| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Biological Regulation (Y.K., D.G., N.D.), The Weizmann Institute of Science, and In Vitro Fertilization Unit (I.G., A.B.), Department of Obstetric and Gynecology, Kaplan Medical Center, Rehovot 76100, Israel
Address all correspondence and requests for reprints to: Nava Dekel, Ph.D., Department of Biological Regulation, Weizmann Institute of Science, Rehovot 76100, Israel. E-mail: nava.dekel{at}weizmann.ac.il.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Each gap junction channel consists of two symmetrical hemispheres, termed connexons, that are contributed by two neighboring cells. The connexon is composed of a hexagonal arrangement of six protein subunits referred to as connexins (Cxs). Cxs are members of a growing multigene family that are defined by their molecular weight and share high homology. Numerous types of Cxs (such as Cx26, Cx30.3, Cx32, Cx37, Cx40, Cx43, and Cx45) were identified in ovarian tissues of different mammalian species (12). Cx43, the most abundant member of the Cx family expressed by the ovarian follicle, has been observed on the surface of the granulosa/cumulus cells as well as on the oocyte (13, 14).
Pituitary FSH and LH are the major regulators of ovarian function. FSH has been shown as the main promoter of follicular maturation enhancing granulosa cell proliferation. The control of FSH on folliculogenesis is completed by LH, which, in addition, plays a role in the more advanced stages of follicular development, stimulating oocyte maturation, ovulation, and luteinization (reviewed in Ref. 15).
Gonadotropins also control the expression of Cx43. In general, studies on rat and mouse animal models demonstrated that FSH up-regulates, whereas LH down-regulates, the levels of this protein. Gonadotropins regulation of Cx43 was initially suggested by the changes in Cx43 levels throughout the estrous cycle that correlate with the profile of serum concentration of FSH and LH. These studies demonstrated an increase in the amount of Cx43 in the large antral follicles in a stage at which serum concentrations of FSH are relatively elevated (16, 17). On the other hand, the preovulatory surge of serum concentrations of LH is followed by a drop at the level of Cx43 mRNA and a reduction in the amount of its corresponding protein (16, 17, 18, 19). More direct evidence for the regulatory effects of FSH and LH on the abundance of the ovarian gap junction protein was provided by the exogenous administration of these gonadotropins. In this study, the FSH-like hormone, pregnant mares serum gonadotropin, up-regulated the expression of the mRNA encoding Cx43 and the synthesis of the Cx43 protein in the ovarian follicles, whereas an additional injection of human chorionic gonadotropin resulted in a reduction in the mRNA encoding Cx43 and the disappearance of the protein (16). Up-regulation of Cx43 mRNA in response to FSH has also been reported in a rat granulosa cell line (20). The direct effect of LH on the expression of Cx43 analyzed in vitro in isolated intact ovarian follicles demonstrated an inhibitory effect on Cx43 expression. The protein in this system was completely abolished; however, the Cx43 mRNA level was decreased but not eliminated (21).
The findings that a certain amount of Cx43 mRNA could still be detected, whereas the protein is totally absent, suggest that, in addition to transcriptional modification, the effect of LH on Cx43 expression may be also elicited at another level of regulation. The aim of the present study was to explore the mechanism by which LH reduces the levels of Cx43 protein and to identify the signal transduction pathway involved in this process. We assumed that LH either affects the rate of Cx43 degradation or its translation. Our experiments revealed that short exposure to LH results in a reduced rate of translation of the Cx43 protein and that this effect is mediated by protein kinase A (PKA) and the ERK1/2 members of the MAPK family.
| Materials and Methods |
|---|
|
|
|---|
Animals and tissue collection
The effect of LH was studied using the in vitro system model of isolated intact ovarian follicles (21). Specifically, 23- to 25-d-old wistar female rats were injected sc with 10 IU pregnant mares serum gonadotropin (Chrono-gest Intervest, Oss, The Netherlands) and killed 48 h later. The ovaries were removed, and the large antral follicles were separated and grown in suspension in L-15 tissue culture medium containing 5% FBS in the presence or absence of LH (National Institutes of Health, NIDDK-oLH-26). The experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council, National Academy of Science, Bethesda, MD).
The possible mediators of LH-induced Cx43 down-regulation were examined by incubating the follicles with LH in the presence or absence of the inhibitors of the PKA and the MAPK signaling pathways, H-89 and U0126, respectively. Unless mentioned otherwise, the inhibitors were added to the medium at 1 h before LH.
Pulse chase experiments
The follicles were washed with methionine-free medium (Biological Industries) and labeled with 100 µCi/ml [35S]methionine (Amersham, Buckinghamshire, UK; 1000 Ci/mmol) for 2 h in 1 ml methionine-free medium containing 5% dialyzed serum (Biological Industries). The radioactive medium was then washed four times with "cold" medium supplemented with 2 mM methionine (Sigma), and the follicles were chased in medium supplemented with 2 mM methionine in the presence or absence of LH.
RT-PCR
RT-PCR was performed on total RNA prepared by the Tri Reagent (Sigma) method. This (7.5 µg) RNA was employed for cDNA synthesis using Moloney murine leukemia virus reverse transcriptase (Promega, 200 U) and oligo deoxythymidine (0.5 µg, Promega). PCR was performed on 1 µl of the 20-µl cDNA sample. Below are indicated, respectively, the number of cycles and the sequences of 5' and 3' primers used for each of the tested genes: for the gene encoding Cx43, 26 cycles, using 5'CAGATCAGGTGGACTGTTTCCTC3' and 5'GGAGACATAGGCGC-GAGGGGAGCGG3'; for the gene encoding S-16, 19 cycles using 5'CGTTCACCTTGATGAGCCCAT3' and 5'TCCAAGGGTCCGCTGCAGTC3'. The annealing temperature for both genes was 60 C.
Analysis of Cx43 translation
Protein synthesis was analyzed in follicles incubated in 1 ml medium in the presence or absence of LH. After 4 h of incubation, 500 µCi of [35S]methionine was added to the medium for an additional 3 h. The rate of Cx43 protein synthesis was determined in follicles exposed for 1 h to 400 µCi of [35S]methionine that was added to the medium at the indicated time points of their incubation. The follicles were then washed on ice four times with PBS and subjected to immunoprecipitation with anti-Cx43 antibodies.
Immunoprecipitation
Twenty-five follicles were homogenized for 30 sec in 0.2 ml radioimmunoprecipitation (RIPA) buffer containing 137 mM NaCl, 20 mM Tris (pH 7.4), 10% glycerol, 0.1% sodium dodecyl sulfate. 0.5% deoxycholate, 1% Triton X-100, 2 mM EDTA, okadaic acid (0.1 µM), pepstatin (1 µg/ml), leupeptin (1 µg/ml), and 1 mM PMSF. The lysates were then centrifuged at maximum speed for 10 min, followed by supernatants transfer to new tubes and determination of protein concentration (21A ). Equal amounts of proteins (400 µg) were incubated with 1 µg monoclonal anti-Cx43 antibody for 2 h at 4 C followed by the addition of the antimouse IgG agarose beads (A-6531 Sigma) for an additional hour (the beads were washed 4 times with RIPA buffer before usage). The beads were then washed once with RIPA buffer, twice with 0.1 M Tris-HCl (pH8)/0.5 M LiCl buffer, and again with RIPA buffer. The immune proteins were recovered by boiling in sample buffer for 5 min. The beads were centrifuged for 30 sec, and the immune complexes were resolved by SDS-PAGE.
Western blot analysis
Follicles were homogenized for 30 sec in homogenization buffer containing 20 mM Tris (pH 7.5), 250 mM sucrose, supplemented with 10 mM DTT, 2 mM EDTA, 5 mM EGTA, okadaic acid (0.1 µM), pepstatin (1 µg/ml), leupeptin (1 µg/ml), and 1 mM PMSF. Large tissue particles were removed by slow centrifugation for 5 min. The supernatant was recovered, and protein concentration was determined. Twenty micrograms of protein per lane were loaded on 12.5% polyacrylamide gel. After electrophoresis, the proteins were transferred to a nitrocellulose membrane (Hybond-C super, Amersham). After blocking, the membranes were incubated with the relevant antibodies. The following antibodies were used: monoclonal anti-Cx43 antibody (1:250 dilution), rabbit anti-MAPK (1:5,000 dilution), and mouse antiphosphorylated MAPK (p-MAPK, 1:10,000 dilution). Goat antimouse horseradish peroxidase-conjugated and goat antirabbit AP-conjugated second antibodies were used (1:5,000 dilution). The immunoreactive bands were detected using enhanced chemiluminescence reagents (Amersham) and AP reagents (Promega), respectively. Quantitation of the autoradiograms was performed by densitometric analysis using the Pdi 420oe densitometer supported by Quantity One software (Pdi, Huntington Station, NY).
MAPK phosphorylation
The activation state of MAPK (ERK1/2) was determined by Western blot analysis using anti-double phosphorylated MAPK monoclonal antibody that detects the phosphorylated, active MAPK and a rabbit polyclonal serum that detects the total amount of MAPK. At the end of the specified incubation time, the follicles were homogenized in 0.2 ml of homogenization buffer, Buffer H containing 50 mM ß-glycerophosphate, 1.5 mM EGTA, 1 mM EDTA, 1 mM Na-orthovanadate, 1 mM benzamidine, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 2 µg/ml pepstatin, and 1 mM DTT. The lysates were then centrifuged at maximum speed for 10 min followed by supernatants transfer to new tubes and determination of protein concentration. Equal amounts of proteins were subjected to Western blot analysis. Detection of the immunoreactive band was done as previously described.
| Results |
|---|
|
|
|---|
|
|
PKA is involved in LH-induced inhibition of translation
The classical second messenger for LH action in the ovarian follicle is cAMP, the downstream effector of which is PKA. The possibility that PKA is involved in mediating the LH-induced inhibition of Cx43 translation was addressed using H-89. This isoquinolinesulfonamide was shown to have a potent inhibitory action against PKA, influencing rather weakly the effect of other kinases (22, 23). We found that LH-induced down-regulation of the Cx43 protein was abolished by this inhibitor (Fig. 3A
), indicating that this effect of LH is indeed mediated by PKA.
|
MAPK is involved in LH-induced inhibition of translation
It has been demonstrated that ERK1/2 are activated by LH in rat granulosa and Leydig cells (25, 26, 27). A more recent study showed that activation of these kinases is essential for gonadotropin-induced oocyte meiotic resumption and cumulus expansion (28). Taken together, these reports suggest that gonadotropin-mediated signaling in the ovary includes members of the MAPK family. To examine the possible involvement of the MAPK cascade in the response to LH in our system, we used U0126, a specific inhibitor of MAPK kinase that is an upstream regulator of ERK1/2. We found that LH-induced down-regulation of Cx43 was abolished by 10 µM of this inhibitor whether it was added before (Fig. 4A
) or after the administration of LH (Fig. 4B
). Lower doses of U0126 were less effective (data not shown). Addition of U0124, a nonreactive derivative of U0126, did not affect the response to LH (Fig. 4A
). Similarly, U0126, but not U0124, prevented the decrease in Cx43 levels promoted by forskolin (Fig. 4C
).
|
Activation of ERK1/2 by LH in the follicles has been demonstrated in our laboratory previously (Sela-Abramovich, S., et al., unpublished data). We further examined herein the pattern of ERK1/2 activation during LH administration. This experiment revealed that activation of ERK1/2 peaks at 30 min after the addition of LH, and that the high level of activity persists for a few hours (Fig. 4F
). A reduction in ERKs activity is initially seen at 4 h after the administration of LH.
LH-induced activation of MAPK is not mediated by PKA
We further studied the role of cAMP in mediating ERK1/2 activation. In this experiment, the effect of the PKA inhibitor, H-89, on ERK1/2 activation was examined. We found that, at a concentration that completely blocked LH-induced down-regulation of Cx43 protein, H-89 had no effect either on the basal activity of ERK1/2 or on the LH-induced ERK1/2 activation (Fig. 5
). On the other hand, as expected, the inhibitor of MAPK kinase activity, U0126, did reduce the basal ERK1/2 activity, as well as the LH-induced ERK1/2 activation (Fig. 5
).
|
| Discussion |
|---|
|
|
|---|
Expression of a protein can be modulated at different levels of regulation among which transcription, mRNA splicing, mRNA stability, translation, and posttranslation events are included. Any combination of these options is also possible. Most of the studies have been focused on transcriptional regulation. However, it is absolutely obvious that posttranscriptional mechanisms play a central role in regulating proteins expression.
Cx43 is an example of a protein whose regulation was demonstrated thus far only at the level of transcription. The idea of translational regulation was previously suggested by Khan-Dawood et al. (29). These investigators showed that the abundant concentration of the ovarian Cx43 in the midluteal phase becomes undetectable in atretic corpora lutea. Their failure to demonstrate variations in Cx43 mRNA throughout the luteal phase suggests that, in this tissue, it is the modulation of translation, rather than transcription, that determines the availability of this protein. Yet, this idea of translational regulation was neither further established nor attributed to the effect of LH on the expression of Cx43.
Translation is a complex process involving the coordinated function of many proteins, the ribosome and tRNAs. Inhibition of translation in most cases results from interaction of proteins with a specific mRNA that subsequently prevents the access of the ribosome to the translation start codon. Such interactions can occur in the 5' or 3' untranslated regions of an mRNA or within the decoded portion of the molecules (reviewed in Ref. 30).
Resolution of the mechanism that mediates the LH-induced inhibition of Cx43 translation must await further studies. However, the fact that inhibition of Cx43 translation cannot be detected before 34 h after LH administration may indicate that the signal transduction pathways activated by LH involve processes other than posttranslational modifications. One such possibility is that LH up-regulates the expression of a gene encoding a protein that, in turn, binds Cx43 mRNA, preventing its translation.
The adenylyl cyclase/cAMP/PKA pathway has been widely accepted as the primary signaling cascade through which LH exerts its action. Upon interaction with its corresponding G protein-coupled receptor, LH promotes cAMP elevation that is followed by PKA activation (31). Other pathways in addition to PKA have been implicated more recently in regulating the steroidogenic action of LH (reviewed in Ref. 32). It is presently established that an important element in gonadotropin-mediated signaling in the ovary includes members of the MAPK family such as ERK1/2. The molecular mechanisms by which G protein-coupled receptors regulate ERK1/2 are poorly understood, but several intracellular signaling elements have been shown to modulate ERK1/2 activation in response to G protein-coupled receptors, among which PKA, protein kinase C, and phosphoinositide 3-kinase are included (reviewed in Refs. 33 and 34).
The fact that inhibitors of PKA and MAPK signal transduction pathways interfered with the negative effect of LH on Cx43 translation implies that both these enzymes participate in mediating the action of this gonadotropin in our system. H-89 is considered as a selective and potent inhibitor of PKA (22). However, a more recent study (23) revealed that three (mitogen- and stress-activated kinase 1, ribosomal protein 56 kinase, and Rho kinase II) other protein kinases were inhibited with a potency similar to that of PKA. Nevertheless, because neither of these kinases has been shown to be activated by cAMP, we are quite confident that inhibition of forskolin (as well as LH)-induced Cx43 down-regulation in our study suggests that this response is mediated by PKA. The finding that inhibition of PKA does not block the LH-induced activation of MAPK seems to suggest that activation of this kinase is PKA independent, and that these two enzymes probably act in parallel to transduce the response to LH. Moreover, inhibition of MAPK signaling that does prevent the effect of forskolin in this system further implies that MAPK activation occurs downstream to elevation of cAMP. Yet, the specific hierarchy of their activation and their downstream substrate proteins should be further established.
Both PKA and MAPK signal transduction pathways have been shown to mediate inhibition of translation of other proteins. For example, cAMP-mediated growth inhibition of lymphoid cells in G1 is due to a rapid down-regulation of cyclin D3 at the level of translation (35). This antiproliferative effect of cAMP in lymphocytes has been shown to be mediated through PKA type I. ERK phosphorylation has also been shown to inhibit the translation of different proteins. For example, it was shown that ERK phosphorylation drives cytoplasmic accumulation of hnRNP (heterogeneous nuclear ribonucleoprotein)-K that mediates inhibition of translation of mRNAs that have a cytidine/uridine-rich differentiation-control element (DICE) in their 3' untranslated region (36). The best-characterized protein regulated by these hnRNPs is 15-lipoxygenase (LOX) (37, 38). Cytidine-rich 15-LOX DICE is a multifunctional cis-element found in the 3'-UTR of numerous eukaryotic mRNAs (39). However, this element is absent in the 3'-UTR of Cx43 mRNA and therefore cannot account for ERK-mediated inhibition of translation of this protein.
Our results show that activation of ERK1/2 in the follicle peaks at 30 min after the addition of LH and persists for several hours. We also demonstrate that inhibition of the MAPK signaling pathway that is introduced after the addition of LH still results in abolishment of the response to this gonadotropin. Taken together, these findings indicate that the prolonged activation of MAPK is instrumental for LH-induced inhibition of translation of Cx43.
To summarize, we demonstrate herein, for the first time, that LH inhibits Cx43 translation and that this effect is mediated by PKA and MAPK. LH is one of the major regulators of ovarian development and function. In response to the preovulatory surge of LH, cell-to-cell communication in the follicle is interrupted, the oocyte resumes meiosis, the mature oocyte is released, and the follicle undergoes luteinization (1, 40). To exert these effects, LH up-regulates the expression of a large repertoire of genes that take part in these processes. Among the induced genes, the early growth regulatory factor-1 (41), CAAT enhancer binding protein ß (42), the progesterone receptor (43, 44), and the steroid acute regulatory protein (45, 46) are included. On the other hand, there are examples of genes, such as P450 17
-hydroxylase and P450 aromatase (47, 48), that are down-regulated after the LH-surge. The reduction in the levels of these last two enzymes can be accounted for by a decrease in their mRNA (49, 50). However, the effect of LH on Cx43 protein down-regulation that is not subsequent to a reduction in the corresponding mRNA is the first example of a LH-induced negative effect on translation. Nevertheless, to ensure the efficiency of the reduction of the gap junction protein, two mechanisms are operated sequentially: the initial suppression of Cx43 translation, demonstrated herein, and the later, previously reported, inhibition of transcription (16, 21). The combined operation of these two mechanisms emphasizes the crucial role of elimination of Cx43 in the ovulatory follicle. We therefore postulate here that this response to LH may also have a role in the control of ovulation. The gap junctions form a network of strong mechanical bonds interconnecting granulosa cells that encapsulate the oocyte, and the loss of these junctions may facilitate the dissociation of the oocyte and its release from the ovarian follicle.
| Footnotes |
|---|
N.D. is the incumbent of the Phillip M. Klutznick Professorial Chair of Developmental Biology.
Abbreviations: AP, Alkaline phosphatase; Cx, connexin; DICE, differentiation-control element; DTT, dithiothreitol; H-89, N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide hydrochloride; hnRNP, heterogeneous nuclear ribonucleoprotein; LOX, lipoxygenase; PKA, protein kinase A; PMSF, phenylmethylsulfonylfluoride.
Received August 13, 2003.
Accepted for publication December 4, 2003.
| References |
|---|
|
|
|---|
, adrenodoxin, and reduced nicotinamide adenine dinucleotide phosphate-cytochrome P-450 reductase in bovine follicles and corpora lutea. Changes in specific contents during the ovarian cycle. Endocrinology 118:13661374
, cytochrome P450scc, and 3-hydroxy-3-methylglutaryl CoA reductase in developing rat ovarian follicles and corpora lutea: correlation with theca cell steroidogenesis. Biol Reprod 37:211223[Abstract]
-hydroxylase and P450 aromatase in preovulatory bovine follicles decrease after the luteinizing hormone surge. Endocrinology 132:22392245This article has been cited by other articles:
![]() |
Y. Reizel, J. Elbaz, and N. Dekel Sustained Activity of the EGF Receptor Is an Absolute Requisite for LH-Induced Oocyte Maturation and Cumulus Expansion Mol. Endocrinol., February 1, 2010; 24(2): 402 - 411. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sasseville, M.-C. Gagnon, C. Guillemette, R. Sullivan, R. B. Gilchrist, and F. J. Richard Regulation of Gap Junctions in Porcine Cumulus-Oocyte Complexes: Contributions of Granulosa Cell Contact, Gonadotropins, and Lipid Rafts Mol. Endocrinol., May 1, 2009; 23(5): 700 - 710. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Z. Carletti and L. K. Christenson MicroRNA in the ovary and female reproductive tract J Anim Sci, April 1, 2009; 87(14_suppl): E29 - E38. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Norris, M. Freudzon, L. M. Mehlmann, A. E. Cowan, A. M. Simon, D. L. Paul, P. D. Lampe, and L. A. Jaffe Luteinizing hormone causes MAP kinase-dependent phosphorylation and closure of connexin 43 gap junctions in mouse ovarian follicles: one of two paths to meiotic resumption Development, October 1, 2008; 135(19): 3229 - 3238. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sela-Abramovich, D. Galiani, N. Nevo, and N. Dekel Inhibition of Rat Oocyte Maturation and Ovulation by Nitric Oxide: Mechanism of Action Biol Reprod, June 1, 2008; 78(6): 1111 - 1118. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Panigone, M. Hsieh, M. Fu, L. Persani, and M. Conti Luteinizing Hormone Signaling in Preovulatory Follicles Involves Early Activation of the Epidermal Growth Factor Receptor Pathway Mol. Endocrinol., April 1, 2008; 22(4): 924 - 936. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-G. Liang, Y.-Q. Su, H.-Y. Fan, H. Schatten, and Q.-Y. Sun Mechanisms Regulating Oocyte Meiotic Resumption: Roles of Mitogen-Activated Protein Kinase Mol. Endocrinol., September 1, 2007; 21(9): 2037 - 2055. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Russell and R. L. Robker Molecular mechanisms of ovulation: co-ordination through the cumulus complex Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-Q. Su, M. Nyegaard, M. T. Overgaard, J. Qiao, and L. C. Giudice Participation of Mitogen-Activated Protein Kinase in Luteinizing Hormone-Induced Differential Regulation of Steroidogenesis and Steroidogenic Gene Expression in Mural and Cumulus Granulosa Cells of Mouse Preovulatory Follicles Biol Reprod, December 1, 2006; 75(6): 859 - 867. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tsai-Turton and U. Luderer Gonadotropin regulation of glutamate cysteine ligase catalytic and modifier subunit expression in rat ovary is subunit and follicle stage specific Am J Physiol Endocrinol Metab, September 1, 2005; 289(3): E391 - E402. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Pfeifer, C. Anderson, R. Werner, and E. Oltra Redefining the structure of the mouse connexin43 gene: selective promoter usage and alternative splicing mechanisms yield transcripts with different translational efficiencies Nucleic Acids Res., August 24, 2004; 32(15): 4550 - 4562. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |