help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1625
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gault, P. M.
Right arrow Articles by Lincoln, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gault, P. M.
Right arrow Articles by Lincoln, G. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Endocrinology Vol. 145, No. 5 2362-2374
Copyright © 2004 by The Endocrine Society

Sheep Exhibit Novel Variations in the Organization of the Mammalian Type II Gonadotropin-Releasing Hormone Receptor Gene

Paula M. Gault, Kevin Morgan, Adam J. Pawson, Robert P. Millar and Gerald A. Lincoln

Medical Research Council Human Reproductive Sciences Unit, University of Edinburgh Academic Centre, Edinburgh EH16 4SB, United Kingdom

Address all correspondence and requests for reprints to: Gerald A. Lincoln, Medical Research Council Human Reproductive Sciences Unit, University of Edinburgh Academic Centre, Edinburgh EH16 4SB, United Kingdom. E-mail: g.lincoln{at}hrsu.mrc.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Species-specific differences in genes encoding type II GnRH receptor indicate that a functional hepta-helical receptor is produced in monkeys but not in rodents, cows, chimpanzees, or humans. To further investigate the extent of evolutionary differences, we sequenced the type II GnRH receptor gene from wild-type Soay sheep. The gene was isolated by long-distance PCR using primers to PEX11ß and RBM8A genes known to flank type II GnRH receptor gene homologues. The gene spans 5.7-kb DNA and was sequenced after shot-gun subcloning. Its novel features include absence of a Pit-1 transcription factor binding site, a premature stop codon (TAG) in exon 1, an in-frame deletion of 51 bp (17 codons) in exon 2, and several nonconservative codon changes. Sheep breed variation in the gene was assessed using genomic DNA in PCR-restriction digest assays for the premature stop codon and in a PCR assay for the deletion. Both characteristics were present in all 15 breeds tested. Receptor gene expression was investigated using poly-A+ RNA Northern analysis, RT-PCR, and in situ hybridization. An oligonucleotide probe to exon 1 revealed an alternative transcript in testis but not in pituitary gland. No transcripts in testis or pituitary were detectable using an exon 2–3 probe. All tissues examined including multiple brain areas and gonadotrope-enriched cell cultures were negative for type II GnRH receptor in RT-PCR. Testis and pituitary sections were negative with exon 1 riboprobes and exon 1 or 2–3 oligonucleotide probes in in situ hybridization. A hepta-helical type II GnRH receptor is therefore not expressed from this sheep gene.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE DECAPEPTIDE pGLU-HIS-TRP-SER-HIS-GLY-TRP-TYR-PRO-GLY.NH2 was originally isolated from chicken brain and was named chicken GnRH-II (1). The GnRH-II peptide is the most universally demonstrable of the GnRH ligands in vertebrates, and the genes or cDNAs encoding the peptide precursor have since been characterized in teleosts, amphibians, and mammals (2, 3, 4). The sequence of the decapeptide has remained evolutionarily unchanged in vertebrates in which an intact precursor gene has been retained. This conservation across a broad range of species and the widespread distribution of the GnRH-II peptide in a variety of tissues suggests an important function. However, the physiological roles of GnRH-II remain poorly understood. Diverse actions such as regulation of gonadotropin release (5, 6, 7), regulation of neurotransmission (8), and stimulation of reproductive behavior (4, 9, 10) have been proposed.

A specific type II GnRH receptor with a high affinity for GnRH-II was first demonstrated in amphibians (11, 12) in which it was shown to be a seven-transmembrane domain (7-TMD, or hepta-helical) protein belonging to the rhodopsin-like G protein-coupled receptor (GPCR) subfamily. The type II GnRH receptor cDNA was subsequently cloned from a variety of primates: marmoset (13), African green monkey, and rhesus monkey (14). This was achieved through PCR, using degenerate primers to extracellular loop (ECL)-3 coupled with 3' and 5' rapid amplification of cDNA ends. The primate type II GnRH receptor amino acid sequences share a 60% identity with amphibian type II GnRH receptors and 40% identity with the human GnRH-I receptor. However, the mammalian GnRH-I receptors are unique within the GPCR superfamily in that they have no cytoplasmic carboxyl tail domain. All nonmammalian GnRH-I and all type II GnRH receptors do possess a cytoplasmic tail, important for agonist-dependent phosphorylation, desensitization, and internalization (15).

Notable species-specific differences in the structure of the mammalian GnRH receptor gene family have been identified. The human type II GnRH receptor gene homologue is disrupted by the presence of a frame shift in exon 1 and a premature stop codon in exon 2 (16). Although a complete sequence for a nonprimate mammalian type II GnRH receptor gene has not yet been elucidated, expressed sequence tags (ESTs) from bovine tissue indicate that the presence of the premature stop codon in exon 2 is not limited to humans. However, porcine and canine DNA sequence fragments (GenBank accession no. CF411223) do not possess the premature stop codon. The type II GnRH receptor gene appears to have been deleted from mouse genomic DNA (GenBank AL772162), whereas a gene remnant is present in rat genomic DNA (GenBank AC131863) (17). How these species differences impact on the physiological regulation of the reproductive axis is unknown. For the GnRH-I system, alternative transcripts produced by skipping GnRH-I receptor gene exon 2 generate a protein that interferes with the binding of the GnRH-I peptide to the GnRH-I receptor in humans (18) and possibly in sheep (19) and mice (20), thus various alternative processing may occur for the GnRH-II receptor to produce functional proteins distinct from the ancestral hepta-helical receptor protein. The variation is likely to be both species specific and tissue specific.

To further investigate such variation, we fully sequenced the type II GnRH receptor gene in the sheep using tissues from a wild-type breed, the Soay sheep. This involved developing a PCR strategy to clone the gene from genomic DNA. Several novel features were found including a stop codon in exon 1 and a major deletion in exon 2 that were confirmed to be present in a wide range of different sheep breeds, indicating that this is a structural characteristic for GnRH-II receptor gene in the ovine family. A specific restriction digest study indicated that only one copy of the gene is likely to be present in the ovine genome. Tissue localization of receptor gene transcripts were investigated using Northern blot analysis, RT-PCR, and in situ hybridization in brain, pituitary gland, isolated gonadotropes, and testes to provide insight into potential functions, or lack of, for GnRH-II receptor proteins in the complex control of reproductive physiology and behavior.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue samples
Tissues were collected from sheep at time of postmortem, as licensed under the Animal Scientific Procedures Act (1986) and either frozen on dry ice for nucleic acid isolation or fixed in phosphate-buffered formaldehyde for histological studies.

Isolation of DNA and RNA
High-molecular-weight DNA was purified from frozen tissue by grinding it into powder on dry ice followed by incubation in proteinase K solution [100 mM NaCl, 10 mM Tris (pH 8.0), 25 mM EDTA, 0.5% sodium dodecyl sulfate, 0.1 mg/ml proteinase K, Sigma, Poole, UK] at 50 C overnight, using 2.0 ml solution per 0.1 g of tissue. Protein was removed by phenol-chloroform extraction, and DNA was precipitated from the aqueous phase with two volumes of 100% ethanol. Contaminating RNA was digested by incubation with RNase A (0.1 µg/ml 37 C for 1 h, Sigma).

RNA was purified from homogenized tissues using Tri-Reagent (Sigma) according to the method of Chomczynski and Sacchi (21). The RNA yield was estimated using UV spectrophotometry (GeneQuant pro machine, Amersham Pharmacia Biotech, Little Chalfont, UK). PolyA+ RNA was prepared from 1.25 mg total RNA using oligo-dT-spin-column chromatography (Amersham Pharmacia Biotech).

Long-distance PCR (LD-PCR)
Nested oligonucleotide primers were designed according to sequences encoding PEX11ß (MRC1063 5'-CTGTTTCTGTAACTCAGGACTGGC, MRC1064 5'-GAAGCGGACCCAGGCGTCCAT) and RBM8A genes (MRC1065 5'-AGAGGTGGTCGAAGACGCAGC, MRC1066 5'-ACAAGGAGGCCCAGGCTGCTA). (See GenBank accession number AL1060282 for PEX11ß sequence at 77,808–84,325 bp and RBM8A sequence at 69,072–69,158 bp.) These primers enabled amplification of the chromosomal region containing the ovine type II GnRH receptor gene (Fig. 1Go). LD-PCR was performed using a commercial kit (Expand HiFidel system, Roche Molecular Biochemicals, Roche Diagnostics Ltd., East Sussex, UK).



View larger version (57K):
[in this window]
[in a new window]
 
FIG. 1. A, Diagram illustrating the LD-PCR strategy used to amplify the region between the PEX11ß and RBM8A genes in sheep genomic DNA. Locations of nested primers in PEX11ß and RBM8A and the size (bp) of the predicted products are indicated. B, Agarose gel electrophoresis of ovine genomic DNA amplified between PEX11ß and RBM8A. Lane 1, 1-kb ladder with sizes indicated; lanes 2–7, products of individual LD-PCR targeting the region between PEX11ß and RBM8A. C, Results of PEX11ß to RBM8A LD-PCR and subcloning: gel of sheep PEX11ß to type II GnRH receptor exon 2 DNA subclones in pGEM T-Easy digested with EcoR1. Lane 1, Ladder; lanes 2–12, individual subclones; subclones containing the predicted transcript are shown (asterisk). D, Southern blot of gel from above (B) hybridized with marmoset type II GnRH receptor cDNA probe. Cloned 4.15-kb DNA fragments in lanes 2 and 9 contain ovine type II GnRH receptor gene sequence. E, Agarose gel electrophoresis of ovine type II GnRH receptor exon 3-RBM8A PCR products. Lane 1, Ladder; lanes 2–3, PCR products generated using nested RBM8A primers.

 
Amplified DNA products were separated on a 1% agarose gel and Southern blotted using marmoset type II receptor cDNA (13) as a probe to enable identification of homologous DNA bands. DNA fragments were excised from a similar gel, purified, and the product used as a template for two nested PCRs, designed to produce two partial receptor gene fragments. The first nested PCR was performed using the LD-PCR protocol with MRC1064 (located in PEX11ß) and MRC1070 5'-GGTACTGGTTCTCTCCCAC derived from sequence obtained by ECL-3 degenerate primer walking into the sheep type II GnRH receptor gene (sequence located in exon 2). Amplified DNA products were Southern blotted and probed with marmoset type II GnRH receptor cDNA (13). The relevant DNA fragments were excised from a similar gel, purified, and the product ligated into pGEM-T Easy Vector (Promega Ltd., Southampton, UK) before transformation into Escherichia coli XL-1 blue (Stratagene, Biocrest B.V., Amsterdam, The Netherlands). Shotgun subcloning was performed on the cloned 4.1-kb fragment (spanning PEX11ß to type II GnRH receptor exon 2, Fig. 1Go). The subclones were generated by restriction endonuclease digestion using enzymes chosen to cut within the insert but not within the plasmid vector, followed by religation and transformation into E. coli XL-1 Blue. Cloned DNAs were subjected to automated DNA sequencing, and data were analyzed using GeneJockey II software (Biosoft, Cambridge, UK). A shorter gene fragment was produced by the second nested PCR, using MRC1067 5'-CCTCTGGATCCTCTCTTCTGTGGGGCCTT and MRC1065 (RBM8A). This 1-kb PCR product (spanning type II GnRH receptor exon 2 to RBM8A) was sequenced directly by primer walking. By aligning the sequences using GeneJockey II software (Biosoft), a full-length genomic sequence was assembled. The gene sequence was verified by repeating DNA sequence analyses several times in both directions.

RT-PCR
Total RNA (5 µg) from different brain areas (forebrain, midbrain, hindbrain, hypothalamus) and several other tissues (pituitary gland, ovary, testes, adrenal gland, and liver) was used to create cDNA, using random primers and Superscript II RNase H-reverse transcriptase (Invitrogen, Paisley, UK), as per manufacturer’s instructions. Oligonucleotide primers were designed to enable amplification of full-length receptor cDNA and subregions of the coding sequence (Fig. 2Go). PCR amplification of these regions was performed using BioTaq DNA polymerase [with KCl buffer, MgCl2, and deoxynucleotide triphosphates, Bioline, London, UK]. Samples (0.25 µg cDNA) were preheated to 94 C for 5 min and then up to 50 cycles of 94 C for 1 min, 58 C for 1 min, and 72 C for 1 min. A final extension was performed at 72 C for 10 min. Amplified DNA products were resolved on a 1% agarose gel. Oligonucleotide probes (MRC1276 5'-GATTCAGTTGTAGTTTGTGGGGATCCTGAT for exon 2–3 of the GnRH-I receptor, MRC1194 5'-TTACAGGCAGGAAAGCTGCGGCCTACATGG for exon 1 and MRC 1262 5'-ATTCACCTGCAGGGGCTGGGCTCCCCTTCC for exon 2–3 of the type II GnRH receptor gene) were designed to enable identification of cDNA products by hybridization to Southern blots of electrophoresed PCR products.



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 2. A, Alignment of predicted type II GnRH receptor amino acid sequences from different species. TMD1–7 (indicated by boxes) were deduced according to the rhodopsin crystal structure model. Significant features of the ovine type II GnRH receptor sequence are marked with asterisks. HII, human; GMII, green monkey; RMII, rhesus macaque; MII, marmoset; OII, sheep; Cow II, bovine EST AV064131; Pig II, porcine EST BI400927. B, Summary of protein domain structures encoded by sheep and human type II GnRH receptor gene sequences. In both species, exon 1 encodes the first four TMDs, exon 2 encodes TMD5, and exon 3 encodes TMD6 and -7. Locations of premature stop codons are indicated by black circles. ECL-2 is shorter in the sheep due to a 17-codon deletion.

 
DNA database searches
The National Center for Biotechnology Information GenBank DNA databases were screened on-line using Basic Local Alignment Search Tool (BLAST) software (National Institutes of Health) (22). The presence of putative transcription factor binding sites in the 5' flanking region of the sheep and human type II GnRH receptor genes were analyzed using Genomatix MatInspector software (http://www.genomatix.de).

PCR-restriction endonuclease-digestion assays
Genomic DNA from wild-type Soay sheep was used for type II GnRH receptor gene cloning. To test whether the gene from this breed is representative of the ovine family, genomic DNA was extracted from 15 other breeds and screened using restriction enzyme/PCR assays. The breeds of sheep used were obtained from specialist breeders and were varieties of European domestic breeds, with the exception of the Barbados Hair sheep, which is a tropical-adapted type that has been isolated from the European breeds for at least 2000 yr. Breeds analyzed can be classified into three groups: 1) Northern seasonal breeds: Suffolk, Herdwick, Cheviot, East Freisland, Vhann, Shetland, Quessant, Finish Landrace, and Texel; 2) Southern less seasonal breeds: Dorset, Romanov, Ryeland, Booroola /Merino, and Barbados Hair; and 3) primitive breeds: Jackob and Soay.

Oligonucleotide primers were designed to generate a defined restriction enzyme product dependent on the presence, or absence, of the premature stop codon (TAG) in the ovine type II GnRH receptor gene. Two different sets of primers were designed with one member of each pair containing a single base mismatch: Stu-1 (MRC1180 sense primer 5'-CCTGGAATATCACTGTTCAATGGCTGGC, MRC1197 antisense primer, 5'-CCAATAATTACAGGCAGGAAAGCTGAGGC) and Sfc-1 (MRC1177 sense primer 5'-CCTACCAGCTGAGCGCAGTCC, MRC1198 antisense primer 5'-CACGTTCCTGAAACTAGTAGCCCTG). Generation of either a Stu-I or Sfc-I restriction enzyme cut site by PCR amplification of sheep DNA depended on the occurrence of different nucleotides within the premature stop codon (TAG), such that if the stop codon is present, then the amplified DNA fragment can be cleaved from 110 bp to produce 85-bp and 35-bp fragments.

Restriction endonuclease digestion of genomic DNA
The DNA sequence between PEX11ß and RBM8A, containing the ovine type II GnRH receptor gene, was investigated using the restriction enzyme Sau3AI that potentially cuts either side of exon 2 and analyzed using GeneJockey II software (Biosoft). For the digests, 6 µg of Soay genomic DNA was incubated in a 35-µl reaction containing 3.5 µl 10 x buffer, 1 µg/µl BSA, and 1.75 µl of Sau3AI for 16 h at 37 C overlaid with mineral oil. The digested DNA products were separated on an a 1% agarose gel and Southern blotted using a DNA probe synthesized from sheep genomic DNA using the primers MRC1217 5'-CCTTGGGGGTCATCAGCGG and MRC1218 5'-GTGAGTGTACGACATGCAAAG located in exon 1 or probed with a mixture of labeled oligos MRC1259 5'-CATCTATAACCTCTTCACCTTCTGCTGCCT, MRC1260 5'-AGGCAGCAGAAGGTGAAGAGGTTATAGATG, and MRC1261 5'CAGATGGTCATTGCAGTCAGTGGCCTCAGA.

Southern blotting
DNA gels were capillary blotted onto Hybond-N+ (Amersham Pharmacia Biotech). All radiolabeled probes were prepared using 50 µCi {alpha}32P-dATP (2000 Ci/mmol, Amersham Pharmacia Biotech) and random prime labeling (Roche Molecular Biochemicals) or terminal transferase 3' end-labeling (Promega). Probes were separated from unincorporated radionucleotide using Sephadex G50 (cDNA probes) or Sephadex G25 fine (30-mer oligonucleotide probes) in microspin columns (Amersham Pharmacia Biotech). The cDNA probe templates were isolated from PCR by agarose gel electrophoresis in 1 x Tris-acetate EDTA, band excision from the gel, and spin-elution in Ultrafree 0.45 µm filter units (Millipore, Bedford, MA). Purified probes were denatured by boiling for 2 min and rapid cooling on ice before addition to the prehybridized filters. The cDNA probes were hybridized to filters at 55 C, and 30-mer oligonucleotide probes were used at 50 C, in prehybridization buffer, with rotation overnight.

Northern blotting
Total RNA (30 µg) or polyA+ RNA (1–15 µg) was size fractionated by denaturing 1.1% agarose gel electrophoresis in 1 x 3[N-morpholino]propanesulfonic acid buffer containing 3% formaldehyde according to standard procedures. Ethidium bromide was added to all samples so that the size of prominent bands or size markers could be estimated after UV transillumination (RNA markers, Life Technologies, Inc.-BRL, Paisley, UK). Gels were rinsed with diethylpyrocarbonate-treated water before blotting, fixing, and probing as described above. A positive control glyceraldehyde 3-phosphate dehydrogenase cDNA probe was generated using the primers MRC1224 5'-CTGCTGACGCTCCCATGTTC and MRC1225 5'-ATGCCAGTGAGCTTCCCGTT based on sheep cDNA sequence data. For GnRH-I receptor, an oligonucleotide probe in exon 1 MRC1265 5'-GTGTTAGTAGGATGCTGCTGTTGATCGCTG and exon 2–3 MRC1276 5'-GATTCAGTTGTAGTTTGTGGGGATCCTGAT was used. For the type II GnRH receptor, an oligonucleotide probe to exon 1 MRC1194 5'-TTACAGGCAGGAAAGCTGCGGCCTACATGG and exon 3 MRC1071 5'-GTCCTGCTGACCTTCATCCTCTGCTGGA was used.

In situ hybridization
Tissues fixed in 4% buffered formaldehyde were embedded in paraffin and tissue sections processed for in situ hybridization using a routine method. Antisense or sense 35S-labeled riboprobes generated to ovine type II GnRH and GnRH-I receptors and 35S-labeled IGF-1 receptor (IGF-1R) oligonucleotide probes (as controls) were hybridized to sections. Riboprobes were generated using a Riboprobe system (T7 kit, Promega) using MRC1206 5'-CCTTGGGGGTCATCAGC and MRC1274 5'-CAGTCGTACCGGAGAGGGTAATACGACTCACTATAGGGCGA to generate the transcription template for the type II GnRH receptor antisense probe. MRC1275 5'-TAATACGACTCACTATAGGGCGACCTTGGGGGTCATCAGCG and MRC1273 5'-CAGTCGTACCGGAGAGGG were used to generate the template for type II GnRH receptor sense probe. For the GnRH-I receptor, sense probe MRC1266 5' GTGACTCTCCTAATCAGAATG and MRC1272 5' GTTATGTTCCACATTCCATCCTAATACGACTCACTATAGGGCGA were used. For the antisense probe, MRC1270 5' TAATACGACTCACTATAGGGCGAGTGACTCTCCTAATCAGAATG and MRC1271 5'-GTTATGTTCCACATTCCATCC were used. These target GnRH-I receptor exon 1. The oligonucleotide probes to IGF-1R were IGF-1R 5'-CAGGGCGTAGTTGTAGAAGAGTTTCCAGCCGCGGATGACCGTGAG (antisense) and 5'-CTCACGGTCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTG (sense).

The tissue sections were incubated overnight at 55 C in humidified chambers, treated with RNase A [20 µg/ml of 10 mM Tris/4 mM EDTA/0.5M NaCl (pH 8)] for 30 min at 37 C to remove nonhybridized probe, dehydrated, and exposed to preflashed Kodak XAR-5 film (Kodak, Hemel Hempstead, UK) at room temperature in a standard slide cassette. After exposure, films were developed using a film processor. Selected slides were dipped in liquid photographic emulsion (G5 diluted 1:1 wt/vol H2O, Ilford Ltd., Cheshire, UK), developed in D19 developer (Kodak) for 40 sec to 1 min, fixed in fixer GBX (Ilford), and finally counterstained with hematoxylin.

Percoll purification of gonadotropes
To produce an enriched population of gonadotropes, dispersed pituitary cells were incubated with TRH (Sigma) 2.76 x 10–7 M for 30 min to stimulate TSH and prolactin release to distinguish cell types via their unique density. The cells were then separated by a Percoll gradient method using a peristaltic pump (P1, Amersham Pharmacia Biotech International, Buckinghamshire, UK) and an auto densiflow (Searle, Fort Lee, NJ). An aliquot from each fraction was plated into glass-bottomed microwell dishes for 48 h at 37 C in 5% CO2 before assessing gonadotrope cell abundance by immunocytochemistry using an antibody to ovine LHß. The remaining cells were used for RT-PCR analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning the ovine type II GnRH receptor gene
Preliminary attempts at cloning the ovine type II GnRH receptor followed methods used elsewhere, namely design of degenerate primers to ECL-3 followed by 3' and 5' rapid amplification of cDNA ends (13, 14). However, this approach was only partially successful, yielding 320 bp of sequence encoding exon 2 and part of exon 3. We therefore employed a new approach using LD-PCR primers based on the arrangement of genes flanking the receptor in the human genome, namely the PEX11ß and RBM8A genes (Fig. 1Go, A and B). LD-PCR between PEX11ß and RBM8A yielded a 5.725-kb product. Subclones carrying the LD-PCR product for PEX11ß to exon 2 were identified by Southern blot to the GnRH-II receptor and provided a 4.15-kb band (Fig. 1Go, C and D). Using nested primers for further LD-PCRs overlapping ovine genomic DNA fragments were generated (Fig. 1EGo) and subsequently sequenced. By aligning the DNA sequences using GeneJockey II software (Biosoft), a full-length genomic sequence for the ovine type II GnRH receptor was assembled.

Organization of the type II GnRH receptor gene
The sheep type II GnRH receptor gene, including 5' flanking region, three coding exons, two introns, and 3' flanking region, is encoded within a region of 5.752 Kbp, and it is orientated in an antisense orientation between the PEX11ß and RBM8A genes. The full sequence was aligned with the known complete and fragmentary data from six other mammalian species to illustrate conservation of structure and novel features (Fig. 2AGo). The 780-bp 5' flanking region exhibits a short 5' region of homology (more than 31 bp) to bovine ESTs such as GenBank no. AW652511 that encode PEX11. Exon 1 of the type II GnRH receptor gene is encoded by a 510-bp sequence and includes a premature stop codon (TAG) at position +373 relative to the translation start codon (ATG). This truncates the open reading frame within transmembrane domain (TMD)-3 of the predicted receptor protein (Fig. 2BGo). The region encompassing the translation start codon (ATG) exhibits 70% homology to the consensus Kozak sequence (GCCRCCATGG) (23).

The ovine DNA sequence shows 94% homology to a bovine exon 1 genomic clone (GenBank BZ916855) that begins 36 bp downstream from the ATG start codon and extends 56 bp into intron 1. A splice donor consensus sequence (GTGAGT) occurs at the end of sheep exon 1. The other splice donor and acceptor sites flanking the coding exons diverge slightly from eukaryotic consensus sequences. Intron 1 consists of 2.821 Kbp of apparently unique ovine genomic sequence and it contains no significant open reading frames. A 360-bp section of intron 1 exhibits homology to sequences found in bovine ESTs such as GenBank no. AU098016. Some bovine and porcine ESTs extend into coding exon 2 (GenBank no. AV604131, BQ597390, BI404763, BI400927, and BF702918) and match the sheep sequence.

Sheep exon 2 is 157 bp long and contains a 51-bp deletion, compared with the human homologue. This deletion removes 17 codons in-frame from the region encoding ECL-2 of the hypothetical receptor protein. Intron 2 spans 631 bp, and it contains a sequence of approximately 100 bp present in multiple ovine DNA sequence fragments, indicative of a repeat sequence. Exon 3 is 413 bp long and encodes two potential TMDs and a cytoplasmic tail domain. The 3' flanking region extends for 440 bp, and it partially overlaps the 3' untranslated region of ovine RBM8A transcripts such as GenBank no. CB222195. These RBM8A transcripts use a polyadenylation signal motif (AATAAA) encoded 290 bp downstream from the type II GnRH receptor exon 3 stop codon (TGA). There is no polyadenylation addition (AATAAA) motif evident for receptor gene transcripts in the 440-bp 3' flanking region. However, a splice donor consensus sequence occurs 396 bp downstream from the exon 3 stop codon, and it is possible that splicing in the 3' untranslated region enables use of a polyadenylation signal farther downstream.

A full-length cDNA encompassing the ovine receptorcoding exons would be greater than 1080 bp long. There are currently no ovine ESTs corresponding to full-length sheep type II GnRH receptor cDNA in the GenBank database. The 1080-bp sheep cDNA coding region predicted from our genomic sequence is 85% identical to primate type II GnRH receptor cDNA, compared with 93% sequence identity between human and marmoset cDNA sequences. If the premature stop codon is disregarded, the sheep gene encodes a 7-TMD protein of 358 amino acid residues. Figure 2BGo shows the domain structure of the proteins encoded by the sheep and human type II receptor sequences.

Structure of the promoter region of the sheep type II GnRH receptor gene
The sequence of the 5' flanking region 780 bp upstream from the ATG start site was analyzed for predicted transcription binding sites and compared with the corresponding human sequence (Fig. 3Go). The 5' flanking region exhibit two stretches of clear sequence homology (>80% identity between sheep and human), termed zone 1 at –640 to –770 and zone 2 at –370 to –440 relative to the translation start codon in the sheep gene. These regions contain putative stimulating protein-1 (SP-1), and SP-1 and myogenic enhancer factor sites, respectively, but the Pit-1 binding site present in the human gene (AAATATTCAT) at position –440 exhibits two base differences in the sheep gene (AAATATTCTG, at –434; shown as Pit-1 related, Fig. 3Go). This difference (<70% identity to Pit-1 consensus) is probably sufficient to inactivate the sheep sequence as a Pit-1 binding site required for pituitary-specific gene expression. A third zone of weaker homology (–30 to –180) includes a GATA-1 and retinoic acid receptor transcription binding site in the sheep sequence that is absent at the equivalent location in the human gene; a GATA-1 is present elsewhere in the human gene (Fig. 3Go).



View larger version (10K):
[in this window]
[in a new window]
 
FIG. 3. Diagram showing locations of selected consensus transcription factor binding sites in the 700-bp 5' flanking region of the sheep and human type II GnRH receptor genes relative to ATG start site. Note some similarities in two domains of the promotor but the absence of a full PIT1 site in the sheep sequence.

 
Southern blot of ovine genomic DNA
Genomic DNA from Soay sheep was digested with Sau3AI, a restriction enzyme exhibiting high-frequency cutting and often used to assess restriction fragment length polymorphisms (24). Sau3AI was predicted to liberate one 589-bp fragment from the GnRH-II receptor gene located between PEX11ß and RBM8A, by cleaving in exon 1 and intron 1 (Fig. 4AGo). This was detected when Southern blotted and probed using a 320-bp PCR product located 88–408 bp downstream from the ATG start codon in exon 1. A single band of approximately 590 bp was detected by Southern blotting using a 320-bp probe for exon 1 (PCR product of the 88- to 408-bp region downstream from the ATG start codon in exon 1) (Fig. 4BGo). The generation of a single unique restriction digest product suggests that there may be only one copy of the GnRH-II receptor gene in the ovine genome.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4. A, Partial restriction map of the ovine type II GnRH receptor gene showing the positions of Sau3AI recognition sites (arrows), the stop codon (TAG) in exon 1 and the deletion in exon 2 (del 51 bp). Locations of EST matches: A, bovine: GenBank accession no. AW652511; B, porcine: GenBank BF702918; C, ovine: GenBank C222195. A bovine genomic clone (D, GenBank BZ916855) and an ovine Southern blot probe (E) are indicated. B, Southern blot of Soay sheep genomic DNA digested with Sau3AI hybridized with an exon 1 probe reveals only a single band of approximately 0.5 kb.

 
Different breeds of sheep have conserved the premature stop codon and deletion
A PCR strategy and a restriction enzyme digest assay were used to assess the uniform presence of a premature stop codon in a wide range of domesticated sheep breeds (Fig. 5AGo). As shown in Fig. 5BGo, all 15 sheep breed DNAs were cleaved in the assay yielding a similar 110-bp product, thus indicating that a TAG stop codon is present in all breeds examined. The stop codon was confirmed to be present by cloning, and sequencing the DNA, from four randomly chosen sheep breeds. Negative controls using pig, marmoset, and human DNA showed no digestion (Fig. 5BGo).



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 5. A, Diagram illustrating primers used for restriction digestion assays to verify the presence of the premature stop codon (TAG). Separate primers introduce restriction enzyme recognition sites for Sfc-1 and Stu1 (MRC 1198, sense strand and MRC 1197, antisense strand). The PCR product contains the respective recognition site only if the premature stop codon is present. B, Agarose gel electrophoresis of assays for the premature stop codon (TAG) in exon 1. The lanes represent alternate pairs of undigested and digested PCR products from different breeds of sheep: 1, Dorset; 2, Jackob; 3, Suffolk; 4, Herdwick; 5, Cheviot; 6, Romanov; 7, Booroola/Merino; 8, East Freisland; 9, Vhann; 10, Shetland; 11, Ryeland; 12, Quessant; 13, Finish Landrace; 14, Barbados Hair; 15, Texel; 16, Soay; and other species as controls: 17, marmoset; 18, human; and 19, pig. Samples from all sheep breeds (1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 ) were cleaved, indicating presence of the premature stop codon, and control samples (17 18 19 ) were not cleaved. C, Agarose gel electrophoresis demonstrating the 51-bp exon 2 deletion in the different sheep breeds: 1, Dorset; 2, Jackob; 3, Suffolk; 4, Herdwick; 5, Cheviot; 6, Romanov; 7, Booroola/Merino; 8, East Freisland; 9, Vhann; 10, Shetland; 11, Ryeland; 12, Quessant; 13, Finish Landrace; 14, Barbados Hair; 15, Texel; and 16, Soay. All breeds exhibit a 124-bp PCR product, consistent with the 51-bp deletion in exon 2.

 
PCRs were performed on DNA from the different breeds to amplify the region containing the deletion in exon 2 (Fig. 5AGo). A 124-bp product was predicted if the deletion was present or a 175-bp product if not. The PCR products were run on a 1% agarose gel next to a DNA ladder and were consistently close to 124 bp in size for all sheep breeds (Fig. 5CGo). Cloning and sequencing of four randomly chosen sheep breeds also confirmed the presence of the deletion. These data indicate an ancestral presence of the stop codon and deletion in the ovine family.

Pattern of receptor gene expression in sheep tissues
The tissue distribution of the type II GnRH receptor gene expression in sheep was analyzed by RT-PCR amplification of different regions of the receptor gene using cDNA generated from Soay sheep brain areas (hypothalamus, forebrain, and brain stem), pituitary gland, ovary, testis, adrenal gland, and liver. This involved the use of a wide range of primers designed to selectively amplify long and short sequences of the type II receptor (Fig. 6AGo). As a positive control for the methodology, RT-PCR was performed on the same cDNA samples using primers designed to localize expression of the GnRH I receptor gene (Fig. 6BGo). The RT-PCR analysis of the ovine type II GnRH receptor produced no detectable amplified bands for any of the tissues, indicating that neither mature spliced transcripts nor alternative transcripts are produced in sheep brain, pituitary, testis, and ovary (data not shown). Only unspliced DNA hybridized to the exon 1 and 2 probes on the Southern blots.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 6. A, RT-PCR analysis of ovine type II GnRH receptor gene using a wide range of primers designed to amplify specific sequences: the location of the target sequences within the three exons are shown. Southern blots of type II GnRH receptor RT-PCR products for extracts of sheep brain, pituitary, ovary, testis, and purified gonadotrope cultures produced no bands (gels not shown). B, To provide a control, RT-PCR analysis of ovine GnRH-1 receptor gene using selected primers: the location of the target sequences and predicted size (bp) of product are shown. Southern blots of sheep GnRH-I receptor RT-PCR products hybridized to a sheep GnRH-I receptor cDNA probe for extracts of pituitary gland, ovary, and testes (above, long exposures of the filter) and purified gonadotrope cultures (below, long exposure). The observed bands were taken to represent alternative spliced transcripts.

 
Analysis of full-length GnRH-I receptor transcripts, used as a positive control for RT-PCR, produced bands of the expected size when probed using a 30-mer oligonucleotide to exon 1. This was expressed as expected in the sheep pituitary gland, and a weak signal was also evident in the testis and ovary (Fig. 6BGo). cDNA generated from gonadotropes purified using Percoll gradient separation produced an amplified transcript of the expected size for the GnRH I receptor, as in whole sheep pituitary tissue (Fig. 6BGo), but no transcript was seen using primers for the GnRH II receptor (data not shown).

Northern blots using poly-A+ mRNA from pituitary glands and testes from sexually active and inactive Soay sheep yielded slightly different results. A band of 0.55 kb was seen in both sexually active and inactive testes when probed with an oligonucleotide probe to exon 1 on the type II GnRH receptor gene, and this was absent in the pituitary tissue (Fig. 7Go). No bands were seen in either tissue when probed for exons 2 or 3 (data not shown). As expected, the GnRH-I receptor probes hybridized to a 2.4-kb transcript in sheep pituitary gland mRNA (data not shown).



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 7. Northern blot analysis using an oligonucleotide probe to exon 1 of the ovine type II GnRH receptor (MRC 1194) using Poly-A+ RNA from sexually inactive (SI) and sexually active (SA) Soay rams: lanes 1–2, SI pituitary gland (15 and 3.75 µg mRNA, respectively); lanes 3–4, SA pituitary gland (7.5 and 1.375 µg mRNA); lanes 5–6, SI testis (15 and 3.75 µg mRNA); lanes 7–8, SA testis (15 and 3.75 µg mRNA). Transcripts of 0.55 kb were detected in testis but not pituitary, whereas the positive control glyceraldehyde 3-phosphate dehydrogenase cDNA probe hybridized to all samples (lower panel). GnRH-I receptor transcripts of 0.98 kb were detected with an exon 1 cDNA probe in SI and SA pituitary using the high loadings of mRNA (data not shown).

 
Both 35S-labeled oligonucleotide probes and 35S-labeled riboprobes were used to investigate gene expression in the sheep pituitary gland and testis by in situ hybridization. As a positive control, an IGF-1R antisense probe (25) was shown to strongly hybridize to pituitary tissue, whereas the sense probe did not (data not shown). Another positive control probe, an antisense riboprobe for GnRH-I receptor also hybridized specifically to the pituitary tissue (Fig. 8AGo), but produced a less intense signal. In contrast, both type II GnRH receptor probes showed no hybridization. These results were consistent using film autoradiograms (Fig. 8AGo) and tissue microscopy (Fig. 8BGo) and helped to confirm that type II GnRH receptor transcripts are absent in the gonadotropes. In the testis, GnRH-I and GnRH-II antisense probes hybridized to a small number of cells in the interstitial tissue. The signal was intense for some cells that were presumed to be a subpopulation of Leydig cells (Fig. 8BGo).



View larger version (78K):
[in this window]
[in a new window]
 
FIG. 8. A, In situ hybridization film autoradiograms of representative samples of sheep pituitary gland hybridized to sense and antisense probes for type II GnRH receptor (GnRH-IIR, left panel) and GnRH-I receptor (GnRH-IR, right panel). The antisense probe for GnRH-IR probe gave a weak signal, and the GnRH-IIR probe produced no visible signal. B, Upper panels, In situ hybridization microscopy showing dark-field silver grain images of tissue sections of sheep pituitary gland probed with riboprobes to GnRH-IIR (sense control probe and antisense) and GnRH-IR. The signal strength was least for GnRH-IIR antisense, as above (PD, pars distalis; PN, pars nervosa). At higher resolution (dark- and light-field images, see below), the GnRH-IR probe gave a localized signal in the pars distalis (arrows, presumed to indicate gonadotopes), but no signal was seen with the GnRH-IIR probe (data not shown). Lower panels, In situ hybridization showing silver grain distribution as a dark- and light-field image on sheep testis tissue sections probed with riboprobes to GnRH-IIR. A localized signal was observed to discrete cells in the interstitial tissue (arrows), and this was not seen with sense control probe.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ovine type II GnRH receptor gene
The current study has identified the nucleotide sequence of the ovine type II GnRH receptor gene providing the first full sequence for a nonprimate mammalian species. The gene is apparently present as a single copy in the sheep genome set in an antisense orientation and located between the PEX11ß and RBM8A genes, as in the human. The gene spans 5.7 kb DNA and is somewhat smaller than the corresponding human gene due to the absence of some intronic repetitive sequence elements. The gene has the expected three-exon/two-intron structure and shows approximately 85% sequence homology with the primate type II GnRH receptor; this clearly confirms it as a member of the 7-TMD GnRH receptor subfamily. The sheep gene, however, has many novel structural features including a premature stop codon in exon 1 and a major deletion in exon 2. These gross features were shown to be present in all 15 breeds of sheep investigated, indicating that they are an ancestral trait in the progenitor of domesticated sheep.

The sequence analysis predicts that no full-length mRNA transcripts and corresponding proteins will exist in sheep. However, the novel aspects of the sheep gene are well illustrated by alignment of the putative amino acid sequence with the other known type II GnRH receptors proteins (Fig. 2Go). This shows that the highest degree of sequence conservation in amino acid positions is within the TMDs.

In contrast, several divergent features occur in the sheep. First is the predicted presence of an extra amino acid residue (alanine) at position 14 close to the N terminus and the absence of one amino acid at position 78 in TMD-2, which is represented as an arginine or a threonine in primates (13, 14, 16). Second, the TMD-3 contains a premature stop codon indicating premature termination of transcription. The human, chimpanzee, and bovine sequences contain a stop codon in ECL-2 (16). Third, at the intracellular end of TMD-3, the conserved DRY motif (26), which is modified to DRS in mammalian GnRH-I receptors and DRQ in other mammalian type II GnRH receptors, is changed in sheep to DHQ at position 139. No GPCR within the rhodopsin family, except platelet activating factor receptor (27), shows a difference in this motif. The arginine residue here is essential for ligand-mediated activation of the receptor (26); thus, the change to histidine is expected to disrupt ligand-mediated activation. 4. In the predicted sheep sequence, ECL-2 shows a 17-amino acid deletion from positions 180–196. Within GPCRs, ECL-2 is variable in length. In GnRH receptors, this region is usually involved in the formation of disulfide bonds between cysteine residues in the N terminus and/or TMD-1 of the-folded protein. These bonds are necessary to stabilize receptor structure (28), and the deletion would be expected to have repercussions on receptor activation. However, a deletion in ECL-2 does not affect Xenopus GnRH receptor function (Troskie, B. E., N. Illing, K. Findlayson, S. Lowe, A. Katz, and R. Millar, unpublished observations; GenBank accession no. AF257320) or that of the human GnRH-I receptor (30). Fifth, in intracellular loop 3 a conserved histidine is absent in position 241. The consequence of this is unknown, but an effect on G protein coupling is unlikely because only residues adjacent to TMD-5 and TMD-6 have been shown to affect coupling in the human GnRH-I receptor (31). A sixth feature is that ECL-3, important for ligand interaction (32), is notably conserved in the sheep sequence. Seventh, the DPXXY motif in TMD-7, important for interactions with G proteins and activation of intracellular signaling (33), is altered to DPXXC. Eighth, the sheep GnRH-II receptor gene encodes a potential PDZ domain-binding motif (TSL) at position 379–381. The cytoplasmic tail of the marmoset type II GnRH receptor contains a potential class 1 postsynaptic density-disc large-zonula occludans (PDZ) domain-binding motif (ITSI) (34), which can be bound by PDZ domain-containing proteins. GnRH-I receptors contain a class II PDZ domain-binding motif (YFSL) (34). This may be important for maintaining correct spatial arrangement of domains and alteration in the sheep would again potentially affect receptor function (35). Finally, the last feature is that the cytoplasmic tail domain is shorter than other GnRH-II receptors (55 amino acid residues in sheep, compared with 57 in rhesus, green monkey, and human, and 58 in marmoset).

The inference from this abstracted species comparison is that the sheep type II GnRH receptor gene carries multiple changes that would impact on the ancestral function as a 7-TMD receptor for the GnRH-II decapeptide ligand. Besides the presence of the premature stop codon midway through the gene that would disrupt transcription and a major deletion that would affect the structure of ECL-2 region of the putative protein, the predicted amino acid sequence shows nonconservative changes in important motifs such as DRY and DPXXY that are required for normal receptor function. These novel features suggest that the sheep gene no longer encodes a functional type II GnRH receptor. In this respect the sheep resembles human, chimpanzee, cow, rat, and mouse in carrying a redundant receptor, but the molecular/structural events at the level of the gene that have produced the loss of gene function in these mammalian species are very different (16).

The expectation based on gene structure is that no full-length mRNA transcripts for the type II GnRH receptor will exist in sheep tissues. This is strongly supported by the results produced by RT-PCR on mRNA extracted from ovine brain, pituitary gland, testis, and other tissues. The PCRs using primers flanking the type II GnRH receptor gene produced no bands of the expected size for either full-length or spliced transcripts. Southern and Northern blot analyses also failed to produce evidence of full-length transcripts, although partial transcripts were evident in pituitary and testis. These data clearly indicate that the full receptor is not transcribed in the sheep, but shorter transcripts may be produced that could be translated into truncated, two transmembrane domain proteins. These might interact with GnRH-I receptors and/or have a paracrine role within the pituitary or testis tissues, although there is currently no functional evidence for this. Alternative transcripts have been described for other GnRH receptors (18, 36, 37) and other GPCRs (38, 39).

The original proposal that there is a functional full-length, 7-TMD, type II GnRH receptor in sheep was based on the observation that the GnRH-II peptide stimulates LH and FSH secretion in vivo. In addition, a polyclonal antiserum generated to an epitope in ECL-3 of the type II GnRH receptor (encoded by exon 3) immunocytochemically labeled cells in the sheep pituitary gland in an apparent cell-specific manner, similar to the staining for LHß in gonadotropes (13). It is now recognized, however, that exogenous GnRH-II activates gonadotropin secretion through the classical GnRH-I receptor expressed on the gonadotrope, and this response occurs only after the administration of a pharmacological dose of the peptide (40). Moreover, there is no evidence that the GnRH-II peptide normally reaches the pituitary gland in sheep, and experimental treatments with GnRH-II, combined with different physiological doses of GnRH-I, do not modulate the gonadotropin response (40). The deductions based on the use of the ECL-3 antiserum also may be misleading because the 12-amino acid sequence to which the antibody was raised also contains an epitope of RLIM transcription factor (LTEVPP, amino acid residues 199–204, GenBank accession no. Q9NVW2). RLIM is a RING H2 zinc finger protein that acts as a negative coregulator for LIM homeodomain transcription factors (41), and that has been shown to be expressed in the pituitary gland (i.e. see GenBank accession no. AV747831).

This reassessment means there is no definitive evidence for a role of type II GnRH receptor in the sheep gonadotrope. This fits with the current molecular data showing the absence of full-length transcripts or transcripts containing exon 3 in the pituitary tissue or in an enriched population of gonadotropes. It also fits with the observation that the 5' flanking region of the sheep GnRH-II receptor gene lacks a Pit1 binding site in zone 2 of the promotor. Sheep and human GnRH-I receptors possess Pit-1 transcription factor binding sites in the 5' flanking region, that play a critical role in pituitary-specific gene expression (42). Overall, the many lines of evidence definitively demonstrate that the type II GnRH receptor is not involved the physiological regulation of gonadotropin secretion in sheep. Furthermore, it is unlikely that the full receptor protein is involved in the regulation of the other putative roles the GnRH II decapeptide in neuromodulation and/or the control of sexual behavior.

In conclusion, this study demonstrates that the sheep type II GnRH receptor gene has accumulated more novel variations in nucleotide sequence structure than in any other mammalian species. The presence of a stop codon in the middle of the gene, and the failure to detect full-length mRNA transcripts from the gene in any tissue shows that a functional, 7-TMD, GnRH-II receptor protein is no longer produced in this species. This appears to be a consistent trait in the ovine family based on the demonstration that the gene structure was similar in a wide range of sheep breeds differing markedly in their reproductive physiology and ancestry. Short transcripts derived from the type II GnRH receptor gene were observed in the pituitary gland and testis, and it remains to be established whether these are translated into smaller proteins that function locally. We previously hypothesized that the type II GnRH receptor gene will show unusual species diversity in structure in mammals due to evolutionary redundancy (16). The data for the sheep are consistent with this hypothesis.


    Acknowledgments
 
We are grateful to Gwen Pfleger and MWG-Biotech for sequencing services; Ted Pinner and Stuart Gray for graphics; and colleagues at the Marshall building for sheep tissues.


    Footnotes
 
GenBank accession number for this manuscript is AY319519.

Abbreviations: ECL, Extracellular loop; EST, expressed sequence tag; GPCR, G protein-coupled receptor; IGF-1R, IGF-1 receptor; LD-PCR, long-distance PCR; PDZ, postsynaptic density-disc large-zonula occludans; TMD, transmembrane domain; 7-TMD, seven-transmembrane domain.

Received December 1, 2003.

Accepted for publication January 19, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Miyamoto K, Hasegawa Y, Nomura M, Igarashi M, Kangawa K, Matsuo H 1984 Identification of the second gonadotropin-releasing hormone in chicken hypothalamus: evidence that gonadotropin secretion is probably controlled by two distinct gonadotropin-releasing hormones in avian species. Proc Natl Acad Sci USA 81:3874–3878[Abstract/Free Full Text]
  2. Sealfon SC, Weinstein H, Millar RP 1997 Molecular mechanisms of ligand interaction with the gonadotropin-releasing hormone receptor. Endocr Rev 18:180–205[Abstract/Free Full Text]
  3. White RB, Eisen JA, Kasten TL, Fernald RD 1998 Second gene for gonadotropin-releasing hormone in humans. Proc Natl Acad Sci USA 95:305–309[Abstract/Free Full Text]
  4. King JK, Millar RP 1997 Coordinated evolution of GnRHs and their receptors. In: Parhar IS, Sakuma Y, eds. GnRH neurones: gene to behaviour. Tokyo: Brain Shuppan Publishers; 51–57
  5. Forlano PM, Maruska KP, Sower SA, King JA, Tricas TC 2000 Differential distribution of gonadotropin-releasing hormone-immunoreactive neurons in the stingray brain: functional and evolutionary considerations. Gen Comp Endocrinol 118:226–248[CrossRef][Medline]
  6. Bosma PT, Rebers FE, Dijk W, Willems PH, Goos HJ, Schulz RW 2000 Inhibitory and stimulatory interactions between endogenous gonadotropin-releasing hormones in the African catfish (Clarias gariepinus). Biol Reprod 62:731–738[Abstract/Free Full Text]
  7. Millar RP, Milton RC, Follett BK, King JA 1986 Receptor binding and gonadotropin-releasing activity of a novel chicken gonadotropin-releasing hormone ([His5, Trp7, Tyr8]GnRH) and a D-Arg6 analog. Endocrinology 119:224–231[Abstract/Free Full Text]
  8. Jones SW 1987 Chicken II luteinizing hormone-releasing hormone inhibits the M-current of bullfrog sympathetic neurons. Neurosci Lett 80:180–184[CrossRef][Medline]
  9. Maney DL, Richardson RD, Wingfield JC 1997 Central administration of chicken gonadotrophin-releasing hormone-II enhances courtship behaviour in a female sparrow. Horm Behav 32:11–18[CrossRef][Medline]
  10. Rissman EF, Li X, King JA, Millar RP 1997 Behavioral regulation of gonadotropin-releasing hormone production. Brain Res Bull 44:459–464[CrossRef][Medline]
  11. Wang L, Bogerd J, Choi HS, Seong JY, Soh JM, Chun SY, Blomenrohr M, Troskie BE, Millar RP, Yu WH, McCann SM, Kwon HB 2001 Three distinct types of GnRH receptor characterized in the bullfrog. Proc Natl Acad Sci USA 98:361–366[Abstract/Free Full Text]
  12. Troskie BE, Hapgood JP, Millar RP, Illing N 2000 Complementary deoxyribonucleic acid cloning, gene expression, and ligand selectivity of a novel gonadotropin-releasing hormone receptor expressed in the pituitary and midbrain of Xenopus laevis. Endocrinology 141:1764–1771[Abstract/Free Full Text]
  13. Millar R, Lowe S, Conklin D, Pawson A, Maudsley S, Troskie B, Ott T, Millar M, Lincoln G, Sellar R, Faurholm B, Scobie G, Kuestner R, Terasawa E, Katz A 2001 A novel mammalian receptor for the evolutionarily conserved type II GnRH. Proc Natl Acad Sci USA 98:9636–9641[Abstract/Free Full Text]
  14. Neill JD, Duck LW, Sellers JC, Musgrove LC 2001 A gonadotrophin-releasing hormone (GnRH) receptor specific for GnRH II in primates. Biochem Biophys Res Commun 282:1012–1018[CrossRef][Medline]
  15. McArdle CA, Franklin J, Green L, Hislop JN 2002 Signalling, cycling and desensitisation of gonadotrophin-releasing hormone receptors. J Endocrinol 173:1–11[Abstract]
  16. Morgan K, Conklin D, Pawson AJ, Sellar R, Ott TR, Millar RP 2003 A transcriptionally active human type II gonadotropin-releasing hormone receptor gene homolog overlaps two genes in the antisense orientation on chromosome 1q.12. Endocrinology 144:423–436[Abstract/Free Full Text]
  17. Pawson AJ, Morgan K, Maudsley SR, Millar RP 2003 Type II gonadotrophin-releasing hormone (GnRH-II) in reproductive biology. Reproduction 126:271–278[Abstract]
  18. Grosse R, Schoneberg T, Schultz G, Gudermann T 1997 Inhibition of gonadotropin-releasing hormone receptor signaling by expression of a splice variant of the human receptor. Mol Endocrinol 11:1305–1318[Abstract/Free Full Text]
  19. Cowley MA, Rao A, Wright PJ, Illing N, Millar RP, Clarke IJ 1998 Evidence for differential regulation of multiple transcripts of the gonadotropin releasing hormone receptor in the ovine pituitary gland; effect of estrogen. Mol Cell Endocrinol 146:141–149[CrossRef][Medline]
  20. Zhou W, Sealfon SC 1994 Structure of the mouse gonadotropin-releasing hormone receptor gene: variant transcripts generated by alternative processing. DNA Cell Biol 13:605–614[Medline]
  21. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  22. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ 1990 Basic local alignment search tool. J Mol Biol 215:403–410[CrossRef][Medline]
  23. Kozak M 1987 An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 15:8125–8148[Abstract/Free Full Text]
  24. Kiyama R, Matsui H, Oishi M 1986 A repetitive DNA family (Sau3A family) in human chromosomes: extrachromosomal DNA and DNA polymorphism. Proc Natl Acad Sci USA 83:4665–4669[Abstract/Free Full Text]
  25. Reynolds TS, Stevenson KR, Wathes DC 1997 Pregnancy-specific alterations in the expression of the insulin-like growth factor system during early placental development in the ewe. Endocrinology 138:886–897[Abstract/Free Full Text]
  26. Ballesteros J, Kitanovic S, Guarnieri F, Davies P, Fromme BJ, Konvicka K, Chi L, Millar RP, Davidson JS, Weinstein H, Sealfon SC 1998 Functional microdomains in G protein-coupled receptors. The conserved arginine-cage motif in the gonadotropin-releasing hormone receptor. J Biol Chem 273:10445–10453[Abstract/Free Full Text]
  27. Honda Z, Nakamura M, Miki I, Minami M, Watanabe T, Seyama Y, Okado H, Toh H, Ito K, Miyamoto T, et al 1991 Cloning by functional expression of platelet-activating factor receptor from guinea-pig lung. Nature 349:342–346[CrossRef][Medline]
  28. Davidson JS, Assefa D, Pawson A, Davies P, Hapgood J, Becker I, Flanagan C, Roeske R, Millar R 1997 Irreversible activation of the gonadotropin-releasing hormone receptor by photoaffinity cross-linking: localization of attachment site to Cys residue in N-terminal segment. Biochemistry 36:12881–12889[CrossRef][Medline]
  29. Deleted in proof
  30. Ott TR, Troskie BE, Roeske RW, Illing N, Flanagan CA, Millar RP 2002 Two mutations in extracellular loop 2 of the human GnRH receptor convert an antagonist to an agonist. Mol Endocrinol 16:1079–1088[Abstract/Free Full Text]
  31. Millar RP 2002 GnRH II and type II GnRH receptors. Trends Endocrinol Metab 14:35–43
  32. Petry R, Craik D, Haaima G, Fromme B, Klump H, Kiefer W, Palm D, Millar R 2002 Secondary structure of the third extracellular loop responsible for ligand selectivity of a mammalian gonadotropin-releasing hormone receptor. J Med Chem 45:1026–1034[CrossRef][Medline]
  33. Arora KK, Cheng Z, Catt KJ 1996 Dependence of agonist activation on an aromatic moiety in the DPLIY motif of the gonadotropin-releasing hormone receptor. Mol Endocrinol 10:979–986[Abstract/Free Full Text]
  34. Pawson AJ, Davidson L, Barran P, Millar RP, Maudsley S Putative PDZ domain-binding motif-mediated interactions between the human GnRH receptor and intracellular proteins delineated by a multi-step proteomics approach in British Andrology Society, British Fertility Society, Society for Reproduction and Fertility 3rd Joint Meeting, University of Aberdeen, Aberdeen, UK, 2003. Reproduction Abstract Series 30, poster 91
  35. Bezprozvanny I, Maximov A 2001 PDZ domains: More than just a glue. Proc Natl Acad Sci USA 98:787–789[Free Full Text]
  36. Wang L, Oh DY, Bogerd J, Choi HS, Ahn RS, Seong JY, Kwon HB 2001 Inhibitory activity of alternative splice variants of the bullfrog GnRH receptor-3 on wild-type receptor signaling. Endocrinology 142:4015–4025[Abstract/Free Full Text]
  37. Kottler ML, Bergametti F, Carre MC, Morice S, Decoret E, Lagarde JP, Starzec A, Counis R 1999 Tissue-specific pattern of variant transcripts of the human gonadotropin-releasing hormone receptor gene. Eur J Endocrinol 140:561–569[Abstract]
  38. Petersenn S, Rasch AC, Penshorn M, Beil FU, Schulte HM 2001 Genomic structure and transcriptional regulation of the human growth hormone secretagogue receptor. Endocrinology 142:2649–2659[Abstract/Free Full Text]
  39. Rekasi Z, Czompoly T, Schally AV, Halmos G 2000 Isolation and sequencing of cDNAs for splice variants of growth hormone-releasing hormone receptors from human cancers. Proc Natl Acad Sci USA 97:10561–10566[Abstract/Free Full Text]
  40. Gault PM, Maudsley S, Lincoln GA 2003 Evidence That gonadotropinreleasing hormone II is not a physiological regulator of gonadotropin secretion in mammals. J Neuroendocrinol 15:831–839[CrossRef][Medline]
  41. Ostendorff HP, Bossenz M, Mincheva A, Copeland NG, Gilbert DJ, Jenkins NA, Lichter P, Bach I 2000 Functional characterization of the gene encoding RLIM, the corepressor of LIM homeodomain factors. Genomics 69:120–130[CrossRef][Medline]
  42. Reinhart J, Xiao S, Arora KK, Catt KJ 1997 Structural organization and characterization of the promotor region of the rat gonadotrophin-releasing hormone receptor gene. Mol Cell Endocrinol 130:1–12[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
C. A. Flanagan, C.-C. Chen, M. Coetsee, S. Mamputha, K. E. Whitlock, N. Bredenkamp, L. Grosenick, R. D. Fernald, and N. Illing
Expression, Structure, Function, and Evolution of Gonadotropin-Releasing Hormone (GnRH) Receptors GnRH-R1SHS and GnRH-R2PEY in the Teleost, Astatotilapia burtoni
Endocrinology, October 1, 2007; 148(10): 5060 - 5071.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
B. Faurholm, S. Cochrane, R. R Millar, and A. A Katz
Gene structure and promoter functional analysis of the marmoset type II GnRH receptor
J. Mol. Endocrinol., August 1, 2007; 39(2): 91 - 104.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
P. C.K. Leung and J.-H. Choi
Endocrine signaling in ovarian surface epithelium and cancer
Hum. Reprod. Update, March 1, 2007; 13(2): 143 - 162.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Morgan, R. Sellar, A. J. Pawson, Z.-L. Lu, and R. P. Millar
Bovine and Ovine Gonadotropin-Releasing Hormone (GnRH)-II Ligand Precursors and Type II GnRH Receptor Genes Are Functionally Inactivated
Endocrinology, November 1, 2006; 147(11): 5041 - 5051.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. K. Barnett, T. M. Bunnell, R. P. Millar, and D. H. Abbott
Gonadotropin-Releasing Hormone II Stimulates Female Sexual Behavior in Marmoset Monkeys
Endocrinology, January 1, 2006; 147(1): 615 - 623.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
N. Eicke, A. R Gunthert, V. Viereck, D. Siebold, M. Behe, T. Becker, G. Emons, and C. Grundker
GnRH-II receptor-like antigenicity in human placenta and in cancers of the human reproductive organs
Eur. J. Endocrinol., October 1, 2005; 153(4): 605 - 612.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Pawson, S. Maudsley, K. Morgan, L. Davidson, Z. Naor, and R. P. Millar
Inhibition of Human Type I Gonadotropin-Releasing Hormone Receptor (GnRHR) Function by Expression of a Human Type II GnRHR Gene Fragment
Endocrinology, June 1, 2005; 146(6): 2639 - 2649.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. K. Cheng and P. C. K. Leung
Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans
Endocr. Rev., April 1, 2005; 26(2): 283 - 306.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gault, P. M.
Right arrow Articles by Lincoln, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gault, P. M.
Right arrow Articles by Lincoln, G. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals