help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2003-0954
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/4/1685    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knöfler, M.
Right arrow Articles by Helmer, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knöfler, M.
Right arrow Articles by Helmer, H.
Endocrinology Vol. 145, No. 4 1685-1694
Copyright © 2004 by The Endocrine Society

Transcriptional Regulation of the Human Chorionic Gonadotropin ß Gene during Villous Trophoblast Differentiation

Martin Knöfler, Leila Saleh, Sandra Bauer, Barbara Galos, Hans Rotheneder, Peter Husslein and Hanns Helmer

Department of Obstetrics and Gynecology (M.K., L.S., S.B., P.H., H.H.), University of Vienna, A-1090 Vienna, Austria; and Institute of Medical Biochemistry (B.G., H.R.), University of Vienna, A-1030 Vienna, Austria

Address all correspondence and requests for reprints to: Martin Knöfler, Department of Obstetrics and Gynecology, University of Vienna, Waehringer Guertel 18–20, A-1090 Vienna, Austria. E-mail: martin.knoefler{at}akh-wien.ac.at.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of the trophoblast-specific subunit of human chorionic gonadotropin, CGß, is associated with fusion of cytotrophoblasts into a multinuclear syncytium. Here, we studied regulation of the CGß5 gene in trophoblasts undergoing in vitro syncytialization. Transfection of luciferase reporters harboring different lengths of the CGß5 upstream sequence revealed that the proximal promoter region (-345 to +114) is sufficient to govern differentiation-dependent induction. Mutational analyses suggested that two selective promoter factor (Sp) and three activating protein 2 (AP-2) recognition sequences are necessary for full activity of the promoter. During syncytialization these elements interacted with increasing amounts of the transcription factors Sp1, Sp3, and AP-2{alpha} in electrophoretic mobility shift assay, but only AP-2{alpha} binding rose upon elevation of cAMP levels with forskolin. Increasing expression of different isoforms of Sp1 and Sp3 could also be detected by Western blot analyses. Sp1/Sp3 localized to syncytial nuclei both in differentiated cultures and in term placental tissue, suggesting assembly of functional transcriptional complexes. Costaining of the transcription factors with E-cadherin on term placental sections revealed that 47 and 33% of cytotrophoblast nuclei were negative for Sp1 and Sp3, respectively. In contrast, immunohistochemistry of early tissue demonstrated expression of Sp1 in the majority of cyto- and syncytiotrophoblasts, whereas Sp3 was absent from the syncytium. Sp1 and Sp3 induced wild-type/mutant promoter constructs upon transfection in Sp-deficient SL-2 cells, indicating that the Sp elements function as activating sequences. The data suggest that increasing concentrations of Sp1, Sp3, and AP-2{alpha} enhance transcription of CGß in differentiating term trophoblasts, whereas a different combination of factors may control expression in early placentas.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
HUMAN CHORIONIC GONADOTROPIN (CG), a member of the family of glycoprotein hormones, is composed of a specific ß-subunit and an {alpha}-subunit common to FSH, LH, and TSH (1). CG is indispensable for successful progression of pregnancy. Its classical function is to maintain production of steroid hormones and other growth factors in the corpus luteum until the seventh week of gestation before the luteo-placental shift in progesterone production occurs (2). However, expression of the LH/CG receptor in different gestational tissues suggests that the hormone plays a pivotal role during pregnancy (3, 4, 5). Indeed, CG was shown to modulate invasiveness of trophoblasts but also promotes angiogenesis and reduces in vitro HIV infection rates of placental tissue (6, 7, 8, 9).

In vivo CG expression is restricted to the syncytium, a multinuclear epithelium that is generated by continuous cell fusion of underlying mononuclear cytotrophoblasts (10, 11). The syncytium comprises the outermost cell layer of the floating placental villus, which is bathed in maternal blood and separates fetal and maternal circulation (12). The epithelium plays an essential role in establishment and maintenance of pregnancy, because it secretes placental hormones into the maternal blood stream and transports nutrients and gases between mother and fetus. Numerous placental growth factors were shown to regulate syncytium formation in an autocrine or paracrine manner (13). Importantly, syncytialization is also stimulated by CG involving a protein kinase A-dependent mechanism (14). Other promoting factors, such as TGF-{alpha}, leukemia inhibitory factor, or epidermal growth factor, seem to exert their effects through induction of CG, pointing toward a central role of the hormone in villous trophoblast differentiation (15).

Maternal serum levels of CG increase rapidly after implantation, peak at 9th to 10th week of gestation and persist at low levels throughout the remainder of pregnancy (16). However, concentrations of free CG{alpha} increase until parturition, suggesting that levels of holo-CG are determined by selective production of the ß-subunit (17). Aberrant serum levels of CG are used to monitor pregnancy-associated complications such as Down’s syndrome, trophoblastic tumors, or extra-uterine gravidity (18, 19, 20). Despite these facts, regulation of the complex expression pattern of CG during normal pregnancy and in gestational diseases remains elusive.

The CGß gene cluster, which comprises six copies arranged on chromosome 19, is highly homologous to the single-copy LHß gene, suggesting that the DNA sequences are derived from a common ancestor (21, 22). Most of our knowledge on CGß gene expression has been acquired from studies of cytotrophoblast-like choriocarcinoma cells (23). Expression of CGß is mainly regulated at the mRNA level, and the CGß5 gene is most abundantly transcribed in choriocarcinoma cells and placentas of early and late gestation (24, 25, 26). A complex promoter region (-311 to -188) interacting with broadly expressed transcription factors of the selective promoter factor (Sp) and activating protein 2 (AP-2) families is required for trophoblast-specific CGß expression (27). Sequences between -315 and -279 maintain basal expression, whereas cAMP-dependent transcription requires an extended (-311 to -202) 5' flanking region (28, 29). Transcription factors of the AP-2 family play a central role in CG expression because they were shown to regulate both subunit genes (28, 30, 31).

In vivo, CG can only be detected in cytotrophoblasts before the sixth week, whereas its expression shifts toward the syncytium at later stages of gestation (32). Therefore, we suspected that expression of CGß mRNA in syncytiotrophoblasts might be accompanied by differentiation-dependent induction of critical transcriptional activators. To study CG gene expression we used isolated villous trophoblasts that undergo spontaneous cell fusion in culture (33, 34). During the in vitro differentiation process, both CG subunit mRNAs are induced, but only CGß at later stages, suggesting that expression of the specific subunit closely correlates with syncytium formation (35, 36, 37). Recently, we analyzed regulation of the CG{alpha} gene promoter in the differentiating cultures (38, 39). Here, we investigated the role of Sp and AP-2 cognate sequences in differentiation-dependent transcription of the CGß5 gene using transient reporter assays and studied binding activities of the interacting nuclear proteins in EMSA. Moreover, we examined the temporal expression and placental localization of different Sp family members in placentas of early and late gestation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Purification, cultivation, and transfection of villous term trophoblast cells
Placental tissue of early (between 10th and 12th weeks) and late (between 38th and 40th weeks) pregnancy was obtained from legal abortions and cesarean sections, respectively. Use of tissues was approved by the local ethical committee. Cytotrophoblasts were isolated by enzymatic dispersion and density gradient centrifugation as described (34, 40). Cells were immunopurified by depleting HLA-I-positive cells as previously mentioned (41). Pure trophoblasts (97% cytokeratin 7-positive cells) were seeded on plastic at a density of 5 x 105 cells/cm2 and cultivated in keratinocyte growth medium (Life Technologies, Inc., Paisley, UK) containing 10% fetal calf serum (Pall, East Hills, NY) to perform in vitro differentiation (33). Each cell preparation was routinely checked by immunocytochemistry at 12 and 60 h of cultivation using cytokeratin 7 and vimentin antibodies to detect trophoblasts and contaminating stromal cells, respectively (39). In the late cultures (60 h) syncytialization was confirmed by the appearance of multinuclear, desmoplakin-negative structures using a monoclonal antibody (0.44 mg/ml anti-desmosomal protein, ZK-31, Sigma Chemical Co., St. Louis, MO). For reporter studies, term trophoblasts were seeded in 24-well plates and transiently transfected at 12 and 48 h using lipofection as described by the supplier (Life Technologies). Briefly, trophoblasts were incubated with preformed complexes containing 2 µl Lipofectamine 2000 reagent, 1.5 µg luciferase reporter plasmid, and 0.5 µg plasmid cytomegalovirus ß-galactose (ß-Gal) (Clontech, Palo Alto, CA) in a final volume of 100 µl serum-free keratinocyte growth medium. Reporter plasmids kindly provided by Dr. J. L. Jameson contained either the (-3700 to +114) CGß5 5' flanking sequences or wild-type/mutant sequences of the proximal (-345 to +114) GGß5 promoter (27, 29, 42). Two parallel transfections per construct were performed. After an additional 36 h, supernatants were aspirated, and cellular protein lysates were prepared in 150 µl reporter lysis buffer (Promega, Madison, WI) and stored at -70 C. SL-2 insect cells were transiently transfected in 60-mm petri dishes using polyethylenimine (PEI 25,000) as previously described (43). To investigate the influence of different Sp proteins on reporter expression, transfections (triplicates) were performed in the presence of 15 µg CGß5 luciferase reporter and 0.5 µg Sp-factor expression plasmid, pPac-Sp1 or pPac-Sp3, encoding the long form of Sp3 (44).

Reporter assays
Luciferase activity was determined on a luminometer (Lumat LB 9507, EG&G Berthold, Bad Wildbad, Germany) using a luciferase assay system (Promega) and 10 µl protein extract. Activity of ß-Gal was quantitated on a photometer by determining the conversion of the chromogenic substrate chlorophenol red-ß-D-galactopyranoside (Roche Diagnostics, Vienna, Austria) at 570 nm as described (45). ß-Gal values were determined in 40 µl of protein lysate incubated 15 min at 37 C. Luciferase and ß-Gal assays were performed in duplicate, and mean values were calculated. Concentration of protein lysates was determined by Bio-Rad assay reagent according to the manufacturer’s instructions (Bio-Rad, Hercules, CA).

Fluorescence immunohistochemistry
Placental tissues were fixed for 60 min at 4 C in 2% paraformaldehyde, washed two times in PBS, and soaked with 0.5 M sucrose/PBS for at least 1 h at room temperature. Subsequently, samples were covered with OCT compound (Sakura, Zoetermonde, The Netherlands), immediately frozen (-20 C), and stored at -80 C. The 3-µm serial cryostat sections were prepared, postfixed with 1% paraformaldehyde (10 min at 4 C), and treated with 0.1% Triton X-100/PBS for another 5 min. After a 60-min incubation in blocking solution (NEN Life Science Products, Boston, MA), slides were incubated overnight with primary antibodies followed by a 1-h treatment with 2.8 µg/ml secondary antibodies (Molecular Probes, Eugene, OR): Alexa Fluor 568 F(ab')2 antirabbit IgG, Alexa Fluor 488 F(ab')2 antimouse IgG, or Alexa Fluor 546 F(ab')2 antimouse IgG. The following primary antibodies were used: cytokeratin 7 (clone OV-TL 12/30 at 8.3 µg/ml) (Dako, Glostrup, Denmark); Sp1 (1C6 at 40 µg/ml), Sp2 (H-282 at 17 µg/ml), and Sp3 (H-225 at 20 µg/ml) (Santa Cruz Biotechnology, Santa Cruz, CA); and E-cadherin (C20820 at 5 µg/ml) (BD Biosciences, Palo Alto, CA). All sections were counterstained with 1 µg/ml 4'6-diamidine-2'-phenylindole dihydrochloride (DAPI) (Roche Diagnostics) and covered with fluoromount G (Soubio, Birmingham, AL). Finally, slides were analyzed by fluorescence microscopy (Olympus BX50) and digitally photographed.

EMSA
Protein extraction of villous trophoblasts, annealing/labeling of complementary oligonucleotide sequences, and EMSA were performed as described elsewhere (39). Briefly, total extracts were prepared by freezing (liquid nitrogen)/thawing in buffer containing 20 mM HEPES (pH 7.9), 0.4 M NaCl, 2.5% glycerol, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM NaF, 0.02 µg/ml leupeptin, 0.02 µg/ml aprotinin, 0.1 µg/ml trypsin inhibitor, and 0.5 mM dithiothreitol. Nuclear/cytoplasmic extracts were prepared using NE-PERT nuclear and cytoplasmic extraction reagent according to the manufacturer’s instructions (Pierce, Rockford, IL). Oligonucleotides were derived from known DNA-binding sequences of the CGß5 promoter (see Fig. 3Go) or contained consensus (underlined) Sp or AP-2 cognate sequences: Sp-sense, 5'ACAAGACGCTGGGCGGGGCCGGATCCGGTTCG3', and AP-2-sense, 5'GATCGAACT GACCGCCCGCGGCCCGT3'. Binding reactions were performed in a buffer containing either 20 µg total/cytoplasmic or 3 µg nuclear extract, 4 fmol 32P-labeled, double-stranded oligonucleotide, 16 mM HEPES, 0.5% Triton, 0.8 mM dithiothreitol, 60 mM KCl, 200 ng/µl polyadenylic acid-pentadecathymidylic acid, 0.1 mM ZnCl2, and 6% glycerin. In supershift experiments, antibody was added after 30 min, and binding reactions were incubated for an additional 15 min at room temperature. The following antibodies were used as mentioned by the supplier (Santa Cruz Biotechnology): Sp1(1C6, sc-420X), Sp2(K-20, sc-643X), Sp3 (D-20, sc-644X), or AP2{alpha} (C-18, sc-184X). Electrophoresis of protein-DNA complexes was carried out on 4% polyacrylamide gels (3% glycerin) in the cold (25 mA). Gels were dried and exposed to films (Hyperfilm MP, Amersham Pharmacia Biotech, Piscataway, NJ).



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 3. Schematic representation of the oligonucleotide sequences of the proximal CGß5 promoter region used in EMSA. Positions of enhancer elements relative to the transcriptional start site (+1) are indicated. Bold sequences depict AP-2 or Sp recognition sequences. Italic letters indicate mutated nucleotides.

 
Cloning, in vitro translation, and EMSA with recombinant AP-2{alpha}
The open reading frame encoding AP-2{alpha} was amplified by RT-PCR from total RNA prepared with TRI reagent (Molecular Research Center, Inc., Cincinnati, OH) from 60-h villous trophoblasts. Briefly, 4 µg of RNA quantitated with the Bioanalyzer 2100 (Agilent, Palo Alto, CA) was used for synthesis of first-strand cDNA using 10 U/µl Superscript (Life Technologies) and 25 µg/ml oligo(dT)12–18 (Research Genetics, Huntsville, AL). PCR (1 min at 96 C, 1 min at 61 C, and 2 min at 72 C) were performed with the RoboCycler Gradient 96 (Stratagene, Amsterdam, The Netherlands) using 0.5 U Taq polymerase as described by the manufacturer (Invitrogen, Carlsbad, CA). The PCR fragment (35 cycles) was amplified using oligonucleotides AP-2{alpha}-s (5'-ATGCTTTGGAAATTGACGGA-3') and AP-2{alpha}-a (5'-TCACTTTCTGTG CTTCTCCTC-3'), gel purified, cloned into pCRII-Topo (Invitrogen), and sequenced on both strands using the nonradioactive ABI PRISM Terminator Cycle Sequencing Ready Reaction Kit as specified by the supplier (Applied Biosystems, Foster City, CA). In vitro transcription/translation of recombinant AP-2{alpha} protein was done by using TNT T7 Coupled Reticulocyte Lysate Systems (1 µg plasmid/50 µl lysate) according to the manufacturer’s instructions (Promega). For EMSA, 4 µl of reticulocyte lysate containing AP-2{alpha} and/or 50ng of recombinant human Sp1 (Promega) were incubated with radiolabeled oligonucleotides using conditions described above.

Western blot analysis
Cells were cultured for 24 and 60 h, and proteins were extracted as described above. Protein (80 µg) was separated on 8.5% SDS/polyacrylamide gels and transferred to polyvinylidene difluoride membranes (Hybond-P, Amersham Pharmacia). Subsequently, membranes were blocked with 3% nonfat dry milk/PBS for 1 h at room temperature and incubated with the primary antibody in 0.5% nonfat dry milk/PBS for an additional 12 h. The following primary antibodies (final concentrations) were used: Sp1 (ab2, Geneka Biotechnology, Quebec, Canada) (1:500), Sp3 (D-20, Santa Cruz Biotechnology) (2 µg/ml), antiactin (A-2066, Sigma) (1 µg/ml). After 1 h of treatment (room temperature) with secondary antibody (antirabbit Ig horseradish peroxidase linked, Amersham) (1:50,000), signals were developed by using the enhanced chemiluminescence system (Amersham Pharmacia Biotech) according to the manufacturer’s instructions. For reprobing, blots were stripped 10 min in a buffer containing 100 mM 2-mercaptoethanol, 2% SDS, and 62.5 mM Tris chloride (pH 6.7) at 50 C and subsequently incubated with a different primary antibody.

Densitometry
Bands obtained in Western blot analysis were densitometrically scanned using the documentation system Epi Chemi II darkroom (UVP, Upland, CA). Signals were quantitated using the program Labworks (UVP).

Statistical analysis
Statistical analyses were performed with Sigma Stat Statistical Software (Jandl Corp., Chicago, IL) using Student’s paired t test or one-way ANOVA. A P value < 0.05 was considered statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Immunopurified villous trophoblasts of term placenta were analyzed by immunocytochemistry to evaluate in vitro syncytium formation. After 60 h of cultivation, 70–80% of cells formed multinuclear, desmoplakin-negative structures (Fig. 1AGo). To assess the regulation of the CGß5 promoter during the differentiation process, cytotrophoblasts (12 h) and syncytializing cultures (48 h) were transfected with reporter plasmids harboring different lengths of the CGß5 5' flanking region or the proximal CG{alpha} promoter as a control (Fig. 1BGo). As previously noticed, transcriptional activity of the CG{alpha} reporter increased 3-fold between 12 and 48 h of differentiation (38). Compared with early cultures (100%), expression of CGß5 (-3700 to +114) and CGß5 (-345 to +114) rose to 230 and 220%, respectively, at 48 h of cultivation, suggesting that the proximal (-345 to +114) CGß5 sequences are sufficient to govern differentiation-dependent induction of the gene.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 1. In vitro syncytialization and transfection of purified villous trophoblasts with CG{alpha} and different CGß5 gene promoter constructs. A, Immunocytochemistry of 24- and 60-h villous trophoblasts using desmoplakin antibodies. Representative samples are shown. Cells were counterstained with DAPI. The stippled line marks a desmoplakin-negative, syncytialized area. B, Trophoblasts were cotransfected with luciferase-expressing plasmids and pCMV-ßGal at 12 and 48 h of in vitro differentiation. After an additional 36 h, luciferase activity (normalized to the respective ß-Gal activity of each extract) was determined in lysates as described in Materials and Methods, and 2- to 3-fold differences in overall transfection rates of primary cells were observed. For comparison of different trophoblast preparations, values at 24 h were arbitrarily set to 100% in each transfection experiment. Bars represent the mean values of eight independent transfections of trophoblasts isolated from four different placentas; error bars indicate SD; *, P < 0.05.

 
By transfecting cytotrophoblasts (12 h) and more differentiated (48 h) trophoblasts with wild-type and mutant constructs of the proximal 5' flanking region we determined the contribution of individual recognition sites to the CGß5 promoter activity (Fig. 2Go). A schematic representation of the two enhancer regions of the wild-type CGß5 (-345 to +114) promoter and the different mutants abolishing binding of Sp/AP-2 factors (27) is depicted (Fig. 2AGo). Luciferase assays revealed that mutation of the distal (mut1) Sp site altered reporter expression to 152 and 87%, respectively, at 12 and 48 h of transfection (Fig. 2BGo). Mutation of the proximal (mut2) Sp element decreased expression to 53% (12 h) and 26% (48 h). Inactivation of the proximal (mut4) AP-2 cognate sequence reduced transcription to 48% (12 h) and 37% (48 h), whereas mutation of the two distal AP-2 elements (mut3) diminished luciferase activity to 63% (12 h) and 23% (48 h). The construct harboring point mutations in all three AP-2 sites (mut5) retained only 47% (12 h) and 13% (48 h) of the transcriptional activity of the wild type (100%).



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 2. Mutational analysis of the proximal (-345 to +114) CGß5 promoter. A, Schematic representation of the CGß5 wild-type (WT) and mutant promoter regions. Open and filled boxes indicate WT and mutated sequences of the two SP/AP-2 enhancer regions, respectively. Positions relative to the transcriptional start site (+1) are depicted. B, Transcriptional activities of different SP/AP-2 mutants of the proximal CGß5 promoter. Differentiated trophoblasts (48 h) were transfected with WT or mutant CGß5 promoter constructs. After 36 h, luciferase activity was determined in protein extracts and normalized to ß-Gal activity as described above. For comparison of different trophoblast preparations, values of WT were arbitrarily set to 100% in each transfection experiment. Bars represent the mean values of eight independent transfections of trophoblasts isolated from four different placentas; error bars indicate SD; *, P < 0.05; ns, not significant

 
To study binding activities of the DNA elements in EMSA, oligonucleotides harboring wild-type or mutant Sp and AP-2 recognition sequences of the CGß5 promoter region were designed (Fig. 3Go). First, we performed gel retardation assays using 32P-labeled Sp and AP-2 consensus sequences to determine the overall expression pattern of Sp and AP-2 factors in syncytialized trophoblast cultures (Fig. 4AGo). Expression of different Sp family members and AP-2{alpha} could be detected in nuclei, whereas the proteins were absent from the cytoplasm. Supershift analyses revealed the presence of Sp1 and two different forms of Sp3, whereas expression of Sp2, which we detected in JEG-3 choriocarcinoma cells, and Sp4 could not be observed (not shown). As recently shown, AP-2{alpha} was the only protein found in the AP-2 DNA-binding complexes, suggesting that it is the main family member expressed in the differentiated primary trophoblasts (39, 46). Whereas Sp and AP-2 binding could be competed by unlabeled consensus sequences, the mutant cognate sequences (used in the transfection assays of Fig. 2BGo) did not abolish binding of the transcription factors (Fig. 4BGo).



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 4. Expression pattern and binding specificity of Sp and AP-2 factors in differentiated trophoblast cultures. Nuclear and cytoplasmic extracts (n = 3) were isolated from trophoblasts after 84 h of cultivation and analyzed by EMSA using 32P-labeled Sp and AP-2 consensus sequences as described in Materials and Methods. Specific DNA-binding complexes are marked by arrows. Asterisks indicate nonspecific binding. A, Supershift analysis. Binding reactions were incubated in the absence (control) or presence of different Sp or AP-2{alpha} antibodies. B, Competition analysis. Binding reactions were incubated with 10 or 50 M excess of unlabeled consensus sites or mutant recognition sequences.

 
Similar to the consensus sites, individual cognate sequences of the promoter interacted with Sp1, Sp3, and AP-2{alpha} after 24 and 60 h of cultivation (Fig. 5Go). Analysis of one of the distal AP-2 elements revealed that its AP-2{alpha} binding activity increased during syncytium formation (Fig. 5AGo). Similarly, Sp1 and different isoforms of Sp3 (short form, lower signal; long form, upper signal) interacting with the distal Sp site rose during in vitro differentiation (Fig 5BGo). In EMSA using a oligonucleotide harboring one of the distal AP-2 sequences and the Sp element (AP2-Sp-II), we observed elevated binding activities of Sp1 and Sp3 isoforms at 60 h of culture (Fig. 5CGo). However, compared with binding to the single AP-2 (AP2-II) and Sp (Sp-II) elements, AP-2{alpha} and Sp1/Sp3 weakly interacted with AP2-Sp-II. The result suggests that the close proximity of Sp and AP-2 sequences may hinder simultaneous binding of the factors to their cognate sequences. Accordingly, complexes harboring both Sp1/Sp3 and AP-2{alpha} could not be detected with the AP2-Sp-II oligonucleotide. Contrary to that, DNA-protein complexes containing both Sp1 and AP-2{alpha} were observed at the proximal promoter element and were abolished in the presence of Sp1 or AP-2{alpha} antibodies (Fig 5DGo). Signals corresponding to the short forms of Sp3 were absent in EMSA with the AP2-Sp-I oligonucleotide. To study whether the close spacing of Sp and AP-2 sites of the distal region may impair concurrent binding, labeled AP2-Sp-II was incubated with in vitro translated AP-2{alpha} in the absence or presence of recombinant Sp1 (Fig 5EGo). Whereas each protein specifically interacted with the oligonucleotide, complexes containing both Sp1 and AP-2{alpha} could not be observed. Contrary to that, EMSA with the proximal sequence (AP2-Sp-I) revealed formation of complexes harboring both proteins, which disappeared upon treatment with AP-2{alpha} or Sp1 antibodies.



View larger version (89K):
[in this window]
[in a new window]
  		FIG. 5. Interaction of Sp1, Sp3, and AP-2{alpha} with DNA elements of the proximal CGß5 promoter region. Representative EMSAs of three independent experiments/placentas are shown. Binding reactions containing different 32P-labeled oligonucleotides (A–F) and gel shifts were performed as described in Materials and Methods. Extracts of villous trophoblasts were isolated at the onset (24 h) and a later stage (60 h) of syncytium formation. Binding reactions were incubated in the absence (control) or presence of different Sp or AP-2{alpha} antibodies. Specific complexes are marked by arrows; nonspecific binding activities are indicated by asterisks. A, EMSA using AP2-II; B, EMSA of oligonucleotide Sp-II; C, For comparison of binding activities at sequences of the distal enhancer region (AP2-Sp-II), equal cpm of radiolabeled oligonucleotides were used; D, EMSA of AP2-Sp-I; E, Binding of in vitro translated AP-2{alpha} and recombinant Sp1 to the proximal and distal region. In all binding reactions, reticulocyte lysate containing AP-2{alpha} was added. Migration distance of Sp1 was not different in binding reactions containing Sp1 and AP-2{alpha} or Sp1 alone (not shown). F, EMSA using AP2-I and Sp-I. For elevation of cAMP levels, 12-h trophoblasts were stimulated for an additional 12 h with 10 µM forskolin.

 
To evaluate the influence of cAMP on Sp and AP-2 binding, villous trophoblasts were treated with forskolin. As previously noticed, AP-2{alpha} binding increased upon elevation of cAMP levels (39), whereas binding of Sp1 and Sp3 of the same cell extract was not affected (Fig. 5FGo).

Western blot analyses revealed the presence of two Sp1 proteins (95 and 106 kDa) and three different Sp3 isoforms (65, 70, and 100 kDa) in the primary trophoblasts, whereas JEG-3 choriocarcinoma cells predominantly expressed 95-kDa Sp1 and higher amounts of 70-kDa Sp3 (Fig. 6Go). Compared with 24 h (100%), Sp1 (95 and 106 kDa) increased to 295 ± 6% SEM at 60 h of differentiation, whereas 100-kDa and 70/65-kDa Sp3 rose to 280 ± 15% SEM and 180 ± 12% SEM, respectively (n = 3).



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 6. Differentiation-dependent expression of Sp1 and Sp3 proteins. Immunopurified trophoblasts of three independent preparations were cultured for 24 and 60 h. Protein extraction and Western blot analyses were performed as described in Materials and Methods. Specific signals were visualized by enhanced chemiluminescence and densitometrically scanned. Molecular weights of the different Sp1 and Sp3 isoforms are indicated. For control of protein loading, the blot was reprobed with an actin antibody. As a control for Sp1 signals, extracts isolated from wild-type (+/+) and Sp1-deficient (-/-) mouse cells, expressing a truncated Sp1 protein, were used (53 ).

 
To localize Sp proteins in vivo, immunohistochemical analyses of term placental sections were performed (Fig. 7Go). Sp1 was detected in the majority of nuclei of the syncytium and the villous stroma, whereas the protein was either weakly expressed or absent from endothelial cells (Fig. 7AGo). Sp3 was strongly expressed in nuclei of all cell types, whereas Sp2 was observed in villous stromal cells but absent from endothelia and trophoblasts. The distribution of Sp1 and Sp3 in cytotrophoblasts and syncytium was further evaluated by costaining of the Sp factors with E-cadherin (Fig. 7BGo) which is expressed at the adherens junctions of cytotrophoblasts but absent from the syncytium (47). Of 604 cytotrophoblasts (six different placentas) counted, 47 ± 2.5% SEM nuclei were negative for Sp1, whereas weak expression was detected in 16 ± 3.6% SEM nuclei. Also, 33 ± 2.5% SEM of nuclei failed to express Sp3 (total of 605 nuclei of six different placentas evaluated), whereas 12 ± 3% SEM cells weakly produced Sp3.



View larger version (47K):
[in this window]
[in a new window]
  		FIG. 7. Immunohistochemical detection of Sp family members in placental tissues. Serial sections were analyzed by fluorescence immunohistochemistry as described in Materials and Methods. To visualize nuclei of each section, slides were counterstained with DAPI (corresponding right panel); arrows mark the syncytium in A and C. A, Localization of Sp1, Sp2, and Sp3 in placental tissue of the 38th week of pregnancy. Photomicrographs (x200 magnification) are from one of 10 different experiments/placentas shown with similar results. B, Costaining of Sp1 and E-cadherin on term placenta. To evaluate expression of Sp1 in cytotrophoblasts (indicated by arrowheads), staining of the transcription factor was counted in nuclei encircled by E-cadherin-positive signals. As an example, a Sp1-positive cytotrophoblast (upper arrowhead) as well as a Sp-1 negative cytotrophoblast (lower arrowhead) are shown. Arrows depict syncytial nuclei. Pictures were taken at x1000 magnification. C, Distribution of Sp factors in placental tissue of 11th week of gestation. Sections were stained with antibodies against cytokeratin 7 (CK7) to mark the trophoblast epithelium and different Sp antibodies. A representative example of eight placentas analyzed is depicted (x200 magnification).

 
Contrary to that, fluorescence immunohistochemistry of first-trimester placentas revealed that almost all nuclei of the cytotrophoblast und syncytial layer expressed Sp1, whereas Sp3 was absent from the syncytium (Fig. 7CGo). Interestingly, Sp2, which is not expressed in villous trophoblasts of term placentas, could be detected in cytotrophoblasts of early pregnancy.

Finally, we cotransfected wild-type and Sp-mutant luciferase reporters with Sp1 or Sp3 expression plasmids into Sp-deficient insect cells to study whether the proteins may influence CGß5 transcription (Fig. 8Go). Both Sp1 and the long form of Sp3 induced activity of the wild-type promoter whereas Sp-mutant constructs (mut1 and mut2) were stimulated to lesser extents.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 8. Transcriptional activity of the proximal CGß5 promoter in SL-2 cells. Insect cells were transfected with wild-type CGß5 promoter or luciferase reporters harboring mutant Sp sites (mut1 and mut2) in the absence or presence of Sp1- or Sp3-expression vectors as described in Materials and Methods. Mean values ± SD are derived from two transfection experiments performed in triplicate (n = 6). Data represent percentage of activity of hybrid genes in the presence of Sp1 or Sp3 compared with reporters alone. For relative correlation, values of Sp1- and Sp3-induced wild-type (wt) promoter were arbitrarily set to 100%. Upon induction with Sp1 or Sp3, mut1 and mut2 were significantly lower than wt. *, P < 0.05.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study we investigated the regulation of the CGß5 gene promoter during trophoblast cell fusion. Similar to the differentiation-dependent expression of the CG{alpha} gene (39), increasing CGß5 mRNA levels (36) seem to be accompanied by rising transcriptional activity of the CGß5 gene. Experiments using different lengths of the CGß5 5' flanking sequence indicate that the proximal region (-345 to +114) was sufficient for transcriptional induction. Thus, cognate sequences and transcription factors known to interact with the particular CGß5 promoter region in choriocarcinoma cells (27) were evaluated in detail.

As was observed in tumor cells (27), CGß5 gene expression in differentiating primary trophoblasts required three AP-2 and two Sp cognate sequences because mutation of the sites considerably reduced CGß5 promoter activity. Inactivation of individual elements in late cultures affected promoter activity to larger extents than in early cultures, suggesting that binding to the recognition sequences becomes more important during in vitro syncytialization. Therefore, we conclude that all enhancer elements tested may contribute to the elevated expression of CGß5 in the syncytialized cultures. Contrary to that, we recently showed that differentiation-dependent induction of CG{alpha} transcription required cAMP-responsive elements (CREs) and the trophoblast-specific element (TSE) but did not involve other cognate sequences such as the CCAAT element, which displayed equal amounts of CAAT-binding activity at different stages of differentiation (39).

The fact that inactivation of the three AP-2 elements decreased luciferase expression to 13% in the differentiated trophoblasts supports the assumption that transcriptional activators of the AP-2 family play a major role in CGß transcription (30, 31). EMSA demonstrated that the AP-2 cognate sequences bound increasing amounts of AP-2{alpha} during in vitro differentiation, suggesting that the rise in transcriptional activity involves elevated binding activity expression of the factor. Indeed, we recently demonstrated that protein expression and interaction of AP-2{alpha} with the TSE of the CG{alpha} gene promoter increased during in vitro differentiation (39). Along those lines it is noteworthy that another AP-2 family member, AP-2{gamma}, can be detected only in early cytotrophoblast cultures and decreases during cell fusion (46). Thus, the central role of AP-2{alpha} in the regulation of both CG subunit genes is further substantiated.

Because syncytialization is accompanied by a spontaneous elevation of cAMP levels (48), increasing CGß5 transcription in primary trophoblasts is likely controlled by cAMP-dependent signaling. Indeed, similar luciferase activities of CGß5 (-3700 to +114) and CGß5 (-345 to +114) in the differentiated cultures reflect the comparable expression levels of the two different promoter regions in cAMP-stimulated tumor cells (29). In particular, AP-2{alpha} could play an important role in the signal transduction pathway because cAMP/protein kinase A induces AP-2{alpha} mRNA/protein expression and binding activity in different trophoblast cell models, whereas AP-2{gamma} transcript levels are not affected (27, 31, 39). Similar to the TSE of the CG{alpha} promoter, elevation of cAMP levels increased binding of AP-2{alpha} to the proximal CGß5 promoter element, whereas Sp1/Sp3 affinities were not altered. Therefore, increasing cAMP levels/AP-2{alpha}-binding could be a major cause of elevated CGß5 transcription in the syncytium.

Although AP-2 could be responsible for basal and cAMP-induced transcription of the CGß5 gene, Sp factors are thought to be mainly required for basal expression (27). It was proposed that upon cAMP stimulation increasing amounts/binding of AP-2 factors may compete with Sp proteins, e.g. at the distal element, thereby governing inducible transcription. Indeed, we could not detect simultaneous binding of recombinant Sp1 and AP-2{alpha} to the distal regulatory region (Fig. 5EGo). We also observed weakened binding of Sp factors in the presence of the closely spaced AP-2 site in trophoblast extracts, and complexes containing both AP-2{alpha} and Sp factors could not be found (Fig. 5CGo). Along those lines, it has been demonstrated that mutation of the Sp sites increased cAMP induction of the CGß5 reporter above wild-type levels, suggesting that facilitated binding of the neighboring AP-2 sites might be artificially generated (27). Compared with the wild-type promoter, we noticed elevated and similar luciferase expression levels of the distal Sp mutant (mut1) at 12 and 48 h of transfection, respectively. Thus, high luciferase levels of mut1 may also reflect facilitated AP-2{alpha} binding upon inactivation of the Sp site.

Our data are not contradictory to the idea that rising AP-2{alpha} levels may displace Sp proteins during differentiation and thereby increase CGß5 gene expression. On the other hand, nuclear Sp1/Sp3 binding activities steeply increase on both Sp elements during in vitro syncytialization. In addition, we observed concurrent binding of Sp1 and AP-2{alpha} to neighboring sites of the proximal region in trophoblasts (Fig. 5DGo) and in experiments using recombinant factors (Fig 5EGo). Increasing binding activities of the Sp proteins were accompanied by rising protein levels, suggesting that induction of the factors is not governed at the posttranslational level. To validate the results of the in vitro cultures, we also examined production of Sp1/Sp3 in cytotrophoblasts of tissue sections. Counting of Sp1/Sp3 expression in E-cadherin-positive cells of trophoblast epithelium revealed that a considerable number of cytotrophoblasts did not express Sp1 or Sp3, whereas the factors were localized in the majority of syncytial nuclei. Thus, we conclude that Sp1 and Sp3 factors are involved in differentiation-dependent regulation of the CGß5 gene, whereas Sp2 and Sp4, which exhibit restricted expression patterns (49), are absent from term trophoblasts. Increasing expression/binding activities of Sp1/Sp3 could trigger onset of basal transcription of CGß5 in cytotrophoblasts undergoing cell fusion. With respect to that, it is interesting to note that a different expression pattern of Sp1 and Sp3 was observed in first-trimester trophoblasts. Additional investigations are needed to delineate whether the altered distribution of the factors could provide a possible explanation for the high CG/CGß levels of early pregnancy.

Whereas Sp1 is generally regarded as a transcriptional activator, Sp3 may act as an activator or repressor depending on the gene and cellular context (50). Both short forms, lacking part of the Sp3 transactivation domains, and long forms of Sp3 were implicated in transcriptional repression (51). Thus, the ratio of Sp1/Sp3 is thought to be critical for transactivation of certain genes, and down-regulation of Sp3 may promote Sp1-dependent transcriptional activation (52). Because short and long isoforms of the protein were detected in the differentiating cultures, it is possible that Sp1-mediated transactivation of the CGß5 promoter might be attenuated by Sp3. On the other hand, transfections in SL-2 cells demonstrate that both Sp sites are active and inducible by either Sp1 or Sp3-long. Therefore, the data indicate that the particular sequences of the CGß5 gene could act as activating elements.

In conclusion, the results suggest that increasing levels of Sp proteins and AP-2{alpha} up-regulate CGß5 mRNA expression during term trophoblast differentiation. Distinct expression patterns of Sp factors were observed in trophoblast cell types of early and late gestation, suggesting that different combinations of nuclear proteins may control CGß expression during placental development.


   Acknowledgments
 
We thank Dr. J. L. Jameson for providing luciferase reporters harboring different wild-type or mutant CGß5 promoter regions. We are also grateful to G. Puller for help with graphics.


   Footnotes
 
This work was supported by Grant 8122 of the "Jubiläumsfond of the Austrian National Bank to M.K. and by Grant P15632 of the Austrian Science Fund to H.R.

Abbreviations: AP, Activating protein; CG, chorionic gonadotropin; DAPI, 4'6-diamidine-2'-phenylindole dihydrochloride; ß-Gal, ß-galactosidase; Sp, selective promoter factor; TSE, trophoblast-specific element.

Received July 28, 2003.

Accepted for publication December 18, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Pierce JG, Parsons TF 1981 Glycoprotein hormones: structure and function. Annu Rev Biochem 50:465–495[CrossRef][Medline]
  2. Tulchinsky D, Hobel CJ 1973 Plasma human chorionic gonadotropin, estrone, estradiol, estriol, progesterone, and 17{alpha}-hydroxyprogesterone in human pregnancy. 3. Early normal pregnancy. Am J Obstet Gynecol 117:884–893[Medline]
  3. Tao YX, Lei ZM, Hofmann GE, Rao CV 1995 Human intermediate trophoblasts express chorionic gonadotropin/luteinizing hormone receptor gene. Biol Reprod 53:899–904[Abstract]
  4. Han SW, Lei ZM, Rao CV 1999 Treatment of human endometrial stromal cells with chorionic gonadotropin promotes their morphological and functional differentiation into decidua. Mol Cell Endocrinol 147:7–16[CrossRef][Medline]
  5. Zhang W, Lei ZM, Rao CV 1999 Immortalized hippocampal cells contain functional luteinizing hormone/human chorionic gonadotropin receptors. Life Sci 65:2083–2098[CrossRef][Medline]
  6. Zygmunt M, Herr F, Keller-Schoenwetter S, Kunzi-Rapp K, Munstedt K, Rao CV, Lang U, Preissner KT 2002 Characterization of human chorionic gonadotropin as a novel angiogenic factor. J Clin Endocrinol Metab 87:5290–5296[Abstract/Free Full Text]
  7. Zygmunt M, Hahn D, Munstedt K, Bischof P, Lang U 1998 Invasion of cytotrophoblastic JEG-3 cells is stimulated by hCG in vitro. Placenta 19:587–593[CrossRef][Medline]
  8. Yagel S, Geva TE, Solomon H, Shimonovitz S, Reich R, Finci-Yeheskel Z, Mayer M, Milwidsky A 1993 High levels of human chorionic gonadotropin retard first trimester trophoblast invasion in vitro by decreasing urokinase plasminogen activator and collagenase activities. J Clin Endocrinol Metab 77:1506–1511[Abstract]
  9. Polliotti BM, Gnall-Sazenski S, Laughlin TS, Miller RK 2002 Inhibitory effects of human chorionic gonadotropin (hCG) preparations on HIV infection of human placenta in vitro. Placenta 23(Suppl A):S102–S106
  10. Hoshina M, Boothby M, Boime I 1982 Cytological localization of chorionic gonadotropin {alpha} and placental lactogen mRNAs during development of the human placenta. J Cell Biol 93:190–198[Abstract/Free Full Text]
  11. Boime I, Boothby M, Hoshina M, Daniels-McQueen S, Darnell R 1982 Expression and structures of human placental hormone genes as a function of placental development. Biol Reprod 26:73–91[CrossRef][Medline]
  12. Boyd JD, Hamilton WJ 1966 Electron microscopic observations on the cytotrophoblast contribution to the syncytium in the human placenta. J Anat 100:535–548[Medline]
  13. Morrish DW, Dakour J, Li H 1998 Functional regulation of human trophoblast differentiation. J Reprod Immunol 39:179–195[CrossRef][Medline]
  14. Shi QJ, Lei ZM, Rao CV, Lin J 1993 Novel role of human chorionic gonadotropin in differentiation of human cytotrophoblasts. Endocrinology 132:1387–1395[Abstract]
  15. Yang M, Lei ZM, Rao Ch V 2003 The central role of human chorionic gonadotropin in the formation of human placental syncytium. Endocrinology 144:1108–1120[Abstract/Free Full Text]
  16. Braunstein GD, Rasor J, Danzer H, Adler D, Wade ME 1976 Serum human chorionic gonadotropin levels throughout normal pregnancy. Am J Obstet Gynecol 126:678–681[Medline]
  17. Braunstein GD, Rasor JL, Engvall E, Wade ME 1980 Interrelationships of human chorionic gonadotropin, human placental lactogen, and pregnancy-specific ß1-glycoprotein throughout normal human gestation. Am J Obstet Gynecol 138:1205–1213[Medline]
  18. Page NM, Kemp CF, Butlin DJ, Lowry PJ 2002 Placental peptides as markers of gestational disease. Reproduction 123:487–495[Abstract]
  19. Lehner R, Kucera E, Jirecek S, Egarter C, Husslein P 2000 Ectopic pregnancy. Arch Gynecol Obstet 263:87–92[CrossRef][Medline]
  20. Benn PA, Horne D, Briganti S, Rodis JF, Clive JM 1996 Elevated second-trimester maternal serum hCG alone or in combination with elevated {alpha}-fetoprotein. Obstet Gynecol 87:217–222[Abstract]
  21. Jameson JL, Lindell CM 1988 Isolation and characterization of the human chorionic gonadotropin ß subunit (CGß) gene cluster: regulation of transcriptionally active CGß gene by cyclic AMP. Mol Cell Biol 8:5100–5107[Abstract/Free Full Text]
  22. Talmadge K, Vamvakopoulos NC, Fiddes JC 1984 Evolution of the genes for the ß subunits of human chorionic gonadotropin and luteinizing hormone. Nature 307:37–40[CrossRef][Medline]
  23. Jameson JL, Hollenberg AN 1993 Regulation of chorionic gonadotropin gene expression. Endocr Rev 14:203–221[CrossRef][Medline]
  24. Bo M, Boime I 1992 Identification of the transcriptionally active genes of the chorionic gonadotropin ß gene cluster in vivo. J Biol Chem 267:3179–3184[Abstract/Free Full Text]
  25. Jameson JL, Lindell CM, Habener JF 1987 Gonadotropin and thyrotropin {alpha}- and ß-subunit gene expression in normal and neoplastic tissues characterized using specific messenger ribonucleic acid hybridization probes. J Clin Endocrinol Metab 64:319–327[Abstract]
  26. Miller-Lindholm AK, LaBenz CJ, Ramey J, Bedows E, Ruddon RW 1997 Human chorionic gonadotropin-ß gene expression in first trimester placenta. Endocrinology 138:5459–5465[Abstract/Free Full Text]
  27. Johnson W, Jameson JL 1999 AP-2 (activating protein 2) and Sp1 (selective promoter factor 1) regulatory elements play distinct roles in the control of basal activity and cyclic adenosine 3',5'-monophosphate responsiveness of the human chorionic gonadotropin-ß promoter. Mol Endocrinol 13:1963–1975[Abstract/Free Full Text]
  28. Steger DJ, Buscher M, Hecht JH, Mellon PL 1993 Coordinate control of the {alpha}- and ß-subunit genes of human chorionic gonadotropin by trophoblast-specific element-binding protein. Mol Endocrinol 7:1579–1588[Abstract]
  29. Albanese C, Kay TW, Troccoli NM, Jameson JL 1991 Novel cyclic adenosine 3',5'-monophosphate response element in the human chorionic gonadotropin ß-subunit gene. Mol Endocrinol 5:693–702[Abstract]
  30. Johnson W, Albanese C, Handwerger S, Williams T, Pestell RG, Jameson JL 1997 Regulation of the human chorionic gonadotropin {alpha}- and ß-subunit promoters by AP-2. J Biol Chem 272:15405–15412[Abstract/Free Full Text]
  31. LiCalsi C, Christophe S, Steger DJ, Buescher M, Fischer W, Mellon PL 2000 AP-2 family members regulate basal and cAMP-induced expression of human chorionic gonadotropin. Nucleic Acids Res 28:1036–1043[Abstract/Free Full Text]
  32. Maruo T, Ladines-Llave CA, Matsuo H, Manalo AS, Mochizuki M 1992 A novel change in cytologic localization of human chorionic gonadotropin and human placental lactogen in first-trimester placenta in the course of gestation. Am J Obstet Gynecol 167:217–222[Medline]
  33. Douglas GC, King BF 1990 Differentiation of human trophoblast cells in vitro as revealed by immunocytochemical staining of desmoplakin and nuclei. J Cell Sci 96:131–141[Abstract/Free Full Text]
  34. Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss 3rd JF 1986 Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 118:1567–1582[Abstract]
  35. Kato Y, Braunstein GD 1989 Discordant secretion of placental protein hormones in differentiating trophoblasts in vitro. J Clin Endocrinol Metab 68:814–820[Abstract]
  36. Ringler GE, Kao LC, Miller WL, Strauss 3rd JF 1989 Effects of 8-bromo-cAMP on expression of endocrine functions by cultured human trophoblast cells. Regulation of specific mRNAs. Mol Cell Endocrinol 61:13–21[CrossRef][Medline]
  37. Feinman MA, Kliman HJ, Caltabiano S, Strauss 3rd JF 1986 8-Bromo-3',5'-adenosine monophosphate stimulates the endocrine activity of human cytotrophoblasts in culture. J Clin Endocrinol Metab 63:1211–1217[Abstract]
  38. Knöfler M, Saleh L, Strohmer H, Husslein P, Wolschek MF 1999 Cyclic AMP- and differentiation-dependent regulation of the proximal {alpha}HCG gene promoter in term villous trophoblasts. Mol Hum Reprod 5:573–580[Abstract/Free Full Text]
  39. Knöfler M, Saleh L, Bauer S, Vasicek R, Griesinger G, Strohmer H, Helmer H, Husslein P 2000 Promoter elements and transcription factors involved in differentiation-dependent human chorionic gonadotrophin-{alpha} messenger ribonucleic acid expression of term villous trophoblasts. Endocrinology 141:3737–3748[Abstract/Free Full Text]
  40. Fisher SJ, Cui TY, Zhang L, Hartman L, Grahl K, Zhang GY, Tarpey J, Damsky CH 1989 Adhesive and degradative properties of human placental cytotrophoblast cells in vitro. J Cell Biol 109:891–902[Abstract/Free Full Text]
  41. Knöfler M, Stenzel M, Husslein P 1998 Shedding of tumour necrosis factor receptors from purified villous term trophoblasts and cytotrophoblastic BeWo cells. Hum Reprod 13:2308–2316[Abstract/Free Full Text]
  42. Pestell RG, Hollenberg AN, Albanese C, Jameson JL 1994 c-Jun represses transcription of the human chorionic gonadotropin {alpha} and ß genes through distinct types of CREs. J Biol Chem 269:31090–31096[Abstract/Free Full Text]
  43. Vasicek R, Meinhardt G, Haidweger E, Rotheneder H, Husslein P, Knöfler M 2003 Expression of the human Hand1 gene in trophoblastic cells is transcriptionally regulated by activating and repressing specificity protein (Sp)-elements. Gene 302:115–127[CrossRef][Medline]
  44. Kingsley C, Winoto A 1992 Cloning of GT box-binding proteins: a novel Sp1 multigene family regulating T-cell receptor gene expression. Mol Cell Biol 12:4251–4261[Abstract/Free Full Text]
  45. Eustice DC, Feldman PA, Colberg-Poley AM, Buckery RM, Neubauer RH 1991 A sensitive method for the detection of ß-galactosidase in transfected mammalian cells. Biotechniques 11:739–740, 742–743
  46. Richardson BD, Cheng YH, Langland RA, Handwerger S 2001 Differential expression of AP-2{gamma} and AP-2{alpha} during human trophoblast differentiation. Life Sci. 69:2157–2165
  47. Coutifaris C, Kao LC, Sehdev HM, Chin U, Babalola GO, Blaschuk OW, Strauss 3rd JF 1991 E-cadherin expression during the differentiation of human trophoblasts. Development 113:767–777[Abstract]
  48. Keryer G, Alsat E, Tasken K, Evain-Brion D 1998 Cyclic AMP-dependent protein kinases and human trophoblast cell differentiation in vitro. J Cell Sci 111:995–1004[Abstract]
  49. Hagen G, Muller S, Beato MGS 1992 Cloning by recognition site screening of two novel GT box binding proteins: a family of Sp1 related genes. Nucleic Acids Res 20:5519–5525[Abstract/Free Full Text]
  50. Bouwman P, Philipsen S 2002 Regulation of the activity of Sp1-related transcription factors. Mol Cell Endocrinol 195:27–38[CrossRef][Medline]
  51. Suske G 1999 The Sp-family of transcription factors. Gene 238:291–300[CrossRef][Medline]
  52. Krikun G, Schatz F, Mackman N, Guller S, Demopoulos R, Lockwood CJ 2000 Regulation of tissue factor gene expression in human endometrium by transcription factors Sp1 and Sp3. Mol Endocrinol 14:393–400[Abstract/Free Full Text]
  53. Marin M, Karis A, Visser P, Grosveld F, Philipsen S 1997 Transcription factor Sp1 is essential for early embryonic development but dispensable for cell growth and differentiation. Cell 89:619–628[CrossRef][Medline]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
J. Prast, L. Saleh, H. Husslein, S. Sonderegger, H. Helmer, and M. Knofler
Human Chorionic Gonadotropin Stimulates Trophoblast Invasion through Extracellularly Regulated Kinase and AKT Signaling
Endocrinology, March 1, 2008; 149(3): 979 - 987.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
A.V. Huber, L. Saleh, J. Prast, P. Haslinger, and M. Knofler
Human chorionic gonadotrophin attenuates NF-{kappa}B activation and cytokine expression of endometriotic stromal cells
Mol. Hum. Reprod., August 1, 2007; 13(8): 595 - 604.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
C. Leisser, L. Saleh, S. Haider, H. Husslein, S. Sonderegger, and M. Knofler
Tumour necrosis factor-{alpha} impairs chorionic gonadotrophin {beta}-subunit expression and cell fusion of human villous cytotrophoblast
Mol. Hum. Reprod., October 1, 2006; 12(10): 601 - 609.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
J. Pollheimer, T. Loregger, S. Sonderegger, L. Saleh, S. Bauer, M. Bilban, K. Czerwenka, P. Husslein, and M. Knofler
Activation of the Canonical Wingless/T-Cell Factor Signaling Pathway Promotes Invasive Differentiation of Human Trophoblast
Am. J. Pathol., April 1, 2006; 168(4): 1134 - 1147.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
K. Rull and M. Laan
Expression of {beta}-subunit of HCG genes during normal and failed pregnancy
Hum. Reprod., December 1, 2005; 20(12): 3360 - 3368.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
E. D. Johnstone, C. P. Sibley, B. Lowen, and L. J. Guilbert
Epidermal Growth Factor Stimulation of Trophoblast Differentiation Requires MAPK11/14 (p38 MAP Kinase) Activation
Biol Reprod, December 1, 2005; 73(6): 1282 - 1288.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
E. D. Johnstone, G. Chan, C. P. Sibley, S. T. Davidge, B. Lowen, and L. J. Guilbert
Sphingosine-1-phosphate inhibition of placental trophoblast differentiation through a Gi-coupled receptor response
J. Lipid Res., September 1, 2005; 46(9): 1833 - 1839.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/4/1685    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted