| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Medical Research Council Human Reproductive Sciences Unit, University of Edinburgh Academic Centre, Edinburgh EH16 4SB, United Kingdom
Address all correspondence and requests for reprints to: Gerald A. Lincoln, Medical Research Council Human Reproductive Sciences Unit, University of Edinburgh Academic Centre, Edinburgh EH16 4SB, United Kingdom. E-mail: g.lincoln{at}hrsu.mrc.ac.uk.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A specific type II GnRH receptor with a high affinity for GnRH-II was first demonstrated in amphibians (11, 12) in which it was shown to be a seven-transmembrane domain (7-TMD, or hepta-helical) protein belonging to the rhodopsin-like G protein-coupled receptor (GPCR) subfamily. The type II GnRH receptor cDNA was subsequently cloned from a variety of primates: marmoset (13), African green monkey, and rhesus monkey (14). This was achieved through PCR, using degenerate primers to extracellular loop (ECL)-3 coupled with 3' and 5' rapid amplification of cDNA ends. The primate type II GnRH receptor amino acid sequences share a 60% identity with amphibian type II GnRH receptors and 40% identity with the human GnRH-I receptor. However, the mammalian GnRH-I receptors are unique within the GPCR superfamily in that they have no cytoplasmic carboxyl tail domain. All nonmammalian GnRH-I and all type II GnRH receptors do possess a cytoplasmic tail, important for agonist-dependent phosphorylation, desensitization, and internalization (15).
Notable species-specific differences in the structure of the mammalian GnRH receptor gene family have been identified. The human type II GnRH receptor gene homologue is disrupted by the presence of a frame shift in exon 1 and a premature stop codon in exon 2 (16). Although a complete sequence for a nonprimate mammalian type II GnRH receptor gene has not yet been elucidated, expressed sequence tags (ESTs) from bovine tissue indicate that the presence of the premature stop codon in exon 2 is not limited to humans. However, porcine and canine DNA sequence fragments (GenBank accession no. CF411223) do not possess the premature stop codon. The type II GnRH receptor gene appears to have been deleted from mouse genomic DNA (GenBank AL772162), whereas a gene remnant is present in rat genomic DNA (GenBank AC131863) (17). How these species differences impact on the physiological regulation of the reproductive axis is unknown. For the GnRH-I system, alternative transcripts produced by skipping GnRH-I receptor gene exon 2 generate a protein that interferes with the binding of the GnRH-I peptide to the GnRH-I receptor in humans (18) and possibly in sheep (19) and mice (20), thus various alternative processing may occur for the GnRH-II receptor to produce functional proteins distinct from the ancestral hepta-helical receptor protein. The variation is likely to be both species specific and tissue specific.
To further investigate such variation, we fully sequenced the type II GnRH receptor gene in the sheep using tissues from a wild-type breed, the Soay sheep. This involved developing a PCR strategy to clone the gene from genomic DNA. Several novel features were found including a stop codon in exon 1 and a major deletion in exon 2 that were confirmed to be present in a wide range of different sheep breeds, indicating that this is a structural characteristic for GnRH-II receptor gene in the ovine family. A specific restriction digest study indicated that only one copy of the gene is likely to be present in the ovine genome. Tissue localization of receptor gene transcripts were investigated using Northern blot analysis, RT-PCR, and in situ hybridization in brain, pituitary gland, isolated gonadotropes, and testes to provide insight into potential functions, or lack of, for GnRH-II receptor proteins in the complex control of reproductive physiology and behavior.
| Materials and Methods |
|---|
|
|
|---|
Isolation of DNA and RNA
High-molecular-weight DNA was purified from frozen tissue by grinding it into powder on dry ice followed by incubation in proteinase K solution [100 mM NaCl, 10 mM Tris (pH 8.0), 25 mM EDTA, 0.5% sodium dodecyl sulfate, 0.1 mg/ml proteinase K, Sigma, Poole, UK] at 50 C overnight, using 2.0 ml solution per 0.1 g of tissue. Protein was removed by phenol-chloroform extraction, and DNA was precipitated from the aqueous phase with two volumes of 100% ethanol. Contaminating RNA was digested by incubation with RNase A (0.1 µg/ml 37 C for 1 h, Sigma).
RNA was purified from homogenized tissues using Tri-Reagent (Sigma) according to the method of Chomczynski and Sacchi (21). The RNA yield was estimated using UV spectrophotometry (GeneQuant pro machine, Amersham Pharmacia Biotech, Little Chalfont, UK). PolyA+ RNA was prepared from 1.25 mg total RNA using oligo-dT-spin-column chromatography (Amersham Pharmacia Biotech).
Long-distance PCR (LD-PCR)
Nested oligonucleotide primers were designed according to sequences encoding PEX11ß (MRC1063 5'-CTGTTTCTGTAACTCAGGACTGGC, MRC1064 5'-GAAGCGGACCCAGGCGTCCAT) and RBM8A genes (MRC1065 5'-AGAGGTGGTCGAAGACGCAGC, MRC1066 5'-ACAAGGAGGCCCAGGCTGCTA). (See GenBank accession number AL1060282 for PEX11ß sequence at 77,80884,325 bp and RBM8A sequence at 69,07269,158 bp.) These primers enabled amplification of the chromosomal region containing the ovine type II GnRH receptor gene (Fig. 1
). LD-PCR was performed using a commercial kit (Expand HiFidel system, Roche Molecular Biochemicals, Roche Diagnostics Ltd., East Sussex, UK).
|
RT-PCR
Total RNA (5 µg) from different brain areas (forebrain, midbrain, hindbrain, hypothalamus) and several other tissues (pituitary gland, ovary, testes, adrenal gland, and liver) was used to create cDNA, using random primers and Superscript II RNase H-reverse transcriptase (Invitrogen, Paisley, UK), as per manufacturers instructions. Oligonucleotide primers were designed to enable amplification of full-length receptor cDNA and subregions of the coding sequence (Fig. 2
). PCR amplification of these regions was performed using BioTaq DNA polymerase [with KCl buffer, MgCl2, and deoxynucleotide triphosphates, Bioline, London, UK]. Samples (0.25 µg cDNA) were preheated to 94 C for 5 min and then up to 50 cycles of 94 C for 1 min, 58 C for 1 min, and 72 C for 1 min. A final extension was performed at 72 C for 10 min. Amplified DNA products were resolved on a 1% agarose gel. Oligonucleotide probes (MRC1276 5'-GATTCAGTTGTAGTTTGTGGGGATCCTGAT for exon 23 of the GnRH-I receptor, MRC1194 5'-TTACAGGCAGGAAAGCTGCGGCCTACATGG for exon 1 and MRC 1262 5'-ATTCACCTGCAGGGGCTGGGCTCCCCTTCC for exon 23 of the type II GnRH receptor gene) were designed to enable identification of cDNA products by hybridization to Southern blots of electrophoresed PCR products.
|
PCR-restriction endonuclease-digestion assays
Genomic DNA from wild-type Soay sheep was used for type II GnRH receptor gene cloning. To test whether the gene from this breed is representative of the ovine family, genomic DNA was extracted from 15 other breeds and screened using restriction enzyme/PCR assays. The breeds of sheep used were obtained from specialist breeders and were varieties of European domestic breeds, with the exception of the Barbados Hair sheep, which is a tropical-adapted type that has been isolated from the European breeds for at least 2000 yr. Breeds analyzed can be classified into three groups: 1) Northern seasonal breeds: Suffolk, Herdwick, Cheviot, East Freisland, Vhann, Shetland, Quessant, Finish Landrace, and Texel; 2) Southern less seasonal breeds: Dorset, Romanov, Ryeland, Booroola /Merino, and Barbados Hair; and 3) primitive breeds: Jackob and Soay.
Oligonucleotide primers were designed to generate a defined restriction enzyme product dependent on the presence, or absence, of the premature stop codon (TAG) in the ovine type II GnRH receptor gene. Two different sets of primers were designed with one member of each pair containing a single base mismatch: Stu-1 (MRC1180 sense primer 5'-CCTGGAATATCACTGTTCAATGGCTGGC, MRC1197 antisense primer, 5'-CCAATAATTACAGGCAGGAAAGCTGAGGC) and Sfc-1 (MRC1177 sense primer 5'-CCTACCAGCTGAGCGCAGTCC, MRC1198 antisense primer 5'-CACGTTCCTGAAACTAGTAGCCCTG). Generation of either a Stu-I or Sfc-I restriction enzyme cut site by PCR amplification of sheep DNA depended on the occurrence of different nucleotides within the premature stop codon (TAG), such that if the stop codon is present, then the amplified DNA fragment can be cleaved from 110 bp to produce 85-bp and 35-bp fragments.
Restriction endonuclease digestion of genomic DNA
The DNA sequence between PEX11ß and RBM8A, containing the ovine type II GnRH receptor gene, was investigated using the restriction enzyme Sau3AI that potentially cuts either side of exon 2 and analyzed using GeneJockey II software (Biosoft). For the digests, 6 µg of Soay genomic DNA was incubated in a 35-µl reaction containing 3.5 µl 10 x buffer, 1 µg/µl BSA, and 1.75 µl of Sau3AI for 16 h at 37 C overlaid with mineral oil. The digested DNA products were separated on an a 1% agarose gel and Southern blotted using a DNA probe synthesized from sheep genomic DNA using the primers MRC1217 5'-CCTTGGGGGTCATCAGCGG and MRC1218 5'-GTGAGTGTACGACATGCAAAG located in exon 1 or probed with a mixture of labeled oligos MRC1259 5'-CATCTATAACCTCTTCACCTTCTGCTGCCT, MRC1260 5'-AGGCAGCAGAAGGTGAAGAGGTTATAGATG, and MRC1261 5'CAGATGGTCATTGCAGTCAGTGGCCTCAGA.
Southern blotting
DNA gels were capillary blotted onto Hybond-N+ (Amersham Pharmacia Biotech). All radiolabeled probes were prepared using 50 µCi
32P-dATP (2000 Ci/mmol, Amersham Pharmacia Biotech) and random prime labeling (Roche Molecular Biochemicals) or terminal transferase 3' end-labeling (Promega). Probes were separated from unincorporated radionucleotide using Sephadex G50 (cDNA probes) or Sephadex G25 fine (30-mer oligonucleotide probes) in microspin columns (Amersham Pharmacia Biotech). The cDNA probe templates were isolated from PCR by agarose gel electrophoresis in 1 x Tris-acetate EDTA, band excision from the gel, and spin-elution in Ultrafree 0.45 µm filter units (Millipore, Bedford, MA). Purified probes were denatured by boiling for 2 min and rapid cooling on ice before addition to the prehybridized filters. The cDNA probes were hybridized to filters at 55 C, and 30-mer oligonucleotide probes were used at 50 C, in prehybridization buffer, with rotation overnight.
Northern blotting
Total RNA (30 µg) or polyA+ RNA (115 µg) was size fractionated by denaturing 1.1% agarose gel electrophoresis in 1 x 3[N-morpholino]propanesulfonic acid buffer containing 3% formaldehyde according to standard procedures. Ethidium bromide was added to all samples so that the size of prominent bands or size markers could be estimated after UV transillumination (RNA markers, Life Technologies, Inc.-BRL, Paisley, UK). Gels were rinsed with diethylpyrocarbonate-treated water before blotting, fixing, and probing as described above. A positive control glyceraldehyde 3-phosphate dehydrogenase cDNA probe was generated using the primers MRC1224 5'-CTGCTGACGCTCCCATGTTC and MRC1225 5'-ATGCCAGTGAGCTTCCCGTT based on sheep cDNA sequence data. For GnRH-I receptor, an oligonucleotide probe in exon 1 MRC1265 5'-GTGTTAGTAGGATGCTGCTGTTGATCGCTG and exon 23 MRC1276 5'-GATTCAGTTGTAGTTTGTGGGGATCCTGAT was used. For the type II GnRH receptor, an oligonucleotide probe to exon 1 MRC1194 5'-TTACAGGCAGGAAAGCTGCGGCCTACATGG and exon 3 MRC1071 5'-GTCCTGCTGACCTTCATCCTCTGCTGGA was used.
In situ hybridization
Tissues fixed in 4% buffered formaldehyde were embedded in paraffin and tissue sections processed for in situ hybridization using a routine method. Antisense or sense 35S-labeled riboprobes generated to ovine type II GnRH and GnRH-I receptors and 35S-labeled IGF-1 receptor (IGF-1R) oligonucleotide probes (as controls) were hybridized to sections. Riboprobes were generated using a Riboprobe system (T7 kit, Promega) using MRC1206 5'-CCTTGGGGGTCATCAGC and MRC1274 5'-CAGTCGTACCGGAGAGGGTAATACGACTCACTATAGGGCGA to generate the transcription template for the type II GnRH receptor antisense probe. MRC1275 5'-TAATACGACTCACTATAGGGCGACCTTGGGGGTCATCAGCG and MRC1273 5'-CAGTCGTACCGGAGAGGG were used to generate the template for type II GnRH receptor sense probe. For the GnRH-I receptor, sense probe MRC1266 5' GTGACTCTCCTAATCAGAATG and MRC1272 5' GTTATGTTCCACATTCCATCCTAATACGACTCACTATAGGGCGA were used. For the antisense probe, MRC1270 5' TAATACGACTCACTATAGGGCGAGTGACTCTCCTAATCAGAATG and MRC1271 5'-GTTATGTTCCACATTCCATCC were used. These target GnRH-I receptor exon 1. The oligonucleotide probes to IGF-1R were IGF-1R 5'-CAGGGCGTAGTTGTAGAAGAGTTTCCAGCCGCGGATGACCGTGAG (antisense) and 5'-CTCACGGTCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTG (sense).
The tissue sections were incubated overnight at 55 C in humidified chambers, treated with RNase A [20 µg/ml of 10 mM Tris/4 mM EDTA/0.5M NaCl (pH 8)] for 30 min at 37 C to remove nonhybridized probe, dehydrated, and exposed to preflashed Kodak XAR-5 film (Kodak, Hemel Hempstead, UK) at room temperature in a standard slide cassette. After exposure, films were developed using a film processor. Selected slides were dipped in liquid photographic emulsion (G5 diluted 1:1 wt/vol H2O, Ilford Ltd., Cheshire, UK), developed in D19 developer (Kodak) for 40 sec to 1 min, fixed in fixer GBX (Ilford), and finally counterstained with hematoxylin.
Percoll purification of gonadotropes
To produce an enriched population of gonadotropes, dispersed pituitary cells were incubated with TRH (Sigma) 2.76 x 107 M for 30 min to stimulate TSH and prolactin release to distinguish cell types via their unique density. The cells were then separated by a Percoll gradient method using a peristaltic pump (P1, Amersham Pharmacia Biotech International, Buckinghamshire, UK) and an auto densiflow (Searle, Fort Lee, NJ). An aliquot from each fraction was plated into glass-bottomed microwell dishes for 48 h at 37 C in 5% CO2 before assessing gonadotrope cell abundance by immunocytochemistry using an antibody to ovine LHß. The remaining cells were used for RT-PCR analysis.
| Results |
|---|
|
|
|---|
Organization of the type II GnRH receptor gene
The sheep type II GnRH receptor gene, including 5' flanking region, three coding exons, two introns, and 3' flanking region, is encoded within a region of 5.752 Kbp, and it is orientated in an antisense orientation between the PEX11ß and RBM8A genes. The full sequence was aligned with the known complete and fragmentary data from six other mammalian species to illustrate conservation of structure and novel features (Fig. 2A
). The 780-bp 5' flanking region exhibits a short 5' region of homology (more than 31 bp) to bovine ESTs such as GenBank no. AW652511 that encode PEX11. Exon 1 of the type II GnRH receptor gene is encoded by a 510-bp sequence and includes a premature stop codon (TAG) at position +373 relative to the translation start codon (ATG). This truncates the open reading frame within transmembrane domain (TMD)-3 of the predicted receptor protein (Fig. 2B
). The region encompassing the translation start codon (ATG) exhibits 70% homology to the consensus Kozak sequence (GCCRCCATGG) (23).
The ovine DNA sequence shows 94% homology to a bovine exon 1 genomic clone (GenBank BZ916855) that begins 36 bp downstream from the ATG start codon and extends 56 bp into intron 1. A splice donor consensus sequence (GTGAGT) occurs at the end of sheep exon 1. The other splice donor and acceptor sites flanking the coding exons diverge slightly from eukaryotic consensus sequences. Intron 1 consists of 2.821 Kbp of apparently unique ovine genomic sequence and it contains no significant open reading frames. A 360-bp section of intron 1 exhibits homology to sequences found in bovine ESTs such as GenBank no. AU098016. Some bovine and porcine ESTs extend into coding exon 2 (GenBank no. AV604131, BQ597390, BI404763, BI400927, and BF702918) and match the sheep sequence.
Sheep exon 2 is 157 bp long and contains a 51-bp deletion, compared with the human homologue. This deletion removes 17 codons in-frame from the region encoding ECL-2 of the hypothetical receptor protein. Intron 2 spans 631 bp, and it contains a sequence of approximately 100 bp present in multiple ovine DNA sequence fragments, indicative of a repeat sequence. Exon 3 is 413 bp long and encodes two potential TMDs and a cytoplasmic tail domain. The 3' flanking region extends for 440 bp, and it partially overlaps the 3' untranslated region of ovine RBM8A transcripts such as GenBank no. CB222195. These RBM8A transcripts use a polyadenylation signal motif (AATAAA) encoded 290 bp downstream from the type II GnRH receptor exon 3 stop codon (TGA). There is no polyadenylation addition (AATAAA) motif evident for receptor gene transcripts in the 440-bp 3' flanking region. However, a splice donor consensus sequence occurs 396 bp downstream from the exon 3 stop codon, and it is possible that splicing in the 3' untranslated region enables use of a polyadenylation signal farther downstream.
A full-length cDNA encompassing the ovine receptorcoding exons would be greater than 1080 bp long. There are currently no ovine ESTs corresponding to full-length sheep type II GnRH receptor cDNA in the GenBank database. The 1080-bp sheep cDNA coding region predicted from our genomic sequence is 85% identical to primate type II GnRH receptor cDNA, compared with 93% sequence identity between human and marmoset cDNA sequences. If the premature stop codon is disregarded, the sheep gene encodes a 7-TMD protein of 358 amino acid residues. Figure 2B
shows the domain structure of the proteins encoded by the sheep and human type II receptor sequences.
Structure of the promoter region of the sheep type II GnRH receptor gene
The sequence of the 5' flanking region 780 bp upstream from the ATG start site was analyzed for predicted transcription binding sites and compared with the corresponding human sequence (Fig. 3
). The 5' flanking region exhibit two stretches of clear sequence homology (>80% identity between sheep and human), termed zone 1 at 640 to 770 and zone 2 at 370 to 440 relative to the translation start codon in the sheep gene. These regions contain putative stimulating protein-1 (SP-1), and SP-1 and myogenic enhancer factor sites, respectively, but the Pit-1 binding site present in the human gene (AAATATTCAT) at position 440 exhibits two base differences in the sheep gene (AAATATTCTG, at 434; shown as Pit-1 related, Fig. 3
). This difference (<70% identity to Pit-1 consensus) is probably sufficient to inactivate the sheep sequence as a Pit-1 binding site required for pituitary-specific gene expression. A third zone of weaker homology (30 to 180) includes a GATA-1 and retinoic acid receptor transcription binding site in the sheep sequence that is absent at the equivalent location in the human gene; a GATA-1 is present elsewhere in the human gene (Fig. 3
).
|
|
|
Pattern of receptor gene expression in sheep tissues
The tissue distribution of the type II GnRH receptor gene expression in sheep was analyzed by RT-PCR amplification of different regions of the receptor gene using cDNA generated from Soay sheep brain areas (hypothalamus, forebrain, and brain stem), pituitary gland, ovary, testis, adrenal gland, and liver. This involved the use of a wide range of primers designed to selectively amplify long and short sequences of the type II receptor (Fig. 6A
). As a positive control for the methodology, RT-PCR was performed on the same cDNA samples using primers designed to localize expression of the GnRH I receptor gene (Fig. 6B
). The RT-PCR analysis of the ovine type II GnRH receptor produced no detectable amplified bands for any of the tissues, indicating that neither mature spliced transcripts nor alternative transcripts are produced in sheep brain, pituitary, testis, and ovary (data not shown). Only unspliced DNA hybridized to the exon 1 and 2 probes on the Southern blots.
|
Northern blots using poly-A+ mRNA from pituitary glands and testes from sexually active and inactive Soay sheep yielded slightly different results. A band of 0.55 kb was seen in both sexually active and inactive testes when probed with an oligonucleotide probe to exon 1 on the type II GnRH receptor gene, and this was absent in the pituitary tissue (Fig. 7
). No bands were seen in either tissue when probed for exons 2 or 3 (data not shown). As expected, the GnRH-I receptor probes hybridized to a 2.4-kb transcript in sheep pituitary gland mRNA (data not shown).
|
|
| Discussion |
|---|
|
|
|---|
The sequence analysis predicts that no full-length mRNA transcripts and corresponding proteins will exist in sheep. However, the novel aspects of the sheep gene are well illustrated by alignment of the putative amino acid sequence with the other known type II GnRH receptors proteins (Fig. 2
). This shows that the highest degree of sequence conservation in amino acid positions is within the TMDs.
In contrast, several divergent features occur in the sheep. First is the predicted presence of an extra amino acid residue (alanine) at position 14 close to the N terminus and the absence of one amino acid at position 78 in TMD-2, which is represented as an arginine or a threonine in primates (13, 14, 16). Second, the TMD-3 contains a premature stop codon indicating premature termination of transcription. The human, chimpanzee, and bovine sequences contain a stop codon in ECL-2 (16). Third, at the intracellular end of TMD-3, the conserved DRY motif (26), which is modified to DRS in mammalian GnRH-I receptors and DRQ in other mammalian type II GnRH receptors, is changed in sheep to DHQ at position 139. No GPCR within the rhodopsin family, except platelet activating factor receptor (27), shows a difference in this motif. The arginine residue here is essential for ligand-mediated activation of the receptor (26); thus, the change to histidine is expected to disrupt ligand-mediated activation. 4. In the predicted sheep sequence, ECL-2 shows a 17-amino acid deletion from positions 180196. Within GPCRs, ECL-2 is variable in length. In GnRH receptors, this region is usually involved in the formation of disulfide bonds between cysteine residues in the N terminus and/or TMD-1 of the-folded protein. These bonds are necessary to stabilize receptor structure (28), and the deletion would be expected to have repercussions on receptor activation. However, a deletion in ECL-2 does not affect Xenopus GnRH receptor function (Troskie, B. E., N. Illing, K. Findlayson, S. Lowe, A. Katz, and R. Millar, unpublished observations; GenBank accession no. AF257320) or that of the human GnRH-I receptor (30). Fifth, in intracellular loop 3 a conserved histidine is absent in position 241. The consequence of this is unknown, but an effect on G protein coupling is unlikely because only residues adjacent to TMD-5 and TMD-6 have been shown to affect coupling in the human GnRH-I receptor (31). A sixth feature is that ECL-3, important for ligand interaction (32), is notably conserved in the sheep sequence. Seventh, the DPXXY motif in TMD-7, important for interactions with G proteins and activation of intracellular signaling (33), is altered to DPXXC. Eighth, the sheep GnRH-II receptor gene encodes a potential PDZ domain-binding motif (TSL) at position 379381. The cytoplasmic tail of the marmoset type II GnRH receptor contains a potential class 1 postsynaptic density-disc large-zonula occludans (PDZ) domain-binding motif (ITSI) (34), which can be bound by PDZ domain-containing proteins. GnRH-I receptors contain a class II PDZ domain-binding motif (YFSL) (34). This may be important for maintaining correct spatial arrangement of domains and alteration in the sheep would again potentially affect receptor function (35). Finally, the last feature is that the cytoplasmic tail domain is shorter than other GnRH-II receptors (55 amino acid residues in sheep, compared with 57 in rhesus, green monkey, and human, and 58 in marmoset).
The inference from this abstracted species comparison is that the sheep type II GnRH receptor gene carries multiple changes that would impact on the ancestral function as a 7-TMD receptor for the GnRH-II decapeptide ligand. Besides the presence of the premature stop codon midway through the gene that would disrupt transcription and a major deletion that would affect the structure of ECL-2 region of the putative protein, the predicted amino acid sequence shows nonconservative changes in important motifs such as DRY and DPXXY that are required for normal receptor function. These novel features suggest that the sheep gene no longer encodes a functional type II GnRH receptor. In this respect the sheep resembles human, chimpanzee, cow, rat, and mouse in carrying a redundant receptor, but the molecular/structural events at the level of the gene that have produced the loss of gene function in these mammalian species are very different (16).
The expectation based on gene structure is that no full-length mRNA transcripts for the type II GnRH receptor will exist in sheep tissues. This is strongly supported by the results produced by RT-PCR on mRNA extracted from ovine brain, pituitary gland, testis, and other tissues. The PCRs using primers flanking the type II GnRH receptor gene produced no bands of the expected size for either full-length or spliced transcripts. Southern and Northern blot analyses also failed to produce evidence of full-length transcripts, although partial transcripts were evident in pituitary and testis. These data clearly indicate that the full receptor is not transcribed in the sheep, but shorter transcripts may be produced that could be translated into truncated, two transmembrane domain proteins. These might interact with GnRH-I receptors and/or have a paracrine role within the pituitary or testis tissues, although there is currently no functional evidence for this. Alternative transcripts have been described for other GnRH receptors (18, 36, 37) and other GPCRs (38, 39).
The original proposal that there is a functional full-length, 7-TMD, type II GnRH receptor in sheep was based on the observation that the GnRH-II peptide stimulates LH and FSH secretion in vivo. In addition, a polyclonal antiserum generated to an epitope in ECL-3 of the type II GnRH receptor (encoded by exon 3) immunocytochemically labeled cells in the sheep pituitary gland in an apparent cell-specific manner, similar to the staining for LHß in gonadotropes (13). It is now recognized, however, that exogenous GnRH-II activates gonadotropin secretion through the classical GnRH-I receptor expressed on the gonadotrope, and this response occurs only after the administration of a pharmacological dose of the peptide (40). Moreover, there is no evidence that the GnRH-II peptide normally reaches the pituitary gland in sheep, and experimental treatments with GnRH-II, combined with different physiological doses of GnRH-I, do not modulate the gonadotropin response (40). The deductions based on the use of the ECL-3 antiserum also may be misleading because the 12-amino acid sequence to which the antibody was raised also contains an epitope of RLIM transcription factor (LTEVPP, amino acid residues 199204, GenBank accession no. Q9NVW2). RLIM is a RING H2 zinc finger protein that acts as a negative coregulator for LIM homeodomain transcription factors (41), and that has been shown to be expressed in the pituitary gland (i.e. see GenBank accession no. AV747831).
This reassessment means there is no definitive evidence for a role of type II GnRH receptor in the sheep gonadotrope. This fits with the current molecular data showing the absence of full-length transcripts or transcripts containing exon 3 in the pituitary tissue or in an enriched population of gonadotropes. It also fits with the observation that the 5' flanking region of the sheep GnRH-II receptor gene lacks a Pit1 binding site in zone 2 of the promotor. Sheep and human GnRH-I receptors possess Pit-1 transcription factor binding sites in the 5' flanking region, that play a critical role in pituitary-specific gene expression (42). Overall, the many lines of evidence definitively demonstrate that the type II GnRH receptor is not involved the physiological regulation of gonadotropin secretion in sheep. Furthermore, it is unlikely that the full receptor protein is involved in the regulation of the other putative roles the GnRH II decapeptide in neuromodulation and/or the control of sexual behavior.
In conclusion, this study demonstrates that the sheep type II GnRH receptor gene has accumulated more novel variations in nucleotide sequence structure than in any other mammalian species. The presence of a stop codon in the middle of the gene, and the failure to detect full-length mRNA transcripts from the gene in any tissue shows that a functional, 7-TMD, GnRH-II receptor protein is no longer produced in this species. This appears to be a consistent trait in the ovine family based on the demonstration that the gene structure was similar in a wide range of sheep breeds differing markedly in their reproductive physiology and ancestry. Short transcripts derived from the type II GnRH receptor gene were observed in the pituitary gland and testis, and it remains to be established whether these are translated into smaller proteins that function locally. We previously hypothesized that the type II GnRH receptor gene will show unusual species diversity in structure in mammals due to evolutionary redundancy (16). The data for the sheep are consistent with this hypothesis.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: ECL, Extracellular loop; EST, expressed sequence tag; GPCR, G protein-coupled receptor; IGF-1R, IGF-1 receptor; LD-PCR, long-distance PCR; PDZ, postsynaptic density-disc large-zonula occludans; TMD, transmembrane domain; 7-TMD, seven-transmembrane domain.
Received December 1, 2003.
Accepted for publication January 19, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. A. Flanagan, C.-C. Chen, M. Coetsee, S. Mamputha, K. E. Whitlock, N. Bredenkamp, L. Grosenick, R. D. Fernald, and N. Illing Expression, Structure, Function, and Evolution of Gonadotropin-Releasing Hormone (GnRH) Receptors GnRH-R1SHS and GnRH-R2PEY in the Teleost, Astatotilapia burtoni Endocrinology, October 1, 2007; 148(10): 5060 - 5071. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Faurholm, S. Cochrane, R. R Millar, and A. A Katz Gene structure and promoter functional analysis of the marmoset type II GnRH receptor J. Mol. Endocrinol., August 1, 2007; 39(2): 91 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C.K. Leung and J.-H. Choi Endocrine signaling in ovarian surface epithelium and cancer Hum. Reprod. Update, March 1, 2007; 13(2): 143 - 162. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Morgan, R. Sellar, A. J. Pawson, Z.-L. Lu, and R. P. Millar Bovine and Ovine Gonadotropin-Releasing Hormone (GnRH)-II Ligand Precursors and Type II GnRH Receptor Genes Are Functionally Inactivated Endocrinology, November 1, 2006; 147(11): 5041 - 5051. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Barnett, T. M. Bunnell, R. P. Millar, and D. H. Abbott Gonadotropin-Releasing Hormone II Stimulates Female Sexual Behavior in Marmoset Monkeys Endocrinology, January 1, 2006; 147(1): 615 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Eicke, A. R Gunthert, V. Viereck, D. Siebold, M. Behe, T. Becker, G. Emons, and C. Grundker GnRH-II receptor-like antigenicity in human placenta and in cancers of the human reproductive organs Eur. J. Endocrinol., October 1, 2005; 153(4): 605 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Pawson, S. Maudsley, K. Morgan, L. Davidson, Z. Naor, and R. P. Millar Inhibition of Human Type I Gonadotropin-Releasing Hormone Receptor (GnRHR) Function by Expression of a Human Type II GnRHR Gene Fragment Endocrinology, June 1, 2005; 146(6): 2639 - 2649. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Cheng and P. C. K. Leung Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans Endocr. Rev., April 1, 2005; 26(2): 283 - 306. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |