help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0882
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cariou, B.
Right arrow Articles by Mauvais-Jarvis, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cariou, B.
Right arrow Articles by Mauvais-Jarvis, F.
Endocrinology Vol. 145, No. 4 1926-1932
Copyright © 2004 by The Endocrine Society

Cellular and Molecular Mechanisms of Adipose Tissue Plasticity in Muscle Insulin Receptor Knockout Mice

Bertrand Cariou, Catherine Postic, Philippe Boudou, Rémy Burcelin, C. Ronald Kahn, Jean Girard, Anne-Françoise Burnol and Franck Mauvais-Jarvis

Department of Endocrinology (B.C., C.P., J.G., A-F. B., F.M.-J.), Institut National de la Santé et de la Recherche Médicale, Unité 567-Centre National de la Recherche Scientifique (CNRS), Unité Mixte de Recherche (UMR) 8104, Cochin Institute, Paris 75014, France; Department of Endocrinology and Diabetes (P.B., F.M.-J.), Department of Hormonal Biochemistry and University of Paris VII School of Medicine, Saint-Louis Hospital, Paris 75010, France; CNRS-UMR 5018 (R.B.), Paul Sabatier University, Toulouse 31062, France; and Research Division (C.R.K.), Joslin Diabetes Center, Department of Medicine, Harvard Medical School, Boston, Massachusetts 02215

Address all correspondence and requests for reprints to: Franck Mauvais-Jarvis, M.D., Ph.D., Department of Medicine, Division of Diabetes, Endocrinology & Metabolism, Baylor College of Medicine, Room 520B, Houston, Texas 77030. E-mail: fmjarvis{at}bcm.tmc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
White adipose tissue (WAT) plays a critical role in the development of insulin resistance via secretion of free fatty acids (FFA) and adipocytokines. Muscle-specific insulin receptor knockout (MIRKO) mice do not develop insulin resistance or diabetes under physiological conditions despite a marked increase in adiposity and plasma FFA. On the contrary, WAT of MIRKO is sensitized to insulin action during a euglycemic clamp, and WAT glucose utilization is dramatically increased. To get insight into the potential antidiabetic role of MIRKO adiposity, we have studied insulin action in WAT during a euglycemic, hyperinsulinemic clamp, and we have characterized the morphology and biology of WAT. During the clamp, there is no alteration in the expression or activation in the insulin signaling molecules involved in glucose transport through the phosphoinositide 3-kinase/Akt and CAP/Cbl pathways in WAT from MIRKO. The 53% increase in WAT mass results from a 48% increase in adipocyte number (P < 0.05) without alteration in cell size and contemporary to a 300% increase in mRNA levels of the adipogenic transcription factor CCAAT enhancer binding protein-{alpha} (C/EBP-{alpha}) (P < 0.05). There is a 39.5% increase in serum adiponectin (P < 0.01) without modification in serum leptin, resistin, and TNF-{alpha}. In conclusion, the MIRKO mouse displays muscle insulin resistance, visceral obesity, and dyslipidemia but does not develop hyperinsulinemia or diabetes. There is an accelerated differentiation of small insulin sensitive adipocytes, an increased secretion of the insulin sensitizer adiponectin, and maintenance of leptin sensitivity. The MIRKO mouse confirms the importance of WAT plasticity in the maintenance of whole body insulin sensitivity and represents an interesting model to search for new secreted molecules that positively alter adipose tissue biology.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
WHITE ADIPOSE TISSUE (WAT) plays a critical role in the maintenance of insulin sensitivity and in the development of insulin resistance, through the secretion of modulators of insulin action. Thus, adipocytokines positively or negatively regulate insulin action, whereas free fatty acids (FFA) can accumulate in insulin-sensitive tissues and impair insulin sensitivity. The MIRKO [tissue-specific muscle insulin receptor (IR) knockout] mouse is a unique model for studying the role of adipose tissue in the maintenance of insulin sensitivity and the role of obesity in the development of insulin resistance. MIRKO mice show a severe resistance to insulin action in skeletal muscle both in vitro and in vivo (1, 2), a dramatic increase in total body fat mass, and elevated serum triglyceride and FFA levels. This phenotype is similar to the metabolic syndrome described in humans. However, despite these features typical of type 2 diabetes, these mice do not develop hyperinsulinemia or glucose intolerance (1). During a glucose tolerance test, MIRKO mice show an increased glucose utilization in WAT, which ultimately results in increased fat mass (3). Surprisingly, this phenotype occurs without prior increase in serum glucose or insulin levels in MIRKO mice. Moreover, the WAT of MIRKO is more sensitive to insulin action during euglycemic and hyperinsulinemic clamp conditions, where glucose utilization is dramatically increased (2). Thus, MIRKO mice develop adaptive mechanisms in WAT to compensate for muscle insulin resistance to maintain glucose homeostasis.

To get insight into the potential antidiabetic role of adiposity in MIRKO, we have studied insulin action in WAT during a euglycemic, hyperinsulinemic clamp, and we have characterized the morphology and biology of WAT. We find that MIRKO mice develop adipocyte hyperplasia with increased expression of CCAAT enhancer binding protein (C/EBP)-{alpha} and increased secretion of adiponectin. The leptin sensitivity is maintained, and there is no alteration in insulin action in WAT or in expression level of the major adipogenic genes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Creation of mutant mice and PCR genotyping
Creation of MIRKO mice, i.e. mice homozygous for the IR lox sites, but carrying the MCK-Cre transgene, has been previously described (1). All genotyping was performed by PCR using genomic DNA from tail biopsies of 3-wk-old mice as previously described (1). All mice were housed in colony cages with a 12-h light, 12-h dark cycle. All procedures were carried out according to the French guidelines for the care and use of experimental animals. Mice had free access to water and food and were fed a standard rodent chow (energy intake: 65% carbohydrate, 11% fat, 24% protein; UAR, Paris, France).

Metabolic studies
Glucose tolerance tests (GTT) and corresponding area under the curve for glucose (minus basal) were respectively performed and calculated as previously described (3). For blood glucose determination, blood samples were obtained from mouse tails and veinous blood glucose levels were determined using an automatic glucose monitor (Glucotrend 2, Roche Diagnostics, Meylan, France) as previously described (3). For determination of hormone levels, blood samples were obtained by retro-orbital bleeds from overnight fasted anesthetized mice [ip injection of a 1:1 (wt/vol) mixture of 2,2,2-tribromoethanol and ter-amyl alcohol; 0.015 ml/g body weight]. Insulin and leptin levels were measured in serum by ELISA using mouse standards (Crystal Chem Inc., Chicago, IL). Adiponectin and TNF-{alpha} levels were determined in serum by RIA (Linco, St. Charles, MO) and ELISA (Biosource International, Camarillo, CA), respectively, using mouse standards. Resistin measurements were semiquantitative with an antibody kindly provided by Mitchel A. Lazar (University of Pennsylvania School of Medicine, Philadelphia, PA).

In vivo insulin stimulation and analysis of insulin signaling proteins in fat
Euglycemic hyperinsulinemic clamp studies were performed on 4-month-old male mice as previously described (4). Briefly, a catheter was indwelled into the femoral vein under anesthesia, and the mice were allowed to recover for 4–6 d. On the day of the experiment, mice were fasted for 6 h. Insulin was infused at a rate of 18 mU/kg·min for 3 h, whereas euglycemia was maintained by periodically adjusting a variable infusion of 16.5% glucose to allow measurement of glucose infusion rate. Throughout the infusion, blood glucose was assessed from blood samples collected from the tip of the tail vein when needed (every 10 min during the last hour of the infusion) using a blood glucose meter. In addition, mice were continuously infused through the femoral vein with HPLC purified D-(3H)3-glucose (NEN Life Science Products, Boston, MA) at a rate of 30 µCi/kg·min. Plasma D-(3H)3-glucose concentration was determined in 5 µl of blood sampled from the tip of the tail vein every 10 min during the last hour of the infusion as described (4).

At time 180 min, a blood sample was obtained for determination of the plasma insulin concentration and the mice were euthanized. Epididymal fat pads were removed and instantly frozen in liquid nitrogen. Immunoprecipitations and Western blot analyses of insulin signaling molecules were performed on fat homogenates as previously described (5).

Antibodies
Rabbit polyclonal anti-IR antibodies ({alpha}IR) were purchased from Transduction Laboratories (Lexington, KY). Rabbit polyclonal anti-IR substrate (IRS)-1 antibodies ({alpha}IRS-1) were generated against a glutathione-S-transferase (GST)-fusion protein corresponding to amino acids 859-1233 of mouse IRS-1 at the Joslin Diabetes Center. Mouse monoclonal anti-phosphotyrosine antibodies (4G10, {alpha}PY) and rabbit polyclonal anti-CAP ({alpha}CAP) antibodies were purchased from Upstate Biotechnology (Lake Placid, NY). Rabbit polyclonal anti-p85 antibodies ({alpha}p85) which recognize all variants of p85 were purchased from Upstate Biotechnology. Goat polyclonal anti-Akt antibodies ({alpha}Akt) that recognize human Akt1, anti-hexokinase (HK)-1 ({alpha}HK1), {alpha}HK2, and anti-Cbl antibodies ({alpha}Cbl) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal phospho-Akt (Ser 473) and phospho-AMP-activated protein kinase (AMPK) (Thre-172), antibodies were purchased from Cell Signaling (Beverly, MA). Rabbit polyclonal anti-GLUT (glucose transporters)-1 ({alpha}GLUT1) and anti-GLUT4 ({alpha}GLUT4) antibodies were purchased from Chemicon (Temecula, CA).

Phosphoinositide 3-kinase (PI 3-kinase) assay
PI 3-kinase activities in fat were determined in immunoprecipitates with the PY antibodies (4G10) in the basal state and after insulin stimulation as previously described (5). Briefly, immunoprecipitates were washed twice with PI 3-kinase reaction buffer [20 mM Tris-HCl (pH 7.4), 100 nM NaCl, and 0.5 mM EGTA], and resuspended in 50 µl of PI 3-kinase reaction buffer containing 0.1 mg/ml PI (Avanti Polar Lipids, Alabaster, AL). The reactions were initiated by adding 5 µl of MgCl2-ATP mixture (200 mM MgCl2, 200 µM ATP) containing 5 µCi of [{gamma}-32P]-ATP to the reaction mixture, followed by incubation at 25 C for 20 min, and terminated by adding 150 µl of chloroform-methanol-11.6 N HCl (100:200:2). After adding 120 µl of chloroform to each sample, the organic phase was separated by centrifugation and washed twice with methanol-1 N HCl (1:1). After evaporation, the pellets were resuspended in 20 µl of chloroform-methanol-28% ammonium hydroxide-water (43:38:5:7) and separated on a thin-layer chromatography plate. The phosphorylated lipids were visualized by autoradiography.

Akt kinase assay
Akt kinase activities were determined in the basal state and after insulin stimulation in immunoprecipitates with {alpha}Akt antibody in an immunocomplex kinase assay as previously described (5). Briefly, immunoprecipitates were washed twice and resuspended in 40 µl of 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 1 mM dithiothreitol to which 50 µM ATP, 5 µCi [32P]{gamma}-ATP, and 1 µg of crosstide were added to start the reaction. After 20 min at 30 C, the reaction was stopped and aliquots were spotted on squares of P-81 paper, washed with 0.5% phosphoric acid, and counted in a scintillation counter.

Morphology of adipose tissue
Paraffin-embedded sections of epididymal fat pad were stained with hematoxylin and eosin. Photomicrographs were captured with Olympus BH2 (Rungis, France) at x20 magnification. Cell size was measured under the same microscope at x10 magnification with a scale of 5 µm per unit of graduation. The diameter of 20 cells in two different microscopic field was determined in fat pads from each mouse.

Total DNA content from adipose tissue
Fat pads were resected, weighed, and immediately frozen in liquid nitrogen. About 100 mg of tissue were homogenized, and genomic DNA was extracted using TriReagent (Molecular Research Center, Cincinnati, OH) as described by the manufacturer. DNA was measured by spectrophotometric method and total DNA content from fat pads was determined by multiplying DNA concentration in each sample by the total fat pad weight for each mouse.

Gene expression studies
Total RNA from 50–150 mg of white adipose from control and MIRKO mice was isolated using RNeasy extraction kit (QIAGEN, Valencia, CA) as described by the manufacturer. cDNA was synthesized from 500 ng of total RNA in final volume of 20 µl using random hexamers (Promega, Madison, WI) and 100 U of superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Real-time quantitative RT-PCR were performed using the following primers: adiponectin, (5':CAATCTGGAGGTGGGAGA, 3': CTCCTGGTGTATGGGCTAT), fatty acid synthase (FAS), (5':ACTCAATACACAGGCTGCTG; 3': GTCAGGATGGCCCTGCAT); peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) (5': CGAGGACATCCAAGACAAC, 3': GTGCTCTGTGACGATCTGC); sterol regulatory element binding protein (SREBP)-1c (5': TTGAAGACATGCTTCTTCAGCTC, 3': GCCTGTGTCTCCTGTCTCA); C/EBP-{alpha} (5': CCGGGAGAACTCTAACTC, 3': GATGTAGGCGCTGATGT); cyclophilin (5': ATGGCACTGGTGGCAAGTCC; 3': TTGCCATTCCGGGACGGTAA). We used 50 ng of reverse-transcribed total RNA (diluted in 5 µl of 1x SYBR Green buffer), with a 200 nM concentration of both sense and antisense primers in a final volume of 25 µl using the SYBR Green PCR core reagents (Roche Molecular Biochemicals, Indianapolis, IN). Samples were incubated in the light cycler instrument (Roche Molecular Biomedicals) for an initial denaturation at 95 C for 10 min, followed by 40 cycles. Each cycle consisted of 95 C for 15 sec, 58 C for 7 sec, and 72 C for 15 sec. Green I fluorescence emission was determined after each cycle. The relative amount of each mRNA was quantified by using the second derivative maximum method of the light cycler software. Amplification of specific transcripts was confirmed by melting curves profiles generated at the end of each run. PCR specificity and product length were further checked by agarose gel electrophoresis and ethidium bromide staining. Cyclophilin was used as an invariant control for each study and the relative quantification for a given gene was corrected for the cyclophilin mRNA values.

Statistical analysis
Results are presented as mean ± SE or SD as specified in figures. All statistical analyses were performed using the unpaired Student’s t test. P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we have investigated the mechanisms responsible for increased adiposity in mice with selective insulin resistance in skeletal muscle. As previously reported, MIRKO mice do not develop hyperglycemia in the fasting state (data not shown) or during IP-GTT (2 g/kg). The area under the curve during the GTT (mg/dl·min·1000) at 4 months was 10.9 ± 0.7 for controls (n = 15) and 11.5 ± 0.9 for MIRKO (n = 14; P = 0.09).

Study of insulin action in WAT during euglycemic hyperinsulinemic clamp
We explored insulin action in vivo, in epididymal fat pad from 4-month-old mice after a 3-h euglycemic, hyperinsulinemic clamp. As previously described (2), MIRKO mice show a decrease in whole body glucose utilization consistent with skeletal muscle insulin resistance (data not shown). Neither the IR and IRS-1 phosphorylation or expression (Fig. 1Go, A and B) nor the IRS-1 binding to the p85 regulatory subunit of PI 3-kinase (Fig. 1CGo) were affected in WAT from MIRKO mice compared with controls. A moderate decrease in the amount of p85 protein improves insulin sensitivity (5), but using an antibody which recognizes p85{alpha} and its isoforms, we did not detect any difference in the expression of the regulatory subunits of PI 3-kinase in WAT (Fig. 1DGo). In addition, PI 3-kinase activity associated with tyrosine-phosphorylated proteins during the clamp experiment was similar in adipose tissue from control and MIRKO mice (Fig. 1EGo). Akt is a Ser/Thr kinase downstream of PI 3-kinase that is phosphorylated and activated upon insulin stimulation and is believed to mediate several metabolic actions of insulin (6). In adipose tissue, the effect of insulin on Akt activity was weak, and no modification of Akt activity (Fig. 1FGo) or phosphorylation (data not shown) was detected in MIRKO compared with controls.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1. Insulin signaling in WAT during euglycemic, hyperinsulinemic clamp. Epididymal fat pads from control and MIRKO mice were studied after an overnight fast (-) and after a 3-h clamp (+) as described in Materials and Methods. A, Tyrosine phosphorylation (upper panel) and expression (lower panel) of the IR were determined using lysates from WAT. Proteins were immunoprecipitated with anti-IR antibody (IRß), and blotted with {alpha}PY or IRß. B, Tyrosine phosphorylation (upper panel) and expression (lower panel) of IRS-1 was determined using lysates from WAT. Proteins were immunoprecipitated with {alpha}IRS-1 and blotted with {alpha}PY or {alpha}IRS-1. C, p85 Binding to IRS-1 was determined after stripping and reblotting the blots from experiment B with an anti-p85pan antibody ({alpha}p85pan). D, Expression level of p85 was determined using lysates from WAT by Western blotting with an {alpha}p85pan antibody. Immunoblots were performed in four mice of each condition. For B and C, the mean ± SE expression level (% of controls) is represented. E, Basal and insulin-stimulated PI 3-kinase activity associated with tyrosine-phosphorylated proteins was assessed in WAT lysates after immunoprecipitation with an {alpha}PY antibody as described in Materials and Methods. F, Basal and insulin-stimulated Akt activity was assessed in WAT lysates after immunoprecipitation with {alpha}PKB antibody, in an immune complex kinase assay as described in Materials and Methods. For E and F, results are expressed in percentage of control enzyme activity in the basal state (mean ± SE; n = 3–4 mice of each genotype).

 
In adipocytes, insulin also activates glucose transport by a mechanism involving the proto-oncogene Cbl, which is independent of PI 3-kinase. Upon insulin stimulation, Cbl is recruited to the IR through the adapter CAP and subsequently tyrosine phosphorylated by the IR (7). Localization of the Cbl-CAP complex to lipid rafts in adipocytes generates a pathway that is crucial in the regulation of glucose uptake (8). In addition, CAP expression and Cbl tyrosine phosphorylation both seem to correlate with insulin sensitivity in adipocytes (9). During the clamp experiment, we observed a similar insulin-stimulated tyrosine phosphorylation of Cbl compared with fasting conditions in WAT from both groups of animals (Fig. 2AGo). Similarly, we did not detect any difference in CAP expression (Fig. 2BGo) between MIRKO and control mice. Increased adipose tissue glucose uptake can result from modifications in activity/expression of GLUT and HK. The level of expression of GLUT1 or GLUT4 [data not shown (2)], and HK I, HKII (Fig. 2CGo) was unchanged in WAT from mice of both genotypes.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 2. Fad pads from control and MIRKO mice were studied as described for Fig. 1Go. A, Expression level of CAP was determined using lysates from WAT by Western blotting with an anti-CAP ({alpha}CAP) antibody CAP. B, Basal and insulin-stimulated tyrosine phosphorylation of Cbl were determined using lysates from WAT. Proteins were immunoprecipitated with anti-Cbl antibody ({alpha}Cbl), and blotted with {alpha}PY. C, Expression level of HK1, HK2 were determined using lysates from WAT by Western blotting with specific antibodies against these molecules. D, Activation of AMPK was assessed by the level of Thr phosphorylation of the protein during clamp (upper panel) or fed conditions (lower panel) using lysates from WAT by Western blotting with an anti-Thr-172 antibody ({alpha}Thr172). Immunoblots were performed in four mice of each condition. For B and D, the mean ± SE expression level (percentage of controls) is represented.

 
Modifications in AMPK expression/activity could also possibly modify lipid partitioning in adipocytes because it blocks fatty acid synthesis by phosphorylating acetyl coenzyme A (CoA) carboxylase (10), and thereby could play a role in the increased glucose transport observed in WAT. We did not detect any difference in the expression of the {alpha}1- or {alpha}2-isoforms of AMPK (data not shown) or in the level of phosphorylation during clamp and under fed conditions (Fig 2DGo).

Morphology and function of WAT in MIRKO mice
To get insight into the mechanisms of increased glucose transport and fat mass in MIRKO mice, we studied adipose tissue morphology and biology. Increased adiposity can result from increased cell number (hyperplasia) or increased cell size (hypertrophy). Adipocyte size was studied on paraffin-embedded sections of WAT after hematoxylin and eosin staining. With regard to epididymal fat, we did not detect any significant difference in adipocyte size between MIRKO and control mice (Fig. 3Go, A and B). However, as previously described (1, 3) we observed a 53% increase in epididymal fat pad weight in MIRKO mice (Fig. 3CGo). The increased fat mass from a given fat pad was accompanied by a 48% increase in total DNA content, which is consistent with an increased number of adipocytes in MIRKO compared with controls (Fig. 3DGo). The differentiation of new adipocytes between skeletal muscle fibers was also studied in sections from skeletal muscle of MIRKO mice, but we did not detect any increase in adipocyte size between muscle fibers compared with controls (data not shown).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 3. Morphology of WAT. Epididymal fat pads from 4-month-old male control and MIRKO mice were resected and studied as described in Materials and Methods. A, Adipose cell size (P = 0.16); B, histology. C, Fat pad weight as percentage of total body weight (*, P = 0.023). D, Fat pad cell number per mouse expressed in DNA content (**, P = 0.021). Result are expressed as the mean + SE from mice of each genotype (n = 18–20/group).

 
Adipocytokines play a critical role in the maintenance of whole body insulin sensitivity. In obesity, the hypertrophied adipocytes show dysregulation of adipocytokine secretion, so we next measured serum adipocytokines levels. As previously described (3), leptin levels were not different between MIRKO and control mice (Table 1Go). Serum adiponectin levels were increased by 30% compared with controls (Table 1Go) and were significantly correlated with the increased WAT mass (R = 0.56, P = 0.0021). Because the expression of the adiponectin gene measured by real-time RT-PCR was comparable in MIRKO and control mice (Fig. 4AGo), the increased serum adiponectin reflects the increased cell number. Other cytokine levels like TNF-{alpha} and resistin (semiquantitative measurement, data not shown), which negatively modulate insulin sensitivity, were not significantly modified (Table 1Go).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Serum adipocytokine levels

 


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 4. Expression of genes involved in WAT biology. The expression of adiponectin, FAS, SREBP-1c, PPAR{gamma}, and C/EBP-{alpha} were determined by fluorescent RT-PCR in 4-month-old male control (C) and MIRKO (M) mice in fed conditions. Amplification of total RNA were performed with gene-specific primers, and mRNA levels were normalized to cyclophilin mRNA. Values are mean ± SE from mice of each genotype (n = 18–20 mice/group). *, P = 0.047.

 
Using real-time RT-PCR, we finally studied the expression of the major genes involved in key pathways of adipose metabolism. Concerning the genes involved in adipocyte differentiation, we found a 302% increased in C/EBP-{alpha} gene expression (P = 0.047), without increased PPAR{gamma} mRNA levels. There was no significant increase in lipogenic gene expression such as FAS or in the transcriptional factor regulating its expression, SREBP-1c (Fig. 4BGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The MIRKO mouse is a unique model of selective insulin resistance in skeletal muscle, which maintains near normal glucose tolerance at the expense of a dramatic increase in adiposity secondary to increase in adipose tissue glucose uptake (1, 2, 3). Because this phenomenon is more pronounced during hyperinsulinemic conditions (2), we reasoned that insulin resistance in skeletal muscle could sensitize the adipocytes to insulin action, and we studied insulin action in vivo during hyperinsulinemic conditions. We find that, unlike in the case of type 2 diabetes, MIRKO mice develop a physiological adiposity with positive alterations in adipose morphology and adipocytokine secretion.

Diet-induced obesity usually results from a hypertrophy of pre-existing adipocytes followed, when cell size reaches a specific threshold, by a phase of cellular expansion during which new fat cells are recruited from the preadipocyte population (11, 12). Here, we show that the increased adiposity in MIRKO mice results from adipocyte hyperplasia, with individual adipocytes reaching the same size as in control mice and without increase in expression of the major lipogenic genes, i.e. leading to de novo triglyceride synthesis from glucose: PPAR{gamma}, SREBP-1c, and FAS. Thus, unlike in the case of diet-induced obesity, the increased adiposity observed in MIRKO mice does not result from hypertrophy of pre-existing adipocytes leading to enlarged insulin-resistant cells, but rather to the recruitment/differentiation of new small insulin-sensitive adipocytes. This is consistent with the finding that insulin sensitivity is increased in WAT from MIRKO mice during euglycemic hyperinsulinemic clamp conditions (2), and this explains why WAT glucose uptake is increased in the postprandial period (3). At the molecular level, MIRKO do not show alteration in the activation of the early steps of two insulin signaling pathways leading to GLUT4 translocation in adipocytes, respectively the IRS-1/PI3-kinase and the CAP/Cbl pathway, and there is no change in expression in molecules involved in glucose uptake such as glucose transporters and HKs. These data do not rule out an alteration in GLUT4 translocation mechanisms in adipocytes located downstream of PI3-kinase and Cbl. However, in vitro glucose uptake in isolated adipocytes is unchanged in MIRKO (2). Thus, the 3-fold increase in insulin-dependent glucose uptake in WAT from MIRKO mice does not appear to be the consequence of an enhanced glucose transport at the individual cell level but rather of an increased cell number with normal individual glucose uptake. Consistent with a 50% increase in fat cells number, MIRKO mice do not develop hyperleptinemia (3) and maintain serum leptin levels similar to those of controls. Indeed, adipose tissue leptin secretion is regulated in part by adipocyte size and hyperleptinemia is more closely associated with adipocyte hypertrophy than with adipose tissue hyperplasia (13). Because the number of adipocytes is increased but leptin levels are normal, this finding also suggests that MIRKO mice display improved leptin sensitivity. Despite the increased fat mass observed in MIRKO mice, serum adiponectin levels are increased by approximately 40%, which is also consistent with the theory of a physiological adiposity composed of young biologically active adipocytes, as opposed to human obesity, which is a normal physiological response to an abnormal environment and characterized by decreased adiponectin secretion. Indeed, adiponectin has been reported to be up-regulated at the early stage of diet-induced obesity when expansion of small adipocytes is active (12) and on the contrary, down-regulated in obesity of long duration and in type 2 diabetes, when adipocytes are hypertrophied (14, 15, 16). A moderate increase in serum adiponectin level is known to display antidiabetic properties by decreasing hepatic glucose production, and by stimulating fatty acid oxidation in insulin sensitive tissues (16, 17, 18). In that sense, adiponectin is believed to protect nonadipose tissues from lipotoxicity (18). Thus, the increased adiponectin levels observed in MIRKO, who display marked elevation in serum triglyceride and FFA levels, may in turn protect muscle and liver tissues from lipotoxicity-induced insulin resistance. Indeed, despite absence of IR in muscle, postprandial glucose uptake is maintained in this tissue (3). In addition, despite the marked increase in serum lipids, liver glycogen synthesis and hepatic glucose production are not altered in MIRKO mice (2, 3), and there is no histological evidence of lipid deposition in MIRKO liver (data not shown). Moreover, when MIRKO mice are crossed with ßIRKO mice, a model of impaired acute-phase insulin release, the resulting double knockouts show improved ß-cell function, and half of these mice are even protected from developing diabetes (3).

The determinants by which insulin resistance in skeletal muscle from MIRKO mice stimulates adipocyte differentiation in WAT are unknown. We looked at expression of the two most central genes involved in adipogenesis: PPAR{gamma} and C/EBP-{alpha}. We find an average 3-fold increase in mRNA expression of C/EBP-{alpha}, without concomitant increase in PPAR{gamma}. There is a large variability in C/EBP-{alpha} expression in MIRKO mice and the result should be interpreted with caution. Nevertheless, these data suggest that muscle insulin resistance could have stimulated de novo adipogenesis through C/EBP-{alpha}. C/EBP-{alpha} could in turn activate genes whose products control endogenous PPAR{gamma} ligands formation (19). One may also hypothesize that a naturally occurring PPAR{gamma} ligand, released by altered muscle metabolism, acts as a PPAR{gamma} agonist. Indeed, MIRKO adipose tissue behaves as if treated by synthetic PPAR{gamma} ligands of the thiazolidinediones class, that are known to stimulate adipocyte differentiation (20) and to increased adiponectin gene transcription and secretion (21, 22). Potential naturally occurring molecules include the prostaglandin J2 metabolite 15-deoxy-{delta} 12,14-PGJ2, which binds directly to PPAR{gamma} and promotes efficient differentiation of fibroblasts to adipocytes (23), and the lipid mediator lysophosphatidic acid, which has recently been shown to bind PPAR{gamma} and to activate preadipocytes proliferation (24, 25). One limitation of this study is that alterations in gene expression leading to the differentiation of new adipocytes could have occurred early in MIRKO life, and that this pattern could have disappeared in adult MIRKO, when adipocytes have reached the same size as those in controls. Another potential problem is that protein expression have been assessed on total WAT, which also contains vascular, nerve, blood, preadipose cells (probably others), and it is not known how these cells contribute to nonadipose-specific proteins and their expression.

In conclusion, the MIRKO mouse displays muscle insulin resistance, visceral obesity, and dyslipidemia but does not develop hyperinsulinemia or diabetes. There is an increased differentiation of small insulin-sensitive adipocytes with increased secretion of the insulin sensitizer adiponectin, and with maintenance of leptin sensitivity. The MIRKO mouse confirms the importance of WAT plasticity in the maintenance of whole body insulin sensitivity, and represents a model to search for new physiologically secreted molecules that positively alter adipose tissue biology.


    Acknowledgments
 
We thank Fadila Rayah for technical assistance and Nathalie Marchand for animal husbandry.


    Footnotes
 
This work was supported by an unrestricted grant from the French Diabetes Association and Merck Laboratories, France (ALFEDIAM/2000) (to F.M.J.).

Abbreviations: AMPK, AMP-activated protein kinase; C/EBP, CCAAT enhancer binding protein; FAS, fatty acid synthase; FFA, free fatty acids; GLUT, glucose transporters; GTT, glucose tolerance test; HK, hexokinases; IR, insulin receptor; IRS, IR substrate; MIRKO, muscle-specific insulin receptor knockout; PI 3-kinase, phosphoinositide 3-kinase; PPAR{gamma}, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}); PY, phosphotyrosine; SREBP, sterol regulatory element binding protein; WAT, white adipose tissue.

Received July 15, 2003.

Accepted for publication December 10, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bruning JC, Michael MD, Winnay JN, Hayashi T, Horsch D, Accili D, Goodyear LJ, Kahn CR 1998 A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell 2:559–569[CrossRef][Medline]
  2. Kim JK, Michael MD, Previs SF, Peroni OD, Mauvais-Jarvis F, Neschen S, Kahn BB, Kahn CR, Shulman GI 2000 Redistribution of substrates to adipose tissue promotes obesity in mice with selective insulin resistance in muscle. J Clin Invest 105:1791–1797[Medline]
  3. Mauvais-Jarvis F, Virkamaki A, Michael MD, Winnay JN, Zisman A, Kulkarni RN, Kahn CR 2000 A model to explore the interaction between muscle insulin resistance and ß-cell dysfunction in the development of type 2 diabetes. Diabetes 49:2126–2134[Abstract/Free Full Text]
  4. Burcelin R, Crivelli V, Dacosta A, Roy-Tirelli A, Thorens B 2002 Heterogeneous metabolic adaptation of C57BL/6J mice to high-fat diet. Am J Physiol Endocrinol Metab 282:E834–E842
  5. Mauvais-Jarvis F, Ueki K, Fruman DA, Hirshman MF, Sakamoto K, Goodyear LJ, Iannacone M, Accili D, Cantley LC, Kahn CR 2002 Reduced expression of the murine p85{alpha} subunit of phosphoinositide 3-kinase improves insulin signaling and ameliorates diabetes. J Clin Invest 109:141–149[CrossRef][Medline]
  6. Coffer PJ, Jin J, Woodgett JR 1998 Protein kinase B (c-Akt): a multifunctional mediator of phosphatidylinositol 3-kinase activation. Biochem J 335:1–13
  7. Ribon V, Saltiel AR 1997 Insulin stimulates tyrosine phosphorylation of the proto-oncogene product of c-Cbl in 3T3–L1 adipocytes. Biochem J 324:839–845
  8. Baumann CA, Ribon V, Kanzaki M, Thurmond DC, Mora S, Shigematsu S, Bickel PE, Pessin JE, Saltiel AR 2000 CAP defines a second signalling pathway required for insulin-stimulated glucose transport. Nature 407:202–207[CrossRef][Medline]
  9. Ribon V, Johnson JH, Camp HS, Saltiel AR 1998 Thiazolidinediones and insulin resistance: peroxisome proliferator activated receptor {gamma} activation stimulates expression of the CAP gene. Proc Natl Acad Sci USA 95:14751–14756[Abstract/Free Full Text]
  10. Winder WW, Hardie DG 1999 AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes. Am J Physiol 277:E1–E10
  11. Faust IM, Johnson PR, Stern JS, Hirsch J 1978 Diet-induced adipocyte number increase in adult rats: a new model of obesity. Am J Physiol 235:E279–E286
  12. Li J, Yu X, Pan W, Unger RH 2002 Gene expression profile of rat adipose tissue at the onset of high-fat-diet obesity. Am J Physiol Endocrinol Metab 282:E1334–E1341
  13. Couillard C, Mauriege P, Imbeault P, Prud’homme D, Nadeau A, Tremblay A, Bouchard C, Despres JP 2000 Hyperleptinemia is more closely associated with adipose cell hypertrophy than with adipose tissue hyperplasia. Int J Obes Relat Metab Disord 24:782–788[CrossRef][Medline]
  14. Hu E, Liang P, Spiegelman BM 1996 AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem 271:10697–10703[Abstract/Free Full Text]
  15. Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, Hotta K, Shimomura I, Nakamura T, Miyaoka K, Kuriyama H, Nishida M, Yamashita S, Okubo K, Matsubara K, Muraguchi M, Ohmoto Y, Funahashi T, Matsuzawa Y 1999 Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun 257:79–83[CrossRef][Medline]
  16. Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, Bihain BE, Lodish HF 2001 Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci USA 98:2005–2010[Abstract/Free Full Text]
  17. Combs TP, Berg AH, Obici S, Scherer PE, Rossetti L 2001 Endogenous glucose production is inhibited by the adipose-derived protein Acrp30. J Clin Invest 108:1875–1881[CrossRef][Medline]
  18. Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T, Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O, Vinson C, Reitman ML, Kagechika H, Shudo K, Yoda M, Nakano Y, Tobe K, Nagai R, Kimura S, Tomita M, Froguel P, Kadowaki T 2001 The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 7:941–946[CrossRef][Medline]
  19. Spiegelman BM, Flier JS 1996 Adipogenesis and obesity: rounding out the big picture. Cell 87:377–389[CrossRef][Medline]
  20. Hallakou S, Doare L, Foufelle F, Kergoat M, Guerre-Millo M, Berthault MF, Dugail I, Morin J, Auwerx J, Ferre P 1997 Pioglitazone induces in vivo adipocyte differentiation in the obese Zucker fa/fa rat. Diabetes 46:1393–1399[Abstract]
  21. Yamauchi T, Kamon J, Waki H, Murakami K, Motojima K, Komeda K, Ide T, Kubota N, Terauchi Y, Tobe K, Miki H, Tsuchida A, Akanuma Y, Nagai R, Kimura S, Kadowaki T 2001 The mechanisms by which both heterozygous peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) deficiency and PPAR{gamma} agonist improve insulin resistance. J Biol Chem 276:41245–41254[Abstract/Free Full Text]
  22. Maeda N, Takahashi M, Funahashi T, Kihara S, Nishizawa H, Kishida K, Nagaretani H, Matsuda M, Komuro R, Ouchi N, Kuriyama H, Hotta K, Nakamura T, Shimomura I, Matsuzawa Y 2001 PPAR{gamma} ligands increase expression and plasma concentrations of adiponectin, an adipose-derived protein. Diabetes 50:2094–2099[Abstract/Free Full Text]
  23. Kliewer SA, Lenhard JM, Willson TM, Patel I, Morris DC, Lehmann JM 1995 A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor gamma and promotes adipocyte differentiation. Cell 83:813–819[CrossRef][Medline]
  24. Ferry G, Tellier E, Try A, Gres S, Naime I, Simon MF, Rodriguez M, Boucher J, Tack I, Gesta S, Chomarat P, Dieu M, Raes M, Galizzi JP, Valet P, Boutin JA, Saulnier-Blache JS 2003 Autotaxin is released from adipocytes, catalyzes lysophosphatidic acid synthesis, and activates preadipocyte proliferation. Up-regulated expression with adipocyte differentiation and obesity. J Biol Chem 278:18162–18169[Abstract/Free Full Text]
  25. McIntyre TM, Pontsler AV, Silva AR, St Hilaire A, Xu Y, Hinshaw JC, Zimmerman GA, Hama K, Aoki J, Arai H, Prestwich GD 2003 Identification of an intracellular receptor for lysophosphatidic acid (LPA): LPA is a transcellular PPAR{gamma} agonist. Proc Natl Acad Sci USA 100:131–136nomic, and behavioral effects of leptin. Physiol Behav 74:703–708



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. N. Ealey, S. Lu, D. Lau, and M. C. Archer
Reduced susceptibility of muscle-specific insulin receptor knockout mice to colon carcinogenesis
Am J Physiol Gastrointest Liver Physiol, March 1, 2008; 294(3): G679 - G686.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. W. J. Leunissen, P. Oosterbeek, L. K. M. Hol, A. A. Hellingman, T. Stijnen, and A. C. S. Hokken-Koelega
Fat Mass Accumulation during Childhood Determines Insulin Sensitivity in Early Adulthood
J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 445 - 451.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Delibegovic, K. K. Bence, N. Mody, E.-G. Hong, H. J. Ko, J. K. Kim, B. B. Kahn, and B. G. Neel
Improved Glucose Homeostasis in Mice with Muscle-Specific Deletion of Protein-Tyrosine Phosphatase 1B
Mol. Cell. Biol., November 1, 2007; 27(21): 7727 - 7734.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Ranalletta, X. Q. Du, Y. Seki, A. S. Glenn, M. Kruse, A. Fiallo, I. Estrada, T.-S. Tsao, A. E. Stenbit, E. B. Katz, et al.
Hepatic response to restoration of GLUT4 in skeletal muscle of GLUT4 null mice
Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1178 - E1187.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Serino, R. Menghini, L. Fiorentino, R. Amoruso, A. Mauriello, D. Lauro, P. Sbraccia, M. L. Hribal, R. Lauro, and M. Federici
Mice Heterozygous for Tumor Necrosis Factor-{alpha} Converting Enzyme Are Protected From Obesity-Induced Insulin Resistance and Diabetes
Diabetes, October 1, 2007; 56(10): 2541 - 2546.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Qiao and J. Shao
SIRT1 Regulates Adiponectin Gene Expression through Foxo1-C/Enhancer-binding Protein {alpha} Transcriptional Complex
J. Biol. Chem., December 29, 2006; 281(52): 39915 - 39924.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. K. Semple, M. A. Soos, J. Luan, C. S. Mitchell, J. C. Wilson, M. Gurnell, E. K. Cochran, P. Gorden, V. K. K. Chatterjee, N. J. Wareham, et al.
Elevated Plasma Adiponectin in Humans with Genetically Defective Insulin Receptors
J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3219 - 3223.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. E. Ayala, D. P. Bracy, O. P. McGuinness, and D. H. Wasserman
Considerations in the Design of Hyperinsulinemic-Euglycemic Clamps in the Conscious Mouse
Diabetes, February 1, 2006; 55(2): 390 - 397.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
B. A. Pederson, J. M. Schroeder, G. E. Parker, M. W. Smith, A. A. DePaoli-Roach, and P. J. Roach
Glucose Metabolism in Mice Lacking Muscle Glycogen Synthase
Diabetes, December 1, 2005; 54(12): 3466 - 3473.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
L. Plum, F. T. Wunderlich, S. Baudler, W. Krone, and J. C. Bruning
Transgenic and Knockout Mice in Diabetes Research: Novel Insights into Pathophysiology, Limitations, and Perspectives
Physiology, June 1, 2005; 20(3): 152 - 161.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cariou, B.
Right arrow Articles by Mauvais-Jarvis, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cariou, B.
Right arrow Articles by Mauvais-Jarvis, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals