| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Medicine and Clinical Science (Y.-S.L., N.K., Y.H., K.M., H.H., K.N., T.A.), Translational Research Center (H.H., T.A.), Kyoto University School of Medicine, Kyoto 606-8507, Japan
Address all correspondence and requests for reprints to: Dr. Takashi Akamizu, Translational Research Center, Kyoto University School of Medicine, 54 Shogoin Kawaharacho Sakyo-ku, Kyoto 606-8507, Japan. E-mail: akamizu{at}kuhp.kyoto-u.ac.jp.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
) molecules and the human TSH receptor (TSHR) but not with those expressing either alone (5). In contrast, several observations have suggested that the MHC class II antigen expression is secondary to lymphocyte infiltration and organ destruction (6, 7, 8, 9). Furthermore, there is controversy regarding the role of MHC class II-expressing thyrocytes, which are nonprofessional APCs, in inducing T-cell reactivity (10, 11, 12, 13, 14) or nonresponsiveness (15, 16, 17, 18, 19). Here, we attempted to produce transgenic mice expressing MHC class II molecules on thyrocytes, driven by the rat TSHR promoter (pTSHR). Then, we examined whether these transgenic mice suffered from AITD and whether MHC class II-expressing thyrocytes obtained from transgenic mice stimulated the proliferation of autologous native T cells in vitro. | Materials and Methods |
|---|
|
|
|---|
-transgenic mice were produced by microinjecting pTSHR-I-A
constructs into fertilized eggs from C3H/HeSLc mice and implanting them into pseudopregnant foster mothers. The pTSHR-I-A
construct was made by reconstructing the Bluescript SK (+/) vector carrying the second intron, the third exon, and the 3' untranslated region of the rabbit ß-globin gene, and an SV40 poly(A) site (20). This construct was kindly provided by Dr. Masahiro Sato (Tokai University, Isehara, Japan). The 5'-flanking region from 200 bp to 1 bp of the rat TSHR gene (21), kindly provided by Dr. Shoichiro Ikuyama (Kyusyu University, Fukuoka, Japan), was inserted into the Bluescript SK (+/) vector between BamHI and HindIII restriction enzyme sites. This particular 200-bp fragment has demonstrated the highest pTSHR activity and tissue specificity of any such promoter fragment. The RT4.15HP cell line, expressing the I-A
k, Aß (ß1
; ß2, TM, IC
) class II antigen, was a gift of Dr. Ronald N. Germain (National Institute of Allergy and Infections Disease, National Institutes of Health). This shuffled I-A
molecule is not different from the wild-type I-A
form in its antigen binding and presentation (22), and this MHC class-II-expressing cell line was also used in the Shimojo model (5). A
and Aß cDNA fragments were each reverse-transcribed from mRNA purified from RT4.15HP cells and separately inserted into an EcoRI site within the third exon of the ß-globin gene in the pTSHR-BlueScript SK (+/) constructs described above. Then, the pTSHR-A
fragment was released by digestion of the vector with XhoI. The pTSHR-Aß vector was linearized at a SalI site for pTSHR-A
fragment ligation (Fig. 1
|
) mice. Mice were screened for transgenic expression by PCR analysis of tail DNA using the following primer pairs: ß-gl-1 sense 5'-CTCCTGGGCAACGTGCTGGT and ß-gl-2 antisense 5'-GTGGTATTTGTGAGCCAGGG, ß-gl-1 sense and I-A
3' antisense 5'-GAACACCCGTAGCACCAC, and I-Aß 5' sense GGGAATTCGGTGACTGCCATTACCTGTG and ß-gl-2 antisense. The transgene copy number was determined by Southern blotting of tail genomic DNA with a I-A cDNA probe. Transgenic mice were bred and maintained in our animal facility under conventional conditions. All animal work was performed in accordance with the ethical guidelines of the animal research committee of Kyoto University.
Transgenic transcript expression and thyroid histology
Mice were killed at various times, and their tissues (thyroid, spleen, heart, liver, and kidney) were fixed and embedded in paraffin for routine hematoxylin-eosin staining or snap-frozen in OCT compound for immunohistologic studies. For immunofluorescence, 5-µm sections were cut with a cryostat, dried, and fixed in acetone. After washing and blocking, the slides were incubated overnight at 4 C with either biotin-conjugated A mAb (Clone 115.2, PharMingen, San Diego, CA), or biotin-conjugated mouse monoclonal Ig (Clone G155178, PharMingen) as an isotype control. Binding of primary antibody was visualized by streptavidin-conjugated Texas red dye (Jackson ImmunoResearch laboratories, Inc., West Grove, PA). For CD45 (leukocyte common antigen, Ly-5) staining, 5-µm-thick paraffin-embedded thyroid sections were stained with biotin-conjugated rat antimouse CD45 mAb (Clone 30-F11, PharMingen) after antigen unmasking, followed by streptavidin-biotin peroxidase labeling (Nacalai tesque, Kyoto, Japan) using diaminobenzidine (DAB) as the chromogen. Negative control slides were created with no primary antibody. Positive controls consisted of spleen sections subjected to the same treatment. Also, sc fat tissues were homogenized, and RNA was prepared by Trizol reagent (Invitrogen, Carlsbad, CA) extraction. First-strand cDNA was synthesized using a pd(N)6 primer. Expression of transgenic transcripts in the adipose tissue was analyzed by RT-PCR using I-A
- and I-Aß-specific primers. RNA expression in the thyroid of transgenic mice was used as a positive control.
Thyroid cell preparation and flow cytometry
Mice thyroid cells were prepared from thyroid lobes by collagenase/dispase digestion as described previously (23). Briefly, thyroids were minced and digested by type I collagenase (Sigma, St. Louis, MO) and dispase I (Roche, Indianapolis, IN) in Eagles MEM. After two 30-min digestions in a 37 C water bath, thyroid cells were harvested by centrifugation. The pellets were resuspended in 5H medium (24) and passed through a 200-µm nylon mesh. To evaluate transgenic expression, cells were seeded in 6-well culture plates supplied with medium in a 37 C humidified incubator under 5% CO2. The medium was changed every day to remove unattached cells and blood cells. After approximately 64 h of culture, single thyroid cell suspensions were obtained after HEPES-EDTA digestion (25). Cells were stained with R-phycoerythrin-conjugated mouse antimouse I-A
monoclonal antibody (clone 115.2, PharMingen). Before antibody staining, the cells were incubated with purified mouse IgG2b protein (Dako, Glostrup, Denmark) to mask nonspecific staining. To distinguish living cells from dead ones, 7-amino-actinomycin D (PharMingen) labeling was performed before the cells were subjected to flow cytometry. I-A
protein expression was analyzed using a FACScan running CellQuest acquisition and analysis software (Becton Dickinson, Franklin Lakes, NJ). The cells were also stained with mouse antihuman TSHR MCA1281 (2C11, Serotec, Raleigh, NC) and rat antimouse CD80-biotin (IM2854, Beckman Coulter, Inc., Marseille, France) to examine the expression of TSHR and B7, respectively.
T cell preparation and coculture experiments
T cells were enriched from spleens of 20- to 32-wk-old transgenic mice and their littermates using a magnetic cell sorting procedure. Briefly, after lysing erythrocytes with hypotonic solution (0.16 M NH4Cl, 0.17 M Tris, pH 7.65), a single-spleen-cell suspension was indirectly labeled using a cocktail of biotin-conjugated antibodies against CD45R (B220), DX5, CD11b (Mac-1), and Ter-119, and antibiotin microBeads. Isolation of pure T cells was achieved by depletion of magnetically labeled cells after retaining them on a MACS Column in the magnetic field of an autoMACS Separator (all of the antibodies and columns, as well as the separator were from Miltenyi Biotec, Bergisch Gladbach, Germany). The purity of enriched T cells was evaluated by flow cytometry by staining with fluorescein isothiocyanate-CD3e mAb (1452C11, PharMingen). Purified T cells (5 x 105/well) in F-12 culture medium (Life Technologies, Inc., Gaithersburg, MD) were added to the cultured thyrocytes in 96-well culture plates, as described above, for 72 h. For T cell coculture experiments, thyrocytes were seeded in 96-well a-bottomed plates at a concentration of 2 x 104 cells per well. For the T cell proliferation assay, wells were pulsed with bromodeoxyuridine (BrdU) solution (50 µg/ml) for the last 24 h. T cells seeded in the well without thyrocytes were stimulated with 10 µg/ml phytohemagglutinin-P (PHA) as a positive control.
T cell activation and proliferation assay
We used flow cytometry to characterize cells labeled by multicolor immunofluorescence with fluorescein isothiocyanate-conjugated rat antimouse CD25 mAb (Clone 7D4, PharMingen), R-phycoerythrin-conjugated rat antimouse CD4 mAb (Clone RM45, PharMingen), and PerCP-CY5.5-conjugated rat antimouse CD8a mAb (Clone 536.7, PharMingen). The combined immunofluorescent staining of the T cell surface marker CD4 or CD8 with the staining of incorporated BrdU was used together with flow cytometry to determine the frequency of proliferated cells that contained newly synthesized DNA. Incorporated BrdU staining was performed using the BrdU Flow Kit (PharMingen) according to the manufacturers protocol. Cells that had not been treated with BrdU were also stained as a negative control.
Serum-free T4 (FT4), TSH, TSHR antibody (TRAb), thyroglobulin (TG) antibody, and microsome antibody
A serum-free T4 (FT4) assay was performed by a commercial laboratory with an AIA-21 automatic enzyme immunoassay system (Tosoh Corp., Tokyo, Japan). Serum TSH was measured with a rat TSH [125I] assay system (RPA554, Amersham Biosciences Corp., Piscataway, NJ). Serum TRAb was determined using a TSH-binding inhibitor Ig assay with a commercially available solid-phase competitive LUMItest TRAb human RRA kit (Yamasa, Tokyo, Japan). Serum TG antibody was measured by the method described previously (26). Serum microsome antibody was assayed by a kit of gelatin-particle agglutination test (Fujirebio, Tokyo, Japan).
Statistics
Results were analyzed using a two-tailed Students t test. P < 0.05 was defined as significant.
| Results |
|---|
|
|
|---|
protein in thyroid follicles only in transgenic mice from lines 1 and 5 but not from line 4 (Fig. 2
molecules were not seen in other tissues from transgenic mice, including heart, kidney, and liver, with the exception of spleen of both transgenic and control mice. Fluorescence-activated cell sorting (FACS) analysis also demonstrated I-A
molecules on the surface of thyrocytes in transgenic mice from line-1 and -5, but not in line-4 transgenic or nontransgenic control mice. The mean fluorescence intensities of line-1, -5, and -4 transgenic and control thyrocytes were 35.51, 30.65, 10.59, and 9.53 arbitrary units, respectively, in one representative experiment (Fig. 2G
|
-transgenic mice
|
|
| Discussion |
|---|
|
|
|---|
transgene used here was the same as that transfected into RT4.15HP cells in the Shimojo model (5), and the ability of its gene products to present antigens effectively had been demonstrated before (30). C3H/HeSLc mice that we used in the present study have been shown to be a lipopolysaccharide responder (31) and are assumed to be similar to C3H/He mice used previously (32). In our study, MHC class II expression on thyrocytes of transgenic mice was driven by the pTSHR. In fact, immunofluorescence staining and flow cytometry demonstrated the presence of MHC class-II molecules on thyrocytes from line-1 and -5 transgenic mice. The expression of TSHR in thyrocytes from these transgenic mice was also confirmed by flow cytometry. Thus, we created a transgenic animal in which thyrocytes produced both MHC class II and TSHR molecules simultaneously under the control of pTSHR. Line 4 did not express MHC class II molecules, although the mice harbor four to five copies of the transgene in their genomes. The failure might be due to the insertion locus. This notion should also be considered for the negative results in the induction of AITD in other lines, 1 and 5. Thus, insertion locus might influence the function of MHC expressed on thyrocytes, although it will be rare that this simultaneously happens in two lines.
We observed a slightly lower serum FT4 in transgenic mice compared with their wild-type littermates. But, comparing with FT4 assay, less evidence of hypothyroidism was obtained from TSH assay by the commercial rat TSH RIA kit, which has a limited sensitivity for measuring murine TSH (33). Upon closer examination, our transgenic mice, with their aberrant MHC class II expression in thyrocytes, showed histologically intact thyroid glands and no evidence of thyroid inflammation or development of AITD. Although the Shimojo model demonstrated the necessity of simultaneous expression of MHC class II and TSHR on the surface of fibroblasts for the induction of GD by ip immunization, it did not show that aberrant MHC class II expression on thyrocytes was necessary to break immune tolerance in the thyroid (5). In contrast, a recent report by Caturegli et al. (34) showed that transgenic mice expressing the transcription factor class II transactivator under control of the TG promoter do not develop spontaneous thyroiditis. In fact, no transgenic models with MHC class II molecules on islet cells have been shown to develop autoimmune destruction of the islet, which is the main pathologic observation in insulin-dependent diabetes mellitus, another typical organ-specific autoimmune disease (35, 36). Thus, our results suggest that MHC class II expression on thyrocytes is not sufficient to induce thyroid autoimmunity. The decrease of serum FT4 levels in transgenic mice might be due to degenerative or other undetected changes in thyrocytes, analogous to those seen in diabetes models (35, 36).
Several studies have shown that MHC class II-producing thyrocytes from AITD glands stimulate the proliferation of T cell clones and lines derived from AITD thyroid tissues (10, 11, 12). Davies et al. (13) reported that MHC class IIproducing thyrocytes induced by lectin or IL-2 could stimulate T cells in an autologous mixed lymphocyte reaction. To address this issue, we have investigated the ability of MHC class II-producing thyrocytes from transgenic mice to induce a native T cell response by measuring the proliferation and activation of autologous T cells in vitro. MHC class-IIproducing thyrocytes from transgenic mice, however, failed to stimulate T cell proliferation in coculture experiments (Table 1
). This failure to respond may be due to a number of reasons; one possibility is that the sources of thyrocytes are different. For example, the amount of MHC class II molecules present may not have been optimal for APC activity. Because we used the endogenous pTSHR to drive transgenic expression, the promoter activity may be much weaker than that of the TG promoter or other exogenous promoters. Another possibility is that the full set of genes necessary for APC activity was not expressed in our system. In previous studies, thyrocytes obtained from AITD glands or stimulated by cytokines produced not only MHC class II molecules but also other molecules, such as B7, CD40, ICAM-1, and other costimulatory molecules, which have been demonstrated to be critical for antigen presentation (25, 37, 38, 39, 40, 41). In our study, however, we could not detect expression of costimulatory molecules on thyrocytes from transgenic mice, including B7, one of the most important of these molecules. In fact, in another parenchymal nonprofessional APC, islet ß-cells, T cells were unresponsive to transgenic MHC class II molecules present on ß-cells (42), and double transgenic mice expressing B7 and TNF-
in their islet ß-cells developed autoimmune diabetes (43). Furthermore, MHC class II- producing hepatocytes with costimulatory B7 molecules on their surfaces could present antigen and activate CD4 T cells (44). Taken together, costimulatory signals appear to be necessary for MHC class II-producing thyrocytes to stimulate T cell responses. Therefore, experiments which provide costimulatory signals necessary for T cell activation should be considered in the future study of the transgenic mice.
In conclusion, the transgenic mice developed here, with aberrant MHC class II-expression on their thyrocytes, did not develop AITD. Thyrocytes from transgenic mice did not show APC activity. These results do not conclusively show, however, that MHC class II-producing thyrocytes would lack the potential for antigen presentation if costimulatory signals or other necessary factors are present. In fact, the present study may lack an appropriate trigger that would induce breakdown of tolerance to develop AITD, although the mice were bred in conventional conditions. As a future study, interventional experiments such as administration of autoantigen (TSHR, TG, thyroid peroxidase), lipopolysaccharide, or cytokines should be considered. Thus, this transgenic model will remain useful for investigating whether and how aberrant MHC class II expression, in combination with other factors that trigger or influence AITD, contributes to APC function, as well as disease susceptibility and perpetuation.
| Footnotes |
|---|
Present address for Y.-S.L.: Department of Endocrinology and Metabolism, The First Clinical College, China Medical University, Shenyang, 110001 China.
Present address for H.H.: Department of Clinical Laboratory Science, School of Allied Health Science, Osaka University, 565-0871 Osaka, Japan.
Abbreviations: AITD, Autoimmune thyroid diseases; APC, antigen-presenting cells; BrdU, bromodeoxyuridine; FACS, fluorescence-activated cell sorting; FT4, serum-free T4; GD, Graves disease; MHC, major histocompatibility complex; PHA, phytohemagglutinin-P; pTSHR, TSHR promoter; TG, thyroglobulin; TRAb, TSHR antibody; TSHR, TSH receptor.
Received December 5, 2003.
Accepted for publication January 28, 2004.
| References |
|---|
|
|
|---|
-containing lymphocytes in human thyroid autoimmune disease. Clin Exp Immunol 83:6468[Medline]
-treated thyroid follicular cells inhibits interleukin-2 (IL-2) and supports IL-4 production by B7-dependent human T cells. Eur J Immunol 27:6271[Medline]
This article has been cited by other articles:
![]() |
P. N. Pichurin, C.-R. Chen, G. D. Chazenbalk, H. Aliesky, N. Pham, B. Rapoport, and S. M. McLachlan Targeted Expression of the Human Thyrotropin Receptor A-Subunit to the Mouse Thyroid: Insight into Overcoming the Lack of Response to A-Subunit Adenovirus Immunization J. Immunol., January 1, 2006; 176(1): 668 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. McLachlan, Y. Nagayama, and B. Rapoport Insight into Graves' Hyperthyroidism from Animal Models Endocr. Rev., October 1, 2005; 26(6): 800 - 832. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kimura, M. Kimura, S.-C. Tzou, Y.-C. Chen, K. Suzuki, N. R. Rose, and P. Caturegli Expression of Class II Major Histocompatibility Complex Molecules on Thyrocytes Does Not Cause Spontaneous Thyroiditis but Mildly Increases Its Severity after Immunization Endocrinology, March 1, 2005; 146(3): 1154 - 1162. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |