| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Endocrinology (B.C., C.P., J.G., A-F. B., F.M.-J.), Institut National de la Santé et de la Recherche Médicale, Unité 567-Centre National de la Recherche Scientifique (CNRS), Unité Mixte de Recherche (UMR) 8104, Cochin Institute, Paris 75014, France; Department of Endocrinology and Diabetes (P.B., F.M.-J.), Department of Hormonal Biochemistry and University of Paris VII School of Medicine, Saint-Louis Hospital, Paris 75010, France; CNRS-UMR 5018 (R.B.), Paul Sabatier University, Toulouse 31062, France; and Research Division (C.R.K.), Joslin Diabetes Center, Department of Medicine, Harvard Medical School, Boston, Massachusetts 02215
Address all correspondence and requests for reprints to: Franck Mauvais-Jarvis, M.D., Ph.D., Department of Medicine, Division of Diabetes, Endocrinology & Metabolism, Baylor College of Medicine, Room 520B, Houston, Texas 77030. E-mail: fmjarvis{at}bcm.tmc.edu.
| Abstract |
|---|
|
|
|---|
(C/EBP-
) (P < 0.05). There is a 39.5% increase in serum adiponectin (P < 0.01) without modification in serum leptin, resistin, and TNF-
. In conclusion, the MIRKO mouse displays muscle insulin resistance, visceral obesity, and dyslipidemia but does not develop hyperinsulinemia or diabetes. There is an accelerated differentiation of small insulin sensitive adipocytes, an increased secretion of the insulin sensitizer adiponectin, and maintenance of leptin sensitivity. The MIRKO mouse confirms the importance of WAT plasticity in the maintenance of whole body insulin sensitivity and represents an interesting model to search for new secreted molecules that positively alter adipose tissue biology. | Introduction |
|---|
|
|
|---|
To get insight into the potential antidiabetic role of adiposity in MIRKO, we have studied insulin action in WAT during a euglycemic, hyperinsulinemic clamp, and we have characterized the morphology and biology of WAT. We find that MIRKO mice develop adipocyte hyperplasia with increased expression of CCAAT enhancer binding protein (C/EBP)-
and increased secretion of adiponectin. The leptin sensitivity is maintained, and there is no alteration in insulin action in WAT or in expression level of the major adipogenic genes.
| Materials and Methods |
|---|
|
|
|---|
Metabolic studies
Glucose tolerance tests (GTT) and corresponding area under the curve for glucose (minus basal) were respectively performed and calculated as previously described (3). For blood glucose determination, blood samples were obtained from mouse tails and veinous blood glucose levels were determined using an automatic glucose monitor (Glucotrend 2, Roche Diagnostics, Meylan, France) as previously described (3). For determination of hormone levels, blood samples were obtained by retro-orbital bleeds from overnight fasted anesthetized mice [ip injection of a 1:1 (wt/vol) mixture of 2,2,2-tribromoethanol and ter-amyl alcohol; 0.015 ml/g body weight]. Insulin and leptin levels were measured in serum by ELISA using mouse standards (Crystal Chem Inc., Chicago, IL). Adiponectin and TNF-
levels were determined in serum by RIA (Linco, St. Charles, MO) and ELISA (Biosource International, Camarillo, CA), respectively, using mouse standards. Resistin measurements were semiquantitative with an antibody kindly provided by Mitchel A. Lazar (University of Pennsylvania School of Medicine, Philadelphia, PA).
In vivo insulin stimulation and analysis of insulin signaling proteins in fat
Euglycemic hyperinsulinemic clamp studies were performed on 4-month-old male mice as previously described (4). Briefly, a catheter was indwelled into the femoral vein under anesthesia, and the mice were allowed to recover for 46 d. On the day of the experiment, mice were fasted for 6 h. Insulin was infused at a rate of 18 mU/kg·min for 3 h, whereas euglycemia was maintained by periodically adjusting a variable infusion of 16.5% glucose to allow measurement of glucose infusion rate. Throughout the infusion, blood glucose was assessed from blood samples collected from the tip of the tail vein when needed (every 10 min during the last hour of the infusion) using a blood glucose meter. In addition, mice were continuously infused through the femoral vein with HPLC purified D-(3H)3-glucose (NEN Life Science Products, Boston, MA) at a rate of 30 µCi/kg·min. Plasma D-(3H)3-glucose concentration was determined in 5 µl of blood sampled from the tip of the tail vein every 10 min during the last hour of the infusion as described (4).
At time 180 min, a blood sample was obtained for determination of the plasma insulin concentration and the mice were euthanized. Epididymal fat pads were removed and instantly frozen in liquid nitrogen. Immunoprecipitations and Western blot analyses of insulin signaling molecules were performed on fat homogenates as previously described (5).
Antibodies
Rabbit polyclonal anti-IR antibodies (
IR) were purchased from Transduction Laboratories (Lexington, KY). Rabbit polyclonal anti-IR substrate (IRS)-1 antibodies (
IRS-1) were generated against a glutathione-S-transferase (GST)-fusion protein corresponding to amino acids 859-1233 of mouse IRS-1 at the Joslin Diabetes Center. Mouse monoclonal anti-phosphotyrosine antibodies (4G10,
PY) and rabbit polyclonal anti-CAP (
CAP) antibodies were purchased from Upstate Biotechnology (Lake Placid, NY). Rabbit polyclonal anti-p85 antibodies (
p85) which recognize all variants of p85 were purchased from Upstate Biotechnology. Goat polyclonal anti-Akt antibodies (
Akt) that recognize human Akt1, anti-hexokinase (HK)-1 (
HK1),
HK2, and anti-Cbl antibodies (
Cbl) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal phospho-Akt (Ser 473) and phospho-AMP-activated protein kinase (AMPK) (Thre-172), antibodies were purchased from Cell Signaling (Beverly, MA). Rabbit polyclonal anti-GLUT (glucose transporters)-1 (
GLUT1) and anti-GLUT4 (
GLUT4) antibodies were purchased from Chemicon (Temecula, CA).
Phosphoinositide 3-kinase (PI 3-kinase) assay
PI 3-kinase activities in fat were determined in immunoprecipitates with the PY antibodies (4G10) in the basal state and after insulin stimulation as previously described (5). Briefly, immunoprecipitates were washed twice with PI 3-kinase reaction buffer [20 mM Tris-HCl (pH 7.4), 100 nM NaCl, and 0.5 mM EGTA], and resuspended in 50 µl of PI 3-kinase reaction buffer containing 0.1 mg/ml PI (Avanti Polar Lipids, Alabaster, AL). The reactions were initiated by adding 5 µl of MgCl2-ATP mixture (200 mM MgCl2, 200 µM ATP) containing 5 µCi of [
-32P]-ATP to the reaction mixture, followed by incubation at 25 C for 20 min, and terminated by adding 150 µl of chloroform-methanol-11.6 N HCl (100:200:2). After adding 120 µl of chloroform to each sample, the organic phase was separated by centrifugation and washed twice with methanol-1 N HCl (1:1). After evaporation, the pellets were resuspended in 20 µl of chloroform-methanol-28% ammonium hydroxide-water (43:38:5:7) and separated on a thin-layer chromatography plate. The phosphorylated lipids were visualized by autoradiography.
Akt kinase assay
Akt kinase activities were determined in the basal state and after insulin stimulation in immunoprecipitates with
Akt antibody in an immunocomplex kinase assay as previously described (5). Briefly, immunoprecipitates were washed twice and resuspended in 40 µl of 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 1 mM dithiothreitol to which 50 µM ATP, 5 µCi [32P]
-ATP, and 1 µg of crosstide were added to start the reaction. After 20 min at 30 C, the reaction was stopped and aliquots were spotted on squares of P-81 paper, washed with 0.5% phosphoric acid, and counted in a scintillation counter.
Morphology of adipose tissue
Paraffin-embedded sections of epididymal fat pad were stained with hematoxylin and eosin. Photomicrographs were captured with Olympus BH2 (Rungis, France) at x20 magnification. Cell size was measured under the same microscope at x10 magnification with a scale of 5 µm per unit of graduation. The diameter of 20 cells in two different microscopic field was determined in fat pads from each mouse.
Total DNA content from adipose tissue
Fat pads were resected, weighed, and immediately frozen in liquid nitrogen. About 100 mg of tissue were homogenized, and genomic DNA was extracted using TriReagent (Molecular Research Center, Cincinnati, OH) as described by the manufacturer. DNA was measured by spectrophotometric method and total DNA content from fat pads was determined by multiplying DNA concentration in each sample by the total fat pad weight for each mouse.
Gene expression studies
Total RNA from 50150 mg of white adipose from control and MIRKO mice was isolated using RNeasy extraction kit (QIAGEN, Valencia, CA) as described by the manufacturer. cDNA was synthesized from 500 ng of total RNA in final volume of 20 µl using random hexamers (Promega, Madison, WI) and 100 U of superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Real-time quantitative RT-PCR were performed using the following primers: adiponectin, (5':CAATCTGGAGGTGGGAGA, 3': CTCCTGGTGTATGGGCTAT), fatty acid synthase (FAS), (5':ACTCAATACACAGGCTGCTG; 3': GTCAGGATGGCCCTGCAT); peroxisome proliferator-activated receptor
(PPAR
) (5': CGAGGACATCCAAGACAAC, 3': GTGCTCTGTGACGATCTGC); sterol regulatory element binding protein (SREBP)-1c (5': TTGAAGACATGCTTCTTCAGCTC, 3': GCCTGTGTCTCCTGTCTCA); C/EBP-
(5': CCGGGAGAACTCTAACTC, 3': GATGTAGGCGCTGATGT); cyclophilin (5': ATGGCACTGGTGGCAAGTCC; 3': TTGCCATTCCGGGACGGTAA). We used 50 ng of reverse-transcribed total RNA (diluted in 5 µl of 1x SYBR Green buffer), with a 200 nM concentration of both sense and antisense primers in a final volume of 25 µl using the SYBR Green PCR core reagents (Roche Molecular Biochemicals, Indianapolis, IN). Samples were incubated in the light cycler instrument (Roche Molecular Biomedicals) for an initial denaturation at 95 C for 10 min, followed by 40 cycles. Each cycle consisted of 95 C for 15 sec, 58 C for 7 sec, and 72 C for 15 sec. Green I fluorescence emission was determined after each cycle. The relative amount of each mRNA was quantified by using the second derivative maximum method of the light cycler software. Amplification of specific transcripts was confirmed by melting curves profiles generated at the end of each run. PCR specificity and product length were further checked by agarose gel electrophoresis and ethidium bromide staining. Cyclophilin was used as an invariant control for each study and the relative quantification for a given gene was corrected for the cyclophilin mRNA values.
Statistical analysis
Results are presented as mean ± SE or SD as specified in figures. All statistical analyses were performed using the unpaired Students t test. P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Study of insulin action in WAT during euglycemic hyperinsulinemic clamp
We explored insulin action in vivo, in epididymal fat pad from 4-month-old mice after a 3-h euglycemic, hyperinsulinemic clamp. As previously described (2), MIRKO mice show a decrease in whole body glucose utilization consistent with skeletal muscle insulin resistance (data not shown). Neither the IR and IRS-1 phosphorylation or expression (Fig. 1
, A and B) nor the IRS-1 binding to the p85 regulatory subunit of PI 3-kinase (Fig. 1C
) were affected in WAT from MIRKO mice compared with controls. A moderate decrease in the amount of p85 protein improves insulin sensitivity (5), but using an antibody which recognizes p85
and its isoforms, we did not detect any difference in the expression of the regulatory subunits of PI 3-kinase in WAT (Fig. 1D
). In addition, PI 3-kinase activity associated with tyrosine-phosphorylated proteins during the clamp experiment was similar in adipose tissue from control and MIRKO mice (Fig. 1E
). Akt is a Ser/Thr kinase downstream of PI 3-kinase that is phosphorylated and activated upon insulin stimulation and is believed to mediate several metabolic actions of insulin (6). In adipose tissue, the effect of insulin on Akt activity was weak, and no modification of Akt activity (Fig. 1F
) or phosphorylation (data not shown) was detected in MIRKO compared with controls.
|
|
1- or
2-isoforms of AMPK (data not shown) or in the level of phosphorylation during clamp and under fed conditions (Fig 2D
Morphology and function of WAT in MIRKO mice
To get insight into the mechanisms of increased glucose transport and fat mass in MIRKO mice, we studied adipose tissue morphology and biology. Increased adiposity can result from increased cell number (hyperplasia) or increased cell size (hypertrophy). Adipocyte size was studied on paraffin-embedded sections of WAT after hematoxylin and eosin staining. With regard to epididymal fat, we did not detect any significant difference in adipocyte size between MIRKO and control mice (Fig. 3
, A and B). However, as previously described (1, 3) we observed a 53% increase in epididymal fat pad weight in MIRKO mice (Fig. 3C
). The increased fat mass from a given fat pad was accompanied by a 48% increase in total DNA content, which is consistent with an increased number of adipocytes in MIRKO compared with controls (Fig. 3D
). The differentiation of new adipocytes between skeletal muscle fibers was also studied in sections from skeletal muscle of MIRKO mice, but we did not detect any increase in adipocyte size between muscle fibers compared with controls (data not shown).
|
and resistin (semiquantitative measurement, data not shown), which negatively modulate insulin sensitivity, were not significantly modified (Table 1
|
|
gene expression (P = 0.047), without increased PPAR
mRNA levels. There was no significant increase in lipogenic gene expression such as FAS or in the transcriptional factor regulating its expression, SREBP-1c (Fig. 4B| Discussion |
|---|
|
|
|---|
Diet-induced obesity usually results from a hypertrophy of pre-existing adipocytes followed, when cell size reaches a specific threshold, by a phase of cellular expansion during which new fat cells are recruited from the preadipocyte population (11, 12). Here, we show that the increased adiposity in MIRKO mice results from adipocyte hyperplasia, with individual adipocytes reaching the same size as in control mice and without increase in expression of the major lipogenic genes, i.e. leading to de novo triglyceride synthesis from glucose: PPAR
, SREBP-1c, and FAS. Thus, unlike in the case of diet-induced obesity, the increased adiposity observed in MIRKO mice does not result from hypertrophy of pre-existing adipocytes leading to enlarged insulin-resistant cells, but rather to the recruitment/differentiation of new small insulin-sensitive adipocytes. This is consistent with the finding that insulin sensitivity is increased in WAT from MIRKO mice during euglycemic hyperinsulinemic clamp conditions (2), and this explains why WAT glucose uptake is increased in the postprandial period (3). At the molecular level, MIRKO do not show alteration in the activation of the early steps of two insulin signaling pathways leading to GLUT4 translocation in adipocytes, respectively the IRS-1/PI3-kinase and the CAP/Cbl pathway, and there is no change in expression in molecules involved in glucose uptake such as glucose transporters and HKs. These data do not rule out an alteration in GLUT4 translocation mechanisms in adipocytes located downstream of PI3-kinase and Cbl. However, in vitro glucose uptake in isolated adipocytes is unchanged in MIRKO (2). Thus, the 3-fold increase in insulin-dependent glucose uptake in WAT from MIRKO mice does not appear to be the consequence of an enhanced glucose transport at the individual cell level but rather of an increased cell number with normal individual glucose uptake. Consistent with a 50% increase in fat cells number, MIRKO mice do not develop hyperleptinemia (3) and maintain serum leptin levels similar to those of controls. Indeed, adipose tissue leptin secretion is regulated in part by adipocyte size and hyperleptinemia is more closely associated with adipocyte hypertrophy than with adipose tissue hyperplasia (13). Because the number of adipocytes is increased but leptin levels are normal, this finding also suggests that MIRKO mice display improved leptin sensitivity. Despite the increased fat mass observed in MIRKO mice, serum adiponectin levels are increased by approximately 40%, which is also consistent with the theory of a physiological adiposity composed of young biologically active adipocytes, as opposed to human obesity, which is a normal physiological response to an abnormal environment and characterized by decreased adiponectin secretion. Indeed, adiponectin has been reported to be up-regulated at the early stage of diet-induced obesity when expansion of small adipocytes is active (12) and on the contrary, down-regulated in obesity of long duration and in type 2 diabetes, when adipocytes are hypertrophied (14, 15, 16). A moderate increase in serum adiponectin level is known to display antidiabetic properties by decreasing hepatic glucose production, and by stimulating fatty acid oxidation in insulin sensitive tissues (16, 17, 18). In that sense, adiponectin is believed to protect nonadipose tissues from lipotoxicity (18). Thus, the increased adiponectin levels observed in MIRKO, who display marked elevation in serum triglyceride and FFA levels, may in turn protect muscle and liver tissues from lipotoxicity-induced insulin resistance. Indeed, despite absence of IR in muscle, postprandial glucose uptake is maintained in this tissue (3). In addition, despite the marked increase in serum lipids, liver glycogen synthesis and hepatic glucose production are not altered in MIRKO mice (2, 3), and there is no histological evidence of lipid deposition in MIRKO liver (data not shown). Moreover, when MIRKO mice are crossed with ßIRKO mice, a model of impaired acute-phase insulin release, the resulting double knockouts show improved ß-cell function, and half of these mice are even protected from developing diabetes (3).
The determinants by which insulin resistance in skeletal muscle from MIRKO mice stimulates adipocyte differentiation in WAT are unknown. We looked at expression of the two most central genes involved in adipogenesis: PPAR
and C/EBP-
. We find an average 3-fold increase in mRNA expression of C/EBP-
, without concomitant increase in PPAR
. There is a large variability in C/EBP-
expression in MIRKO mice and the result should be interpreted with caution. Nevertheless, these data suggest that muscle insulin resistance could have stimulated de novo adipogenesis through C/EBP-
. C/EBP-
could in turn activate genes whose products control endogenous PPAR
ligands formation (19). One may also hypothesize that a naturally occurring PPAR
ligand, released by altered muscle metabolism, acts as a PPAR
agonist. Indeed, MIRKO adipose tissue behaves as if treated by synthetic PPAR
ligands of the thiazolidinediones class, that are known to stimulate adipocyte differentiation (20) and to increased adiponectin gene transcription and secretion (21, 22). Potential naturally occurring molecules include the prostaglandin J2 metabolite 15-deoxy-
12,14-PGJ2, which binds directly to PPAR
and promotes efficient differentiation of fibroblasts to adipocytes (23), and the lipid mediator lysophosphatidic acid, which has recently been shown to bind PPAR
and to activate preadipocytes proliferation (24, 25). One limitation of this study is that alterations in gene expression leading to the differentiation of new adipocytes could have occurred early in MIRKO life, and that this pattern could have disappeared in adult MIRKO, when adipocytes have reached the same size as those in controls. Another potential problem is that protein expression have been assessed on total WAT, which also contains vascular, nerve, blood, preadipose cells (probably others), and it is not known how these cells contribute to nonadipose-specific proteins and their expression.
In conclusion, the MIRKO mouse displays muscle insulin resistance, visceral obesity, and dyslipidemia but does not develop hyperinsulinemia or diabetes. There is an increased differentiation of small insulin-sensitive adipocytes with increased secretion of the insulin sensitizer adiponectin, and with maintenance of leptin sensitivity. The MIRKO mouse confirms the importance of WAT plasticity in the maintenance of whole body insulin sensitivity, and represents a model to search for new physiologically secreted molecules that positively alter adipose tissue biology.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: AMPK, AMP-activated protein kinase; C/EBP, CCAAT enhancer binding protein; FAS, fatty acid synthase; FFA, free fatty acids; GLUT, glucose transporters; GTT, glucose tolerance test; HK, hexokinases; IR, insulin receptor; IRS, IR substrate; MIRKO, muscle-specific insulin receptor knockout; PI 3-kinase, phosphoinositide 3-kinase; PPAR
, peroxisome proliferator-activated receptor
(PPAR
); PY, phosphotyrosine; SREBP, sterol regulatory element binding protein; WAT, white adipose tissue.
Received July 15, 2003.
Accepted for publication December 10, 2003.
| References |
|---|
|
|
|---|
subunit of phosphoinositide 3-kinase improves insulin signaling and ameliorates diabetes. J Clin Invest 109:141149[CrossRef][Medline]
activation stimulates expression of the CAP gene. Proc Natl Acad Sci USA 95:1475114756
(PPAR
) deficiency and PPAR
agonist improve insulin resistance. J Biol Chem 276:4124541254
ligands increase expression and plasma concentrations of adiponectin, an adipose-derived protein. Diabetes 50:20942099
agonist. Proc Natl Acad Sci USA 100:131136nomic, and behavioral effects of leptin. Physiol Behav 74:703708This article has been cited by other articles:
![]() |
K. N. Ealey, S. Lu, D. Lau, and M. C. Archer Reduced susceptibility of muscle-specific insulin receptor knockout mice to colon carcinogenesis Am J Physiol Gastrointest Liver Physiol, March 1, 2008; 294(3): G679 - G686. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. J. Leunissen, P. Oosterbeek, L. K. M. Hol, A. A. Hellingman, T. Stijnen, and A. C. S. Hokken-Koelega Fat Mass Accumulation during Childhood Determines Insulin Sensitivity in Early Adulthood J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 445 - 451. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Delibegovic, K. K. Bence, N. Mody, E.-G. Hong, H. J. Ko, J. K. Kim, B. B. Kahn, and B. G. Neel Improved Glucose Homeostasis in Mice with Muscle-Specific Deletion of Protein-Tyrosine Phosphatase 1B Mol. Cell. Biol., November 1, 2007; 27(21): 7727 - 7734. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ranalletta, X. Q. Du, Y. Seki, A. S. Glenn, M. Kruse, A. Fiallo, I. Estrada, T.-S. Tsao, A. E. Stenbit, E. B. Katz, et al. Hepatic response to restoration of GLUT4 in skeletal muscle of GLUT4 null mice Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1178 - E1187. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Serino, R. Menghini, L. Fiorentino, R. Amoruso, A. Mauriello, D. Lauro, P. Sbraccia, M. L. Hribal, R. Lauro, and M. Federici Mice Heterozygous for Tumor Necrosis Factor-{alpha} Converting Enzyme Are Protected From Obesity-Induced Insulin Resistance and Diabetes Diabetes, October 1, 2007; 56(10): 2541 - 2546. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Qiao and J. Shao SIRT1 Regulates Adiponectin Gene Expression through Foxo1-C/Enhancer-binding Protein {alpha} Transcriptional Complex J. Biol. Chem., December 29, 2006; 281(52): 39915 - 39924. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Semple, M. A. Soos, J. Luan, C. S. Mitchell, J. C. Wilson, M. Gurnell, E. K. Cochran, P. Gorden, V. K. K. Chatterjee, N. J. Wareham, et al. Elevated Plasma Adiponectin in Humans with Genetically Defective Insulin Receptors J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3219 - 3223. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Ayala, D. P. Bracy, O. P. McGuinness, and D. H. Wasserman Considerations in the Design of Hyperinsulinemic-Euglycemic Clamps in the Conscious Mouse Diabetes, February 1, 2006; 55(2): 390 - 397. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Pederson, J. M. Schroeder, G. E. Parker, M. W. Smith, A. A. DePaoli-Roach, and P. J. Roach Glucose Metabolism in Mice Lacking Muscle Glycogen Synthase Diabetes, December 1, 2005; 54(12): 3466 - 3473. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Plum, F. T. Wunderlich, S. Baudler, W. Krone, and J. C. Bruning Transgenic and Knockout Mice in Diabetes Research: Novel Insights into Pathophysiology, Limitations, and Perspectives Physiology, June 1, 2005; 20(3): 152 - 161. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |