance functional signaling in the myocardium in the absence of extraligand stimulation. We wanted to achieve a similar increase in GHSR signaling in GHRH/GH axis, but without affecting GHSR-mediated pathways in other cells.

The hGHSR has been expressed in a number of heterologous cell lines and signals in some hGH-producing adenomas (24), but surprisingly little has been done with expression of GHSR in GH-producing cell lines, which would provide the most appropriate complement of downstream signaling and adaptor molecules. We isolated several stable hGHSR+ GC cell lines in which PI turnover was markedly stimulated by GH secretagogues that had no effect in the untransfected parent cell line. Interestingly, basal PI turnover was significantly enhanced in the absence of ligand in hGHSR+ GC cells. Assuming that this did not reflect autocrine production of some endogenous ligand, this suggested that overexpression of the hGHSR construct per se might be enough to increase basal GHSR signaling.

A recent study with overexpression of GHSR in other heterologous cell systems supports this idea, as it showed that high GHSR expression can induce signaling in the absence of ligand (32). GC cells release GH constitutively in culture, and we did not attempt to measure increased GH in response to GHS in vitro. However, in preliminary experiments these hGHSR+ GC cells were implanted into Wistar-Furth rats and produced a massive GH secretory response after iv challenge with GHRP-6 (our unpublished observations).

Encouraged by this increased basal signaling in GC cells overexpressing GHSR, we turned to an in vivo model. Microinjection of the GHRH-hGHSR transgene construct in oocytes enabled us to establish a line of transgenic mice with approximately 8-fold increased hGHSR copy number vs. mouse GHSR. In situ hybridization confirmed overexpression of the GHSR in the hypothalamic ARC, with many more intensely labeled cells compared with WT littermates. No expression of the hGHSR transgene was detected in any other tissue examined, other than the hypothalamic ARC, and previous studies have shown that this GHRH construct colocalizes transgene expression to GHRH neurons.

Overexpression of GHSR in GHRH neurons doubled ARC GHRH expression in GHRH-GHSR transgenic mice compared with WT littermates. Furthermore, pituitary GH, but not PRL, contents were elevated in male GHRH-GHSR transgenic mice, although not significantly so in female GHRH-GHSR mice. Increased GH should depress GHRH expression by negative feedback (33, 34), so these results strongly suggest that the increase in pituitary GH reflects a steady state up-regulation of GHRH output, which is known to directly stimulate GH synthesis and secretion (35).

An increased activity in the GHRH/GH axis could account for the small, but significant, increase in the postweaning growth rate in transgenic mice, their increased muscle and heart mass (despite chronic high fat feeding), as well as the reduced amount of body fat in adult mice, the latter most prominent in females. Enhanced basal activity in the GHRH/GH axis could be caused by the increased constitutive GHSR signaling we and others (32) observed in the absence of endogenous ligand, but could also reflect a greater responsiveness of GHRH neurons to circulating stomach-derived ghrelin (1) or from a hypothalamic source (7, 36).

However, we found no increased responsiveness to acute administration of GHSs, nor any selective increase in response to homologous vs. heterologous ligands; both GHRP-6 and GHRH elicited large GH responses, but these did not differ between transgenic and WT mice. Furthermore, the ARC cellular Fos responses to peripheral GHS administration (37) were blunted, rather than increased, in GHRH-GHSR transgenic mice.

What could explain this unexpected finding? Firstly, the major ARC cell type showing a Fos response to GHS injection is the NPY/AGRP cell line, whereas the GHRH cells targeted by our transgene are a much smaller proportion of Fos-responding cells (12, 38). It is possible that the increased GH release caused by chronic up-regulation of GHSR signaling in GHRH neurons could up-regulate somatostatin or down-regulate endogenous GHSR signaling in the NPY pathway, as NPY and GHRH expression are regulated in an opposite fashion by changes in GH status (39, 40). A reduction in Fos responses in GHRH-GHSR mice could reflect desensitization, because the Fos response to an iv bolus injection of GHRP-6 is lost after a prior continuous exposure to GHRP-6 (41), but such a desensitization should be restricted to GHRH neurons, whereas we found that the Fos responses in all ARC areas were reduced. A more speculative explanation is suggested from the recent study by Holst et al. (32), who have shown that the high basal signaling activity of overexpressed GHSRs is susceptible to silencing by inverse agonists. Whatever the mechanism, some relationship must exist between GHRH and other hypothalamic GHS-responsive neurons, because up-regulation of GHSR in the former leads to a reduction in GHS-induced Fos responses in the latter.

The faster postweaning growth rate, an increase in muscle and heart mass, and a reduction in fat are all consistent with an upward resetting of the GHRH-GH axis in GHRH-GHSR mice (42). The reduced adiposity was particularly notable in the females, which normally develop larger fat depots than males. Interestingly, the lean phenotype of GHSR mice persisted even on a fat-enriched diet, with GHRH-GHSR mice continuing to maintain a lower adiposity than WT mice.

There is abundant evidence linking GH with adiposity. Obesity is associated with reduced GH secretion and responsiveness in rodents (43, 44), GH deficiency promotes the accumulation of fat, which can be reversed by GH treatment, and GH hypersecretion reduces fat mass (45, 46, 47). Other factors, such as increased activity in the hypothalamo-pituitary-adrenal (HPA) axis, augmented by a high fat diet (48), could also contribute to increased body fat. GHSR ligands can transiently increase activity in the HPA axis (49, 50, 51), but this is unlikely to be mediated via GHRH neurons, to which GHSR overexpression is restricted in our mice. Anxiety-related behaviors are affected by changes in the HPA axis, high fat diet, and ghrelin (52), and GH secretagogues have been implicated in states of anxiety and wakefulness (52, 53, 54). However, GHRH-GHSR and WT mice showed no differences in anxiety or exploratory behaviors.

Long-term GHS and ghrelin treatments cause modest increases in body weight in a variety of rodent models (19, 55, 56, 57). Although the effects of GHS on body weight were initially attributed to their GH-releasing effects, it is now clear that a significant proportion of the weight gain is due to increased body fat and reflects GH-independent effects (2, 19). Effects of ghrelin on food intake and fat deposition probably involve changes in the activity of several hypothalamic circuits (58) involving NPY/AGRP-containing and proopiomelanocortin-containing neurons among others (7, 17, 18). We found that chronic GHS treatment increased body weight and some organ weights in both GHRH-GHSR transgenic and WT mice, but had no differential effect on daily food intake or fat accumulation, suggesting that the enhancement of GHSR signaling in GHRH neurons did not alter the overall responses to GHS treatment. This was to be expected because these responses are likely to be mediated by hypothalamic targets other than GHRH neurons.

Our aim was to focus on enhanced GHSR signaling in the GHRH-GH axis. Despite the large number of studies of the ghrelin/GHSR system, there are still many questions about its physiological role in relation to normal GH secretion. Administration of large doses of ghrelin and other GHS have impressive effects on the GH axis (59, 60, 61), but the link between circulating endogenous ghrelin and physiological GH release remains unclear (62, 63, 64). A hypothalamic ghrelin system has been described (7), but it remains to be established whether it activates GHRH neurons to release GHRH into portal blood (8). Preliminary reports from knockout experiments suggest that the GHSR system does not play an essential role in the GH axis (20), certainly not compared with the GHRH receptor or its ligand (65, 66).

Although increased expression of the GHSR in GHRH neurons appears to leads to an upward resetting of the GH axis in GHRH-GHSR mice, interpretation of their responses to exogenous GHS administration is complicated, because they still have a full complement of their endogenous GHSR in many different cell types, including hypothalamic NPY cells and pituitary GH cells. Although the phenotype of GHSR knockout mice is not dramatic, GH responses to ghrelin are clearly lost (20). It will thus be of interest to cross our GHRH-GHSR mice with GHSR-null mice to be able to evaluate the effects of ghrelin in their progeny, whose only GHSR signaling pathway will be confined to GHRH neurons.


    Acknowledgments
 
We thank Ms. Rubika Balendra and Drs. Eric Adams, Sam Cooke, Evelien Gevers. and Paul Le Tissier for help with and advice about some of these studies. Many thanks to animal technicians, Clare Brazil, Monika Franchi, and Lucy Fern, for the daily care and maintenance of the mice. We thank Drs. Smith, Howard, and Woods (Merck Research Laboratories) for many hGHSR reagents and ligands, Dr. A. L. Parlow and the National Hormone and Pituitary Program for assay reagents, and Ferring AB for the peptides used in this study.


    Footnotes
 
This work was supported by the Medical Research Council of the United Kingdom.

S.L. and N.B. contributed equally to this work.

Abbreviations: AGRP, Agouti-related peptide; ARC, arcuate nucleus; CMV, cytomegalovirus; GHRP, GH-releasing peptide; GHS, GH secretagogue; GHSR, GH secretagogue receptor; h, human; HPA, hypothalamo-pituitary-adrenal; NPY, neuropeptide Y; PB, phosphate buffer; PI, phosphoinositol; PRL, prolactin; r, rat; RNase, ribonuclease; RPA, ribonuclease protection assay; UTR, untranslated region; WT, wild-type.

Received November 6, 2003.

Accepted for publication December 23, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K 1999 Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402:656–660[CrossRef][Medline]
  2. Tschop M, Smiley DL, Heiman ML 2000 Ghrelin induces adiposity in rodents. Nature 407:908–913[CrossRef][Medline]
  3. Muccioli G, Tschop M, Papotti M, Deghenghi R, Heiman M, Ghigo E 2002 Neuroendocrine and peripheral activities of ghrelin: implications in metabolism and obesity. Eur J Pharmacol 440:235–254[CrossRef][Medline]
  4. Howard AD, Feighner SD, Cully DF, Arena JP, Liberator CI, Hamelin M, Hreniuk DL, Palyha OC, Anderson J, Paress PS, Diaz C, Chou M, Liu KK, McKee KK, Pong SS, Chaung LY, Elbrecht M, Heavens R, Rigby M, Sirinathsinghji DJS, Dean DC, Melillo DG, Patchett AA, Nargund R, Griffin PR, DeMartino JA, Gupta SK, Schaeffer JM, Smith RG, VanderPloeg LHT 1996 A receptor in pituitary and hypothalamus that functions in growth hormone release. Science 273:974–977[Abstract]
  5. Guan XM, Yu H, Palyha OC, McKee KK, Feighner SD, Sirinathsinghji DJ, Smith RG, VanderPloeg LHT, Howard AD 1997 Distribution of mRNA encoding the growth hormone secretagogue receptor in brain and peripheral tissues. Brain Res Mol Brain Res 48:23–29[Medline]
  6. Bowers CY 2001 Unnatural growth hormone-releasing peptide begets natural ghrelin. J Clin Endocrinol Metab 86:1464–1469[Free Full Text]
  7. Cowley MA, Smith RG, Diano S, Tschop M, Pronchuk N, Grove KL, Strasburger CJ, Bidlingmaier M, Esterman M, Heiman ML, Garcia-Segura LM, Nillni EA, Mendez P, Low MJ, Sotonyi P, Friedman JM, Liu H, Pinto S, Colmers WF, Cone RD, Horvath TL 2003 The distribution and mechanism of action of ghrelin in the CNS demonstrates a novel hypothalamic circuit regulating energy homeostasis. Neuron 37:649–661[CrossRef][Medline]
  8. Guillaume V, Magnan E, Cataldi M, Dutour A, Sauze N, Renard RH, Contedevolx B, Deghenghi R, Lenaerts V, Oliver C 1994 Growth-hormone (GH)-releasing hormone-secretion is stimulated by a new GH-releasing hexapeptide in sheep. Endocrinology 135:1073–1076[Abstract]
  9. Jansson J, Downs T, Beamer W, Frohman L 1986 Receptor-associated resistance to growth hormone-releasing factor in dwarf "little" mice. Science 232:511–512[Abstract/Free Full Text]
  10. Clark RG, Carlsson LMS, Trojnar J, Robinson ICAF 1989 The effects of a growth hormone-releasing peptide and releasing factor in conscious and anesthetized rats. J Neuroendocrinol 1:249–255[CrossRef][Medline]
  11. Maheshwari HG, Rahim A, Shalet SM, Baumann G 1999 Selective lack of growth hormone (GH) response to the GH-releasing peptide hexarelin in patients with GH-releasing hormone receptor deficiency. J Clin Endocrinol Metab 84:956–959[Abstract/Free Full Text]
  12. Dickson SL, Luckman SM 1997 Induction of c-fos messenger ribonucleic acid in neuropeptide Y and growth hormone (GH)-releasing factor neurons in the rat arcuate nucleus following systemic injection of the GH secretagogue, GH-releasing peptide-6. Endocrinology 138:771–777[Abstract/Free Full Text]
  13. Willesen MG, Kristensen P, Romer J 1999 Co-localization of growth hormone secretagogue receptor and NPY mRNA in the arcuate nucleus of the rat. Neuroendocrinology 70:306–316[CrossRef][Medline]
  14. Tannenbaum GS, Lapointe M, Beaudet A, Howard AD 1998 Expression of growth hormone secretagogue-receptors by growth hormone-releasing hormone neurons in the mediobasal hypothalamus. Endocrinology 139:4420–4423[Abstract/Free Full Text]
  15. Wren AM, Small CJ, Fribbens CV, Neary NM, Ward HL, Seal LJ, Ghatei MA, Bloom SR 2002 The hypothalamic mechanisms of the hypophysiotropic action of ghrelin. Neuroendocrinology 76:316–324[CrossRef][Medline]
  16. Wang L, Saint-Pierre DH, Tache Y 2002 Peripheral ghrelin selectively increases Fos expression in neuropeptide Y-synthesizing neurons in mouse hypothalamic arcuate nucleus. Neurosci Lett 325:47–51[CrossRef][Medline]
  17. Lawrence CB, Snape AC, Baudoin FM, Luckman SM 2002 Acute central ghrelin and GH secretagogues induce feeding and activate brain appetite centers. Endocrinology 143:155–162[Abstract/Free Full Text]
  18. Tschop M, Statnick MA, Suter TM, Heiman ML 2002 GH-releasing peptide-2 increases fat mass in mice lacking NPY: indication for a crucial mediating role of hypothalamic agouti-related protein. Endocrinology 143:558–568[Abstract/Free Full Text]
  19. Lall S, Tung LY, Ohlsson C, Jansson JO, Dickson SL 2001 Growth hormone (GH)-independent stimulation of adiposity by GH secretagogues. Biochem Biophys Res Commun 280:132–138[CrossRef][Medline]
  20. Yuxiang S, Wang P, Zheng H, Smith RG, Generation and characterization of growth hormone secretagogue receptor knockout mice. Program of the 85th Annual Meeting of The Endocrine Society, Philadelphia, PA, 2003, p 184 (Abstract P1–216)
  21. Asnicar AM, Yuxiang S, Smith RG, Ghrelin deficiency does not protect against diet induced obesity in mice. Program of the 85th Annual Meeting of The Endocrine Society, Philadelphia, PA, 2003, p 185 (Abstract P1–215)
  22. Flavell DM, Wells T, Wells SE, Carmignac DF, Thomas GB, Robinson ICAF 1996 Dominant dwarfism in transgenic rats by targeting human growth hormone (GH) expression to hypothalamic GH-releasing factor. EMBO J 15:3871–3879[Medline]
  23. Balthasar N, Mery PF, Magoulas CB, Mathers KE, Martin A, Mollard P, Robinson IC 2003 Growth hormone-releasing hormone (GHRH) neurons in GHRH-enhanced green fluorescent protein transgenic mice: a ventral hypothalamic network. Endocrinology 144:2728–2740[Abstract/Free Full Text]
  24. Adams EF, Lei T, Buchfelder M, Bowers CY, Fahlbusch R 1996 Protein kinase C-dependent growth hormone releasing peptides stimulate cyclic adenosine 3',5'-monophosphate production by human pituitary somatotropinomas expressing gsp oncogenes: Evidence for cross-talk between transduction pathways. Mol Endocrinol 10:432–438[Abstract/Free Full Text]
  25. Bennett PA, Thomas GB, Howard AD, Feighner SD, VanderPloeg LHT, Smith RG, Robinson ICAF 1997 Hypothalamic growth hormone secretagogue-receptor (GHS-R) expression is regulated by growth hormone in the rat. Endocrinology 138:4552–4557[Abstract/Free Full Text]
  26. Shu S, Ju G, Fan L 1988 The glucose oxidase-DAB-nickel method in peroxidase histochemistry of the nervous system. Neurosci Lett 85:169–171[CrossRef][Medline]
  27. Lister RG 1987 The use of a plus-maze to measure anxiety in the mouse. Psychopharmacology 92:180–185[Medline]
  28. King S 1998 Escape-related behaviours in an unstable elevated and exposed environment. I. A new behavioural model of extreme anxiety. Behav Brain Res 98:113–126[CrossRef]
  29. McKee K, Palyha O, Tan C, Feighner S, Hreniuk D, VanDerPloeg L, Howard A 1997 Molecular cloning and characterization of a rat pituitary and hypothalamic growth hormone secretagogue receptor (GHS-R). FASEB J 11:2272
  30. Dickson SL, Leng G, Dyball REJ, Smith RG 1995 Central actions of peptide and nonpeptide growth-hormone secretagogues in the rat. Neuroendocrinology 61:36–43[Medline]
  31. Koch WJ, Lefkowitz RJ, Rockman HA 2000 Functional consequences of altering myocardial adrenergic receptor signaling. Annu Rev Physiol 62:237–260[CrossRef][Medline]
  32. Holst B, Cygankiewicz A, Halkjar Jensen T, Ankersen M, Schwartz T 2003 High constitutive signaling of the ghrelin receptor: identification of a potent inverse agonist. Mol Endocrinol 17:2201–2210[Abstract/Free Full Text]
  33. Chomczynski P, Downs TR, Frohman LA 1988 Feedback-regulation of growth-hormone (GH)-releasing hormone expression by GH in rat hypothalamus. Mol Endocrinol 2:236–241[Abstract/Free Full Text]
  34. Kamegai J, Unterman TG, Frohman LA, Kineman RD 1998 Hypothalamic/pituitary-axis of the spontaneous dwarf rat: autofeedback regulation of growth hormone (GH) includes suppression of GH releasing-hormone receptor messenger ribonucleic acid. Endocrinology 139:3554–3560[Abstract/Free Full Text]
  35. Mayo KE, Godfrey PA, Suhr ST, Kulik DJ, Rahal JO 1995 Growth hormone-releasing hormone: synthesis and signaling. Recent Prog Horm Res 50:35–73
  36. Lu S, Guan J, Wang Q, Uehara K, Yamada S, Goto N, Date Y, Nakazato M, Kojima M, Kangawa K, Shioda S 2002 Immunocytochemical observation of ghrelin-containing neurons in the rat arcuate nucleus. Neurosci Lett 321:157–160[CrossRef][Medline]
  37. Dickson SL, Leng G, Robinson ICAF 1993 Systemic administration of growth hormone-releasing peptide activates hypothalamic arcuate neurons. Neuroscience 53:303–306[CrossRef][Medline]
  38. Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kangawa K, Matsukura S 2001 A role for ghrelin in the central regulation of feeding. Nature 409:194–198[CrossRef][Medline]
  39. Chan YY, Steiner RA, Clifton DK 1996 Regulation of hypothalamic neuropeptide-Y neurons by growth hormone in the rat. Endocrinology 137:1319–1325[Abstract]
  40. Minami S, Kamegai J, Sugihara H, Suzuki N, Wakabayashi I 1998 Growth hormone inhibits its own secretion by acting on the hypothalamus through its receptors on neuropeptide Y neurons in the arcuate nucleus and somatostatin neurons in the periventricular nucleus. Endocr J 45:19–26
  41. Bailey AR, Giles M, Brown CH, Bull PM, Macdonald LP, Smith LC, Smith RG, Leng G, Dickson SL 1999 Chronic central infusion of growth hormone secretagogues: effects on fos expression and peptide gene expression in the rat arcuate nucleus. Neuroendocrinology 70:83–92[CrossRef][Medline]
  42. Nam SY, Lobie PE 2000 The mechanism of effect of growth hormone on preadipocyte and adipocyte function. Obes Rev 1:73–86[CrossRef][Medline]
  43. Renier G, Gaudreau P, Hajjad H, Deslauriers N, Houde-Nadeau M, Brazeau P 1990 Decreased pituitary growth hormone response to growth hormone-releasing factor in cafeteria-fed rats: dietary and obesity effects. Neuroendocrinology 52:284–290[CrossRef][Medline]
  44. Tannenbaum GS, Lapointe M, Gurd W, Finkelstein JA 1990 Mechanisms of impaired growth hormone secretion in genetically obese Zucker rats: roles of growth hormone-releasing factor and somatostatin. Endocrinology 127:3087–3095[Abstract/Free Full Text]
  45. Salomon F, Cuneo RC, Hesp R, Sonksen PH 1989 The effects of treatment with recombinant human growth hormone on body composition and metabolism in adults with growth hormone deficiency. N Engl J Med 321:1797–1803[Abstract]
  46. Bengtsson BA, Eden S, Lonn L, Kvist H, Stokland A, Lindstedt G, Bosaeus I, Tolli J, Sjostrom L, Isaksson OG 1993 Treatment of adults with growth hormone (GH) deficiency with recombinant human GH. J Clin Endocrinol Metab 76:309–317[Abstract]
  47. Ho KK, O’Sullivan AJ, Hoffman DM 1996 Metabolic actions of growth hormone in man. Endocr J 43:57–63
  48. Tannenbaum BM, Brindley DN, Tannenbaum GS, Dallman MF, McArthur MD, Meaney MJ 1997 High-fat feeding alters both basal and stress-induced hypothalamic-pituitary-adrenal activity in the rat. Am J Physiol 273:E1168–E1177
  49. Clark RG, Thomas GB, Mortensen DL, Won WB, Ma YH, Tomlinson EE, Fairhall KM, Robinson IC 1997 Growth hormone secretagogues stimulate the hypothalamic-pituitary-adrenal axis and are diabetogenic in the Zucker diabetic fatty rat. Endocrinology 138:4316–4323[Abstract/Free Full Text]
  50. Thomas GB, Fairhall KM, Robinson IC 1997 Activation of the hypothalamo-pituitary-adrenal axis by the growth hormone (GH) secretagogue, GH-releasing peptide-6, in rats. Endocrinology 138:1585–15891[Abstract/Free Full Text]
  51. Arvat ER, J. Maccagno B, Giordano R, Broglio F, Deghenghi R, Boscaro M, Ghigo E 1999 Corticotropin-releasing effect of hexarelin, a peptidyl GH secretagogue, in normal subjects pretreated with metyrapone or RU-486, a glucocorticoid receptor antagonist, and in patients with Addison’s disease. Neuroendocrinology 70:200–206[CrossRef][Medline]
  52. Carlini VP, Monzon ME, Varas MM, Cragnolini AB, Schioth HB, Scimonelli TN, de Barioglio SR 2002 Ghrelin increases anxiety-like behavior and memory retention in rats. Biochem Biophys Res Commun 299:739–743[CrossRef][Medline]
  53. Kerkhofs M, Van Cauter E, Van Onderbergen A, Caufriez A, Thorner MO, Copinschi G 1993 Sleep-promoting effects of growth hormone-releasing hormone in normal men. Am J Physiol 264:94–98
  54. Frieboes RM, Murck H, Maier P, Schier T, Holsboer F, Steiger A 1995 Growth hormone-releasing peptide-6 stimulates sleep, ACTH and cortisol release in normal man. Neuroendocrinology 61:584–589[Medline]
  55. Bowers CY, Momany FA, Reynolds GA, Hong A 1984 On the in vitro and in vivo activity of a new synthetic peptide that acts on the pituitary to specifically release growth hormone. Endocrinology 114:1537–1545[Abstract/Free Full Text]
  56. McDowell RS, Elias KA, Stanley MS, Burdick DJ, Burnier JP, Chan KS, Fairbrother WJ, Hammonds RG, Ingle GS, Jacobsen NE, Mortensen DL, Rawson TE, Won WB, Clark RG, Somers TC 1995 Growth hormone secretagogues: characterization, efficacy, and minimal bioactive conformation. Proc Natl Acad Sci USA 92:11165–11169[Abstract/Free Full Text]
  57. Svensson J, Lall S, Dickson SL, Bengtsson BA, Romer J, Ahnfelt-Ronne I, Ohlsson C, Jansson JO 2000 The GH secretagogues ipamorelin and GH-releasing peptide-6 increase bone mineral content in adult female rats. J Endocrinol 165:569–577[Abstract]
  58. McMinn J, Baskin D, Schwartz M 2000 Neuroendocrine mechanisms regulating food intake and body weight. Obes Rev 1:37–46[CrossRef][Medline]
  59. Bowers CY, Reynolds GA, Durham D, Barrera CM, Pezzoli SS, Thorner MO 1990 Growth hormone (GH)-releasing peptide stimulates GH release in normal men and acts synergistically with GH-releasing hormone. J Clin Endocrinol Metab 70:975–982[Abstract/Free Full Text]
  60. Hataya Y, Akamizu T, Takaya K, Kanamoto N, Ariyasu H, Saijo M, Moriyama K, Shimatsu A, Kojima M, Kangawa K, Nakao K 2001 A low dose of ghrelin stimulates growth hormone (GH) release synergistically with GH-releasing hormone in humans. J Clin Endocrinol Metab 86:4552[Abstract/Free Full Text]
  61. Arvat E, Maccario M, Di Vito L, Broglio F, Benso A, Gottero C, Papotti M, Muccioli G, Dieguez C, Casanueva FF, Deghenghi R, Camanni F, Ghigo E 2001 Endocrine activities of ghrelin, a natural growth hormone secretagogue (GHS), in humans: comparison and interactions with hexarelin, a nonnatural peptidyl GHS, and GH-releasing hormone. J Clin Endocrinol Metab 86:1169–1174[Abstract/Free Full Text]
  62. Tannenbaum GS, Epelbaum J, Bowers CY 2003 Interrelationship between the novel peptide ghrelin and somatostatin/growth hormone-releasing hormone in regulation of pulsatile growth hormone secretion. Endocrinology 144:967–974[Abstract/Free Full Text]
  63. Tolle V BM, Zizzari P, Poindessous-Jazat F, Tomasetto C, Epelbaum J, Bluet-Pajot MT 2002 Ultradian rhythmicity of ghrelin secretion in relation with GH, feeding behavior, and sleep-wake patterns in rats. Endocrinology 143:1353–1361[Abstract/Free Full Text]
  64. Okimura Y UK, Hosoda H, Murata M, Iguchi G, Iida K, Kaji H, Kojima M, Kangawa K, Chihara K 2003 The role of circulating ghrelin in growth hormone (GH) secretion in freely moving male rats. Life Sci 72:2517–2524[CrossRef][Medline]
  65. Maheshwari H, Silverman B, Dupuis J, Baumann G 1998 Phenotype and genetic analysis of a syndrome caused by an inactivating mutation in the growth hormone-releasing hormone receptor: dwarfism of Sindh. J Clin Endocrinol Metab 83:4065–4074[Abstract/Free Full Text]
  66. Mayo KE, Miller TL, DeAlmeida V, Zheng J, Godfrey PA 1996 The growth-hormone-releasing hormone receptor: signal transduction, gene expression, and physiological function in growth regulation. Ann NY Acad Sci 26:184–203



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. A. Reed, S. C. Benoit, P. T. Pfluger, M. H. Tschop, D. A. D'Alessio, and R. J. Seeley
Mice with chronically increased circulating ghrelin develop age-related glucose intolerance
Am J Physiol Endocrinol Metab, April 1, 2008; 294(4): E752 - E760.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. Liu, J.-P. Fortin, M. Beinborn, and A. S. Kopin
Four Missense Mutations in the Ghrelin Receptor Result in Distinct Pharmacological Abnormalities
J. Pharmacol. Exp. Ther., September 1, 2007; 322(3): 1036 - 1043.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. S. Farhy, C. Y. Bowers, and J. D. Veldhuis
Model-projected mechanistic bases for sex differences in growth hormone regulation in humans
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2007; 292(4): R1577 - R1593.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. C Carreira, J. P Camina, E. Diaz-Rodriguez, R. Alvear-Perez, C. Llorens-Cortes, and F. F Casanueva
Adenosine does not bind to the growth hormone secretagogue receptor type-1a (GHS-R1a).
J. Endocrinol., October 1, 2006; 191(1): 147 - 157.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Mano-Otagiri, T. Nemoto, A. Sekino, N. Yamauchi, Y. Shuto, H. Sugihara, S. Oikawa, and T. Shibasaki
Growth Hormone-Releasing Hormone (GHRH) Neurons in the Arcuate Nucleus (Arc) of the Hypothalamus Are Decreased in Transgenic Rats Whose Expression of Ghrelin Receptor Is Attenuated: Evidence that Ghrelin Receptor Is Involved in the Up-Regulation of GHRH Expression in the Arc
Endocrinology, September 1, 2006; 147(9): 4093 - 4103.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. D. Veldhuis, J. N. Roemmich, E. J. Richmond, and C. Y. Bowers
Somatotropic and Gonadotropic Axes Linkages in Infancy, Childhood, and the Puberty-Adult Transition
Endocr. Rev., April 1, 2006; 27(2): 101 - 140.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lall, S.
Right arrow Articles by Robinson, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lall, S.
Right arrow Articles by Robinson, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals