Endocrinology, doi:10.1210/en.2003-0874
Endocrinology Vol. 145, No. 4 1972-1979
Copyright © 2004 by The Endocrine Society
Female-Predominant Expression of Fatty Acid Translocase/CD36 in Rat and Human Liver
Nina Ståhlberg,
Elizabeth Rico-Bautista,
Rachel M. Fisher,
Xuxia Wu,
Louisa Cheung,
Amilcar Flores-Morales,
Gunnel Tybring,
Gunnar Norstedt and
Petra Tollet-Egnell
Department of Molecular Medicine (N.S., E.R.-B., X.W., L.C., A.F.-M., G.N., P.T.-E.), and Atherosclerosis Research Unit, King Gustaf V Research Institute (R.M.F.), Karolinska Hospital, Karolinska Institute, SE-171 76 Stockholm, Sweden; and Department of Laboratory Medicine, Division of Clinical Pharmacology, Huddinge University Hospital, Karolinska Institute (G.T.), SE-141 86 Stockholm, Sweden
Address all correspondence and requests for reprints to: Dr. Nina Ståhlberg, Karolinska Institute, Department of Molecular Medicine, CMM L8:01, Karolinska Hospital, 171 76 Stockholm, Sweden. E-mail: nina.stahlberg{at}cmm.ki.se.
 |
Abstract
|
|---|
The aim of this study was to identify genes for hepatic fuel metabolism with a gender-differentiated expression and to determine which of these that might be regulated by the female-specific secretion of GH. Effects of gender and continuous infusion of GH to male rats were studied in the liver using cDNA microarrays representing 3200 genes. Sixty-nine transcripts displayed higher expression levels in females, and 177 displayed higher expression in males. The portion of GH-regulated genes was the same (30%) within the two groups of gender-specific genes. The male liver had a higher expression of genes involved in fuel metabolism, indicating that male rats might have a greater capacity for high metabolic turnover, compared with females. Most notable among the female-predominant transcripts was fatty acid translocase/CD36, with 18-fold higher mRNA levels in the female liver and 4-fold higher mRNA levels in males treated with GH, compared with untreated males. This gender-differentiated expression was confirmed at mRNA and protein levels in the rat and at the mRNA level in human livers. Although purely speculative, it is possible that higher levels of fatty acid translocase/CD36 in human female liver might contribute to the sexually dimorphic development of diseases resulting from or characterized by disturbances in lipid metabolism, such as arteriosclerosis, hyperlipidemia, and insulin resistance.
 |
Introduction
|
|---|
IT IS WELL known that the body composition differs between the sexes, and there is also increasing evidence that fuel metabolism differs between genders (1, 2, 3). It is therefore likely that tissues from male and female individuals have different metabolic functions and that genes from different metabolic pathways are expressed in a sex-specific manner. Hepatic sex differences at the level of gene expression have previously been demonstrated and shown to be regulated by different hormones (4), including sex steroids and peptide hormones. One hormone in the latter category is GH. The existence of a sexually dimorphic pattern of GH secretion was first described in the rat (5), but has also been demonstrated in other species, including humans (6). In adult male rats, GH is secreted in episodic bursts at 3- to 4-h intervals, with low or undetectable levels between peaks, whereas females have a more continuous pattern of secretion. In rodents, biological effects of this sexually differentiated pattern of GH secretion includes sex differences in body weight gain and longitudinal bone growth (7), but also hepatic steroid metabolism (4). We have recently demonstrated that episodic (male pattern) GH treatment of old male rats repress the expression of hepatic gene products involved in lipogenesis and induce genes for fatty acid oxidation (7A ). In a related study, old male rats were treated by continuous (female pattern) infusion of GH (8). Interestingly, these different types of GH treatment induced opposite changes in the same set of genes. This implies that previously reported gender-related effects of GH, such as body growth, might include a sexually dimorphic metabolism of lipids.
Gender differences are also seen in the manifestations of different disorders, some of which may have links to sex-specific liver functions. The male predominance of the metabolic syndrome is well established, and men have an earlier onset and a higher incidence of coronary heart disease (9). The sexually dimorphic development of lipid-related disorders motivates investigations that seek to clarify gender differences in the physiology and pathophysiology of the liver. Generating sex-specific transcript profiles should help to elucidate molecular mechanisms behind sex-specific functions of the liver. The aim of the present investigation was to identify genes involved in the metabolism of carbohydrates, lipids, and protein with a gender-differentiated expression and to determine which of these might be regulated by the sex-specific secretion of GH. We have collected transcript profiles from male and female rat livers using cDNA microarrays representing 3200 genes. Gender differences in gene expression have been compared with the effect of continuous infusion of GH to male rats. Most notable among the female-predominant gene products was fatty acid translocase/CD36 (FAT/CD36), which was shown to have 18-fold higher mRNA levels in the female liver. This gender-differentiated expression was confirmed at mRNA and protein levels in the rat and at the mRNA level in humans.
 |
Materials and Methods
|
|---|
Animals
Ten-week-old male and female Sprague Dawley rats (B&K Universal AB, Hull, UK) were maintained under standardized conditions. Five male rats were treated with bovine GH (gift from Pharmacia & Upjohn AB, Stockholm, Sweden) by continuous infusion from osmotic minipumps (model 2001, B&K Universal AB) at a dose of 5 µg/h. After 1 wk of treatment, the rats were killed, and tissues removed and frozen in liquid nitrogen. The animal experiments were approved by the institutional animal care and use committee.
Human liver samples
Human liver tissue was obtained from a donor liver bank established at the Department of Clinical Pharmacology at Huddinge University Hospital. The liver specimens which for various reasons could not be used for organ transplantation, included seven women and five men between 22 and 50 yr of age. None of the subjects had been diagnosed with metabolic disorders. The donors were checked for hepatitis B and C serology, and all were HIV negative. All livers were processed to be used for transplantation and were transfused with 510 liters Belzer UW Cold Storage Solution (ViaSpan, DuPont Pharmaceuticals, Wilmington, DE). Before transfusion, benzyl penicillin (0.12 mg), actaprid (1.4 mg), and dexamethasone (16 mg) were added (all per liter of UW solution). The livers were handled within the ischemic time of about 16 h, cut into small pieces, snap-frozen in liquid nitrogen, and stored at -80 C. The study was approved by the ethics committee of Huddinge University Hospital, Karolinska Institute. Consent was obtained from the donor or their relatives to use the liver tissue for scientific purposes.
cDNA microarray analysis
The generation (10), use, and analysis (11) of microarrays representing 3200 cDNAs have been described previously. Total RNA was isolated from livers using TRIzol reagent (Invitrogen Life Technologies, Gaithersburg, MD). The aim of this study was to investigate not individual variations, but, rather, the common changes representative of the whole group. Therefore, equal amounts of total RNA from five animals in the same experimental group were pooled before cDNA labeling. Although pooling of samples might lead to the signals being confounded by mixed individuals, it also minimizes the biological noise. In the first set of experiments, each hybridization compared Cy3-labeled cDNA reverse transcribed from RNA isolated from male rats with Cy5-labeled cDNA isolated from females. In another set of experiments, Cy3-labeled cDNA derived from livers of nontreated males were compared with Cy5-labeled cDNA from male rats that had been treated with bovine GH for 1 wk. Each experiment was analyzed in triplicate on the same cDNA pool.
The significance of the expression ratios of both sex and GH replacement studies were estimated using the significance analysis of microarray technique (12). A q value was assigned for each of the detectable genes in the array. This value is similar to the familiar P value, measuring the lowest false discovery rate at which the differential expression (the ratio between control and experimental cDNA) of the gene is called significant. In this study, genes with a q value less than 5% were considered significantly differentially expressed. Genes with higher q values were excluded from further analysis. To this statistically based criterion a further requirement was added for differential expression based on the absolute changes in gene expression ratios. A value of 1.5 was chosen to denote differences (increased or decreased expression) in the level of hybridization between control and experimental cDNA. This cut-off was empirically chosen based on previous validation studies using different independent techniques. Previous results from our laboratory have shown that Cy5/Cy3 ratios around 1.5 correspond to higher ratios when calculated using results obtained from ribonuclease (RNase) protection analysis (8, 10, 11, 13, 14). In terms of fold regulation, DNA chip analysis tended to underestimate differences compared with RNase protection assay.
Solution hybridization analysis
Total RNA was isolated from rat tissues as described above, and mRNA levels were measured using a solution hybridization/RNase protection assay. A specific 35S-labeled cRNA probe was transcribed in vitro from the cDNA vector construct corresponding to nucleotides 18862058 within the FAT/CD36 mRNA sequence (L19658), according to the method of Melton et al. (15). Samples were analyzed in triplicate, and the results were determined as counts per minute of mRNA per microgram of total RNA. The results are expressed as the mean ± SD, and a t test was used for the determination of statistical significance.
Immunoblotting
Tissue homogenates were resolved by SDS-PAGE on 7.5% polyacrylamide gels and transferred to polyvinylidene difluoride membranes with a Trans-Blot SD semidry transfer cell (Bio-Rad Laboratories, Hercules, CA). The membranes were blocked for 2 h in Tris-buffered saline (10 mM Tris, pH 8.0, and 150 mM NaCl) containing 0.05% (vol/vol) Tween 20 and 10% (wt/vol) milk powder, incubated for 2 h with monoclonal anti-FAT/CD36 antibodies (antimurine CD36, Cascade Biosciences, Winchester, MA) diluted 1:2500 in Tris-buffered saline, washed, and incubated with the secondary antibody (1:10,000; donkey antimouse IgG, Jackson ImmunoResearch Laboratories, West Grove, PA). After additional washing steps antibody binding was visualized using an ECL detection system (Pierce Chemical Co., Rockford, IL).
Immunohistochemistry
Cryostat sections (5 µm) from rat livers were used in a standard immunohistochemical protocol (avidin-biotin-peroxidase). After rinsing the sections in PBS, nonspecific endogenous peroxidase activity was blocked by 3% hydrogen peroxide in methanol for 10 min. After 10-min washing, sections were exposed to a 30-min nonimmunoblock using diluted normal horse serum (Vectastain, Vector Laboratories, Inc., Burlingame, CA) in PBS. The sections were incubated with monoclonal anti-FAT/CD36 antibodies (antimurine CD36, Cascade Biosciences), diluted 1:500 in PBS containing 2% BSA, at 4 C overnight. Negative controls were obtained by replacing the primary antibody with normal horse serum. As secondary antibody, a biotinylated horse antimouse antibody was used (Vector Laboratories, Inc.), and the slides were incubated with horseradish peroxidase-avidin-biotin complex (Vectastain ABC Elite, Vector Laboratories, Inc.). The site of bound enzyme was visualized by 3,3-diaminobenzidine (DAB-kit, Vector Laboratories, Inc.). The sections were counterstained with hematoxylin and dehydrated before mounting with Pertex (Histolab, Gothenburg, Sweden).
Determination of hepatic lipid content
Cellular lipids were extracted from rat liver homogenates using chloroform and methanol (2:1, vol/vol). The extracts were dried and dissolved in 200 µl isopropanol. The lipid contents were determined using kits for total cholesterol (ABX Diagnostics, Montpellier, France), free cholesterol (Wako Chemical GmbH, Neuss, Germany), and triglycerides (Roche, Indianapolis, IN). Samples were analyzed in duplicate, and the results were determined as micromoles of lipid per gram of liver tissue. The amount of cholesteryl esters was calculated as the difference between total and free cholesterol. The results are expressed as the mean ± SE. A t test was used for the determination of statistical significance.
Quantification of human FAT/CD36 mRNA expression
Total RNA was isolated from human livers using TRIzol reagent, as described above for rat tissues. The RNA concentration was carefully determined spectrophotometrically, and the quality of the RNA samples was examined on a denaturing agarose gel. A total of 1.0 µg RNA was transcribed into cDNA using 200 U SuperScript II RNase H- reverse transcriptase (Life Technologies, Inc.) and oligo(deoxythymidine)1218 primer.
Quantification of CD36 and ß-actin mRNAs was performed by TaqMan real-time semiquantitative PCR according to the manufacturers protocol, using an ABI PRISM 7000 Sequence Detection System instrument and software (PE Applied Biosystems, Foster City, CA). CD36 was measured using a predeveloped TaqMan Assay-on-Demand (assay ID, Hs00169627_m1, PE Applied Biosystems). Primers and probe sequences for ß-actin were designed using the Primer Express software (PE Applied Biosystems): forward primer, 5'-CTGGCTGCTGACCGAGG-3'; reverse primer, 5'-GAAGGTCTCAAACATGATCTGGGT-3'; and probe, 5'-(6-FAM)CCTGAACCCCAAGGCCAACCG(TAMRA)-3'.
Standard curves were constructed using dilutions of purified PCR-amplified target sequences. Results are expressed in arbitrary units. Differences in loading of RNA were accounted for by expressing CD36 expression relative to ß-actin. Data analysis was performed using t test.
 |
Results
|
|---|
Expression profiles were collected from rat liver to identify genes with a gender-differentiated expression. Of 3200 genes printed on the arrays, approximately 1800 were detected in the liver. Among these, 246 transcripts were expressed in a sexually differentiated manner; 69 transcripts (4%) displayed a statistically significant increase (at least 1.5-fold) in females, whereas 177 (10%) had a higher level in males. To identify sex-specific genes dependent on the sexually differentiated pattern of GH secretion, we compared mRNA expression in livers from untreated male rats with livers exposed to 1 wk of continuous GH infusion. GH infusion of male rats changed the expression levels in 16% of the total number of hepatic genes. By comparing the list of gender-differentiated genes with the list of GH-regulated genes, various GH-regulated genes with gender-differentiated expression could be identified. Twenty-one female-predominant genes were induced by continuous infusion of GH to male rats, indicating that these genes might be female-predominant due to their ability to become induced by the continuous presence of GH. Similarly, 51 male-predominant genes were reduced by GH and might thus be under negative influence of female-specific GH secretion.
Continuous treatment of male rats with GH through osmotic minipumps is well known to feminize the liver at the level of gene expression (4). This feminizing effect of GH could be observed in the present study through the induction of CYP2C12 and CYP2C7 (Table 1
), which represent GH-regulated female-specific (16) and female-predominant (17) gene products, respectively. Similarly, the male-specific CYP2C13 (18), carbonic anhydrase III (19), and
2u-globulin (20) were expressed at higher levels in male liver and were reduced by continuous GH treatment. The expression of these genes is dependent on the male-specific intermittent pattern of GH secretion in the rat and is repressed by continuous infusion of GH. Taken together, these results indicate that the animals had been able to respond sufficiently to the infusion of GH.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Effects of gender and continuous GH treatment on the expression of hepatic genes previously characterized as sex specific and GH regulated
|
|
To identify gene products that might be involved in the sexually dimorphic development of metabolic disorders, the differentially expressed gene products were next grouped into functional categories to enable an overview of the effects of gender and GH treatment on specific cellular pathways. The male liver was found to have a higher expression of several genes involved in glucose, lipid, and amino acid metabolism compared with the situation in females (Table 2
). Only four metabolic gene products displayed a higher expression in female livers. Most notable among these was FAT/CD36, which was shown to have 18-fold higher mRNA levels in the female liver. This finding might be of special interest, because FAT/CD36 has been implicated in both reverse cholesterol transport and long-chain fatty acid (LCFA) uptake in various tissues. As a consequence, plasma cholesterol is elevated in FAT/CD36 gene knockout mice (21). Furthermore, hepatic clearance of LCFA is substantially faster in females than in males (22), a fact that has been suggested to underlie known gender-related differences in lipoprotein metabolism and associated disease states.
View this table:
[in this window]
[in a new window]
|
TABLE 2. Effects of gender and continuous GH treatment on the expression of genes involved in fuel metabolism in rat liver
|
|
The finding that females had higher levels of hepatic FAT/CD36 indicates that females, in situations of increased availability of circulating fatty acids, will be better equipped to import these lipids. As previous reports have concluded that FAT/CD36 is only expressed in the liver at low levels (23), we wanted to confirm our observation by further studies. mRNA expression in liver was compared with that in adipose tissue, where the presence of FAT/CD36 is well documented (23). When liver and fat RNA samples were prepared from individual rats and hybridized with a FAT/CD36-specific cRNA probe in an RNase protection/solution hybridization assay, FAT/CD36 mRNA levels were approximately 6 times higher in fat compared with liver, but only if the RNA was obtained from male animals (Fig. 1
). If female tissues were compared, the liver had higher levels of this transcript. FAT/CD36 mRNA levels were approximately 8 times higher in female livers compared with male livers, and GH was shown to induce this transcript in male liver. In contrast to the situation in liver, adipose FAT/CD36 displayed approximately 2 times lower mRNA levels in female rats and was not affected by GH treatment, indicating that this gene is differently regulated in fat compared with liver. One likely explanation for the opposite effect of gender on the FAT/CD36 mRNA levels in liver and fat might be that tissue-specific signaling molecules are involved in regulating the expression of this gene. Furthermore, as the gender effect was greater than the GH effect (in both tissues), other hormones, such as sex steroids, might regulate this gene.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1. Effects of gender and GH treatment on FAT/CD36 mRNA expression in liver and adipose tissue from rats. Comparison of changes in FAT/CD36 mRNA expression in female vs. male rats and GH-treated (continuous infusion) vs. untreated male rats (n = five rats/group) determined by RNase protection/solution hybridization analysis. Individual RNA samples were analyzed in triplicate, and the results were expressed as the mean ± SD. The effect of gender was significant in both tissues, but the GH effect was only significant in liver. **, P < 0.001; *, P < 0.005 (vs. untreated male rats).
|
|
To gain more information about the hormonal regulation of FAT/CD36 expression in rat liver, we used our recently developed database for microarray data (EndoGED) to search for expression data associated with this gene. The database can be found at www.cmm.ki.se/endoged and contains detailed information about the animal experiments behind the data collected therein. The data extracted from EndoGED related to FAT/CD36 are summarized in Table 3
. Based on data from previously described experiments (24), estrogen treatment did not induce hepatic FAT/CD36 expression in castrated female rats. However, continuous treatment of GH (female pattern) induced FAT/CD36 mRNA levels in hypophysectomized (10) or 2-yr-old (8) male rats, confirming the positive effect of GH on this gene. Furthermore, GH treatment of primary cultures of rat hepatocytes was also shown to increase the level of FAT/CD36 mRNA in the absence of any other hormone except insulin, indicating a direct effect of GH on the hepatocyte. Interestingly, episodic treatment (male pattern) with GH led to reduced expression in 18-month-old male rats. Bearing in mind the screening nature of DNA microarray analysis, these data indicate that GH is an important regulator of this gene, and depending on the mode of treatment (continuous or episodic), the gene might be either induced or repressed. It may therefore be speculated that the added effects of continuous GH secretion in females (which is stimulatory) and episodic GH secretion in males (which is inhibitory) will produce the final gender difference observed in this study. Work is now in progress to validate this hypothesis.
To examine whether the sex-differentiated mRNA expression in rat liver is translated into protein, FAT/CD36 expression was studied by immunoblotting and immunohistochemistry. As shown in Fig. 2
, immunoblotting with FAT/CD36 monoclonal antibodies revealed higher levels of a protein with the apparent molecular mass of 85 kDa in female livers, indicating a female-predominant expression of hepatic FAT/CD36 protein. The reason why multiple bands appear on the blot is unknown, but might be related to different degrees of protein glycosylation (25). The same antibody recognized a protein in hepatic cryostat sections (Fig. 3
). Immunostaining of FAT/CD36 was mainly confined to hepatocytes, although a weak presence could be observed in some Kupffer cells (arrowhead). Arrows indicate strongly stained hepatocytes in female rats, whereas the arrows with broken lines indicate the weak staining in male rats. The intensity of FAT/CD36 staining in hepatocytes from female livers (Fig. 3A
) seems to be stronger than that in male livers (Fig. 3B
).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2. Effects of gender on FAT/CD36 protein expression in rat tissues. FAT/CD36 protein levels were analyzed by immunoblotting in male adipose tissue (A), male liver (BE), or female liver (FI) from eight different individuals. Different amounts of protein were loaded for the different types of tissue (100 µg from fat and 250 µg from liver).
|
|

View larger version (90K):
[in this window]
[in a new window]
|
FIG. 3. Effects of gender on FAT/CD36 expression in rat liver. Cryostat sections show anti-FAT/CD36 staining in normal female (A) and male liver (B). C, Negative control. Representative sections are shown. Scale bars, 50 µm.
|
|
In attempts to relate gender differences of FAT/CD36 expression to a specific phenotype, the effect of gender and GH treatment was determined on liver triglyceride and cholesteryl ester contents. As shown in Fig. 4
, the hepatic triglyceride content was not different between the sexes, but increased after GH treatment. This effect of GH has been shown previously (26) and fits with the data presented in Table 2
, showing increased expression of gene products involved in lipogenesis in GH-treated rats. Similarly, no gender difference was detected for total cholesterol. The hepatic content of cholesteryl ester was significantly lower in the females, but was not affected by GH treatment. As the total amount of cholesterol was the same in the three groups of animals, the lower amount of cholesteryl ester in females might be due to a lower capacity to convert free cholesterol into cholesteryl esters. Although further studies on lipid metabolism, including assays for fatty acid oxidation and secretion of lipoprotein particles, are required to better address what type of metabolic changes would be expected from a high expression of FAT/CD36, the sex differences might not appear unless the rats are exposed to increased levels of circulating fatty acids. This question might therefore be better addressed if the experiments described in this report were repeated on rats fed a high fat diet.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4. Effects of gender and GH treatment on hepatic lipid content. Total cholesterol, free cholesterol, cholesterol ester, and triglycerides were determined in hepatic lipid extracts from male, female, and GH-treated male rats. Lipid extraction and analyses were performed as described in Materials and Methods. Data are given as the mean ± SE. **, P < 0.01; *, P < 0.05 (vs. untreated male rats).
|
|
Finally, FAT/CD36 mRNA expression was investigated in human liver samples using TaqMan real-time semiquantitative PCR. Human liver tissue was obtained from postmortem subjects, including seven women and five men between 2250 yr of age. When FAT/CD36 mRNA levels were quantified and related to levels of ß-actin, it could be concluded that hepatic FAT/CD36 expression is also female-predominant in humans (Table 4
), although the differences are not as marked as in rodents. The mean ± SD FAT/CD36 expression in male and female livers were 1.56 ± 0.33 and 3.28 ± 1.31, respectively. The smaller gender effect in human samples could indicate species-specific mechanisms behind the expression of this gene, or it might be due to the fact that gender-unrelated factors affected the FAT/CD36 expression in the human livers.
In the above-described experiments we have used cDNA microarrays as a screening instrument to obtain an overview of differentially expressed genes. The finding that FAT/CD36 is a gene with a sex-specific liver expression caught our attention, especially as this seems to also be the case in humans. To pave the way for further studies, we found it relevant to conduct an in silico analysis of the FAT/CD36 promoter. It is reasonable to assume that regulatory regions in gene promoters are conserved between species if they regulate the gene in a similar manner. Rodent compared with human FAT/CD36 promoters share regions of conserved sequences. These regions contain more than 50 different conserved putative DNA-binding elements (see the supplemental data published on The Endocrine Societys Journals Online web site at http://endo.endojournals.org) that motivate further investigations. Some of the conserved DNA-binding elements that could be of interest are pointed out in Fig. 5
, where the organization of the mouse gene promoter is shown. Hepatocyte nuclear factor-3ß has previously been shown to be involved in gender-differentiated and GH pattern-dependent gene regulation (27, 28). Also, c-Fos (29) and nuclear factor-
B (30) have shown gender-related differences in expression under certain circumstances. Further investigations are needed to explore whether any of these transcription factors is involved in the gender-specific regulation of FAT/CD36 expression.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 5. Organization of the mouse FAT/CD36 promoter. The figure shows the 5'-untranslated region of the mouse FAT/CD36 gene with the alternative promoters preceding exons 1a and 1b. Translation starts in exon 3. Putative binding sites for hepatocyte nuclear factor-3ß (HNF-3ß), c-Fos, and nuclear factor- B (NF-kappaB) are indicated. Other binding sites that were conserved between species, and their exact location, can be found in the supplemental data.
|
|
 |
Discussion
|
|---|
This study describes gender-dimorphic expression profiles from rat liver with particular emphasis on fuel metabolism, which may set the basis for gender-related differences in this metabolically important tissue. Our results indicate that male rats have a higher expression of genes encoding important proteins for glucose oxidation, glycogen production, lipid synthesis, fatty acid oxidation, and amino acid turnover. This observation might explain why male rats have a higher metabolic rate than females and is in line with the fact that males have a bigger muscle mass and higher growth rate. We have recently observed that genes involved in hepatic fatty acid oxidation and glycogen production are induced by intermittent GH treatment in old male rats. As this type of treatment is believed to mimic the male-specific episodic secretion of GH, the results suggested that this set of genes might be male-predominant. Indeed, data obtained in the present study show that the same genes had a higher hepatic expression in male rats. As the higher growth rate in males is also dependent on episodic GH secretion, this might be a way to ensure that increased body growth is always coupled to increased utilization of fatty acids for energy expenditure. A high rate of hepatic ß-oxidation in male rats may increase the ability of the liver to produce glucose by gluconeogenesis. In addition, a higher level of UDP pyrophosphorylase might lead to a relatively higher deposition of hepatic glycogen in males compared with females. Both UDP pyrophosphorylase and carnitine palmitoyltransferase 1 were male-predominant, repressed by continuous GH in the present study, and shown to be induced by intermittent GH treatment in a previous study (7A ). Therefore, these genes seem to be under the same type of GH regulation as has previously been described for other male-predominant gene products, such as CYP2C13 (18), CYP3A2 (31), carbonic anhydrase III (19), and
2u-globulin (20).
Among the gender-differentiated genes classified as being important in intermediary metabolism, FAT/CD36 was found to display the biggest difference in mRNA levels between the sexes, with a very high level in female livers. This gene was further shown to have at least 2 times higher mRNA expression in human female livers compared with male livers. FAT/CD36 is a cell surface glycoprotein that functions as a receptor/transporter for LCFAs. FAT/CD36 has been shown to be expressed by various cell types, including platelets, monocytes/macrophages, and endothelial cells, and tissues with active LCFA metabolism, such as adipose, small intestine, and heart. Until recently, the liver was not believed to be a major site for FAT/CD36 expression. However, during the preparation of this manuscript, Zhang et al. (32) described the production of a monoclonal Ab (UA009) that recognizes an antigen characterized as FAT/CD36. Immunostaining using UA009 revealed high FAT/CD36 expression in female hepatocytes. Moreover, a clear gender difference was reported, with higher expression in the liver of female rats compared with males, confirming the results obtained in the present study.
If FAT/CD36 is involved in the uptake of LCFAs by the liver, the female-predominant hepatic expression of this gene might explain the long-recognized difference in LCFA uptake and utilization in livers of male and female rats (33). Moreover, as fatty acids also act as signals involved in regulating gene expression, a greater capacity to import these molecules might lead to a sexually differentiated pattern of gene expression during situations of increased availability of fatty acids. Several genes encoding proteins involved in the metabolism of glucose and lipids are known to be regulated by fatty acids. Down-regulated genes include pyruvate kinase, glucose-6-phosphatase, fatty acid synthase, spot 14, and stearyl CoA desaturase 1. Interestingly, all of these gene products were expressed at a lower level in the livers from female rats in this study. Whether this observation is related to the higher level of FAT/CD36 in female livers must await further investigations. It is tempting, however, to speculate that the lower level of FAT/CD36 observed in male rats and male humans might lead to a reduced capacity to repress hepatic lipogenesis when circulating levels of LCFAs increase. This observation is in line with the idea that sex differences in arteriosclerosis might be determined not only by sex-related differences in the extracellular hormonal environment, but also by sex-specific cellular characteristics mediating responses to a variety of stimuli. Previous studies have shown that there is a pathophysiological connection between FAT/CD36 and cardiovascular disorders (34). Our finding that FAT/CD36 expression is sex different leads us to speculate that this gene might be involved in the sexually dimorphic development of diseases resulting from or characterized by disturbances in lipid metabolism, such as arteriosclerosis, hyperlipidemia, and insulin resistance.
 |
Footnotes
|
|---|
This work was supported by grants from the Swedish Medical Research Council, 13X-08556, 32X-14053-01, 14GX-13571-01A, 3902, the Swedish Society of Medical Research, the Fredrik and Ingrid Thuring Foundation, the Tore Nilsson Foundation for Medical Research, the Magnus Bergvall Foundation, the Swedish Medical Association, the Swedish Heart Lung Foundations, and the Loo and Hans Osterman Foundation.
N.S. and E.R.-B. contributed equally to this study.
Abbreviations: FAT/CD36, Fatty acid translocase/CD36; LCFA, long-chain fatty acid; RNase, ribonuclease.
Received July 14, 2003.
Accepted for publication December 9, 2003.
 |
References
|
|---|
- Blaak E 2001 Gender differences in fat metabolism. Curr Opin Clin Nutr Metab Care 4:499502[CrossRef][Medline]
- Tarnopolsky M, Ruby B 2001 Sex differences in carbohydrate metabolism. Curr Opin Clin Nutr Metab Care 4:521526[CrossRef][Medline]
- Tipton K 2001 Gender differences in protein metabolism. Curr Opin Clin Nutr Metab Care 4:493498[CrossRef][Medline]
- Zaphiropoulos PG, Mode A, Norstedt G, Gustafsson J-Å 1989 Regulation of sexual differentiation in drug and steroid metabolism. Trends Pharmacol Sci 10:149153[CrossRef][Medline]
- Isaksson OG, Edén S, Jansson J-O 1985 Mode of action of pituitary growth hormone on target cells. Annu Rev Physiol 47:483499[CrossRef][Medline]
- Rose S, Municchi G, Barnes K, Kamp G, Uriarte M, Ross J, Cassorla F, Cutler GJ 1991 Spontaneous growth hormone secretion increases during puberty in normal girls and boys. J Clin Endocrinol Metab 73:428435[Abstract/Free Full Text]
- Clark RG, Jansson JO, Isaksson O, Robinson IC 1985 Intravenous growth hormone: growth responses to patterned infusions in hypophysectomized rats. J Endocrinol 104:5361[Abstract/Free Full Text]
- Tollet-Egnell P, Parini P, Stahlberg N, Lonnstedt I, Lee NH, Rudling M, Flores-Morales A, Norstedt G 2004 Growth hormone-mediated alteration of fuel metabolism in the aged rat as determined from transcript profiles. Physiol Genom 16:261267[Abstract/Free Full Text]
- Tollet-Egnell P, Flores-Morales A, Ståhlberg N, Malek R, Lee N, Norstedt G 2001 Gene expression profile of the aging process in rat liver: normalizing effects of growth hormone replacement. Mol Endocrinol 15:308318[Abstract/Free Full Text]
- Wingard D, Suarez L, Barrett-Connor E 1983 The sex differential in mortality from all causes and ischaemic heart disease. Am J Epidemiol 117:165172[Abstract/Free Full Text]
- Flores-Morales A, Ståhlberg N, Tollet-Egnell P, Lundeberg J, Malek R, Quackenbush J, Lee N, Norstedt G 2001 cDNA microarray analysis of the in vivo effects of hypophysectomy and growth hormone treatment on gene expression in the rat. Endocrinology 142:31633176[Abstract/Free Full Text]
- Pang S, Dillner K, Wu X, Pousette A, Norstedt G, Flores-Morales A 2002 Gene expression profiling of androgen deficiency predicts a pathway of prostate apoptosis that involves genes related to oxidative stress. Endocrinology 143:48974906[Abstract/Free Full Text]
- Tusher V, Tibshirani R, Chu G 2001 Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 98:51165121[Abstract/Free Full Text]
- Flores-Morales A, Gullberg H, Fernandez L, Stahlberg N, Lee N, Vennstrom B, Norstedt G 2002 Patterns of liver gene expression governed by TRß. Mol Endocrinol 16:12571268[Abstract/Free Full Text]
- Iyer VR, Eisen MB, Ross DT, Schuler G, Moore T, Lee JC, Trent JM, Staudt LM, Hudson Jr J, Boguski MS, Lashkari D, Shalon D, Botstein D, Brown PO 1999 The transcriptional program in the response of human fibroblasts to serum. Science 283:8387[Abstract/Free Full Text]
- Melton DA, Krieg PA, Rebagliati MR, Maniatis T, Zinn K, Green MR 1984 Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promotor. Nucleic Acids Res 12:70357056[Abstract/Free Full Text]
- Mode A, Wiersma-Larsson E, Gustafsson J-Å 1989 Transcriptional and posttranscriptional regulation of sexually differentiated rat liver cytochrome P-450 by growth hormone. Mol Endocrinol 3:11421147[Abstract/Free Full Text]
- Bandiera S, Ryan D, Levin W, Thomas P 1986 Age- and sex-related expression of cytochromes p450f and P450g in rat liver. Arch Biochem Biophys 248:658676[CrossRef][Medline]
- Ryan D, Iida S, Wood A, Thomas P, Lieber C, Levin W 1984 Characterization of three highly purified cytochromes P-450 from hepatic microsomes of adult male rats. J Biol Chem 259:12391250[Abstract/Free Full Text]
- Jeffery S, Wilson C, Mode A, Gustafsson J-Å, Carter N 1986 Effects of hypophysectomy and growth hormone infusion on rat hepatic carbonic anhydrases. J Endocrinol 110:123126[Abstract/Free Full Text]
- Chatterjee B, Demyan W, Gustafsson J, Harris M, Hökfelt T, Norstedt G, Roy A 1986 Effect of anterior hypothalamic deafferentation and continuous growth hormone infusion on the hepatic synthesis of
2u-globulin in the male rat. J Endocrinol 108:351355[Abstract/Free Full Text]
- Febbraio M, Abumrad N, Hajjar D, Sharma K, Cheng W, Pearce S, Silverstein R 1999 A null mutation in murine CD36 reveals an important role in fatty acid and lipoprotein metabolism. J Biol Chem 274:1905519062[Abstract/Free Full Text]
- Luxon BA, Holly DC, Milliano MT, Weisiger RA 1998 Sex differences in multiple steps in hepatic transport of palmitate support a balanced uptake mechanism. Am J Physiol 274:G52G61
- Abumrad N, el-Maghrabi M, Amri E, Lopez E, Grimaldi P 1993 Cloning of a rat adipocyte membrane protein implicated in binding or transport of long-chain fatty acids that is induced during preadipocyte differentiation. Homology with human CD36. J Biol Chem 268:1766517668[Abstract/Free Full Text]
- Wu X, Pang S, Sahlin L, Blanck A, Norstedt G, Flores-Morales A 2003 Gene expression profiling of the effects of castration and estrogen treatment in the rat uterus. Biol Reprod 2003 69:13081317[Abstract/Free Full Text]
- Greenwalt D, Lipsky R, Ockenhouse C, Ikeda H, Tandon N, Jamieson G 1992 Membrane glycoprotein CD36: a review of its roles in adherence, signal transduction, and transfusion medicine. Blood 80:11051115[Free Full Text]
- Elam M, Simkevich C, Solomon S, Wilcox H, Heimberg M 1988 Stimulation of in vitro triglyceride synthesis in the rat hepatocyte by growth hormone treatment in vivo. Endocrinology 122:13971402[Abstract/Free Full Text]
- Legraverend C, Eguchi H, Ström A, Lahuna O, Mode A, Tollet P, Westin S, Gustafsson J-Å 1994 Transactivation of the rat CYP2C13 gene promoter involves HNF-1, HNF-3, and members of the orphan receptor subfamily. Biochemistry 33:98899897[CrossRef][Medline]
- Delesque-Touchard N, Park S, Waxman D 2000 Synergistic action of hepatocyte nuclear factors 3 and 6 on CYP2C12 gene expression and suppression by growth hormone-activated STAT5b. Proposed model for female specific expression of CYP2C12 in adult rat liver. J Biol Chem 275:3417334182[Abstract/Free Full Text]
- Porsh-Hällström I, Gustafsson J-Å, Blanck A 1989 Effects of growth hormone on the expression of c-myc and c-fos during early stages of sex-differentiated rat liver carcinogenesis in the resistant hepatocyte model. Carcinogenesis 10:23392343[Abstract/Free Full Text]
- Kono H, Wheeler M, Rusyn I, Lin M, Seabra V, Rivera C, Bradford B, Forman D, Thurman R 2000 Gender differences in early alcohol-induced liver injury: role of CD14, NF-
B, and TNF-
. Am J Physiol 278:G652G661
- Pampori N, Shapiro B 1996 Feminization of hepatic cytochrome P450s by nominal levels of growth hormone in the feminine plasma profile. Mol Pharmacol 50:11481156[Abstract]
- Zhang X, Fitzsimmons R, Cleland L, Ey P, Zannettino A, Farmer E, Sincock P, Mayrhofer G 2003 CD36/fatty acid translocase in rats: distribution, isolation from hepatocytes, and comparison with the scavenger receptor SR-B1. Lab Invest 83:317332[Medline]
- Ockner R, Burnett D, Lysenko N, Manning J 1979 Sex differences in long chain fatty acid utilization and fatty acid binding protein concentration in rat liver. J Clin Invest 64:172181
- Tanaka T, Sohmiya K, Kawamura K 1997 Is CD36 deficiency an etiology of hereditary hypertrophic cardiomyopathy? J Mol Cell Cardiol 29:121127[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
C. J. Krebs, S. Khan, J. W. MacDonald, M. Sorenson, and D. M. Robins
Regulator of sex-limitation KRAB zinc finger proteins modulate sex-dependent and -independent liver metabolism
Physiol Genomics,
June 1, 2009;
38(1):
16 - 28.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. W. van der Meer, S. Hammer, H. J. Lamb, M. Frolich, M. Diamant, L. J. Rijzewijk, A. de Roos, J. A. Romijn, and J. W. A. Smit
Effects of Short-Term High-Fat, High-Energy Diet on Hepatic and Myocardial Triglyceride Content in Healthy Men
J. Clin. Endocrinol. Metab.,
July 1, 2008;
93(7):
2702 - 2708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. W. van der Meer, L. J. Rijzewijk, M. Diamant, S. Hammer, M. Schar, J. J. Bax, J. W.A. Smit, J. A. Romijn, A. de Roos, and H. J. Lamb
The ageing male heart: myocardial triglyceride content as independent predictor of diastolic function
Eur. Heart J.,
June 2, 2008;
29(12):
1516 - 1522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Rogers, E. J. Theve, Y. Feng, R. C. Fry, K. Taghizadeh, K. M. Clapp, C. Boussahmain, K. S. Cormier, and J. G. Fox
Hepatocellular Carcinoma Associated with Liver-Gender Disruption in Male Mice
Cancer Res.,
December 15, 2007;
67(24):
11536 - 11546.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Magkos, B. W. Patterson, B. S. Mohammed, S. Klein, and B. Mittendorfer
Women Produce Fewer but Triglyceride-Richer Very Low-Density Lipoproteins than Men
J. Clin. Endocrinol. Metab.,
April 1, 2007;
92(4):
1311 - 1318.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. S. Eyre, L. G. Cleland, N. N. Tandon, and G. Mayrhofer
Importance of the carboxyl terminus of FAT/CD36 for plasma membrane localization and function in long-chain fatty acid uptake
J. Lipid Res.,
March 1, 2007;
48(3):
528 - 542.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Brodeur, V. Luangrath, G. Bourret, L. Falstrault, and L. Brissette
Physiological importance of SR-BI in the in vivo metabolism of human HDL and LDL in male and female mice
J. Lipid Res.,
April 1, 2005;
46(4):
687 - 696.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Rico-Bautista, C. J. Greenhalgh, P. Tollet-Egnell, D. J. Hilton, W. S. Alexander, G. Norstedt, and A. Flores-Morales
Suppressor of Cytokine Signaling-2 Deficiency Induces Molecular and Metabolic Changes that Partially Overlap with Growth Hormone-Dependent Effects
Mol. Endocrinol.,
March 1, 2005;
19(3):
781 - 793.
[Abstract]
[Full Text]
[PDF]
|
 |
|