| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Biology/Animal Physiology (C.W.E.M., M.K., S.R., G.H.), Karl-von-Frisch Strasse, Philipps University Marburg, D-35043 Marburg, Germany; Ingenium Pharmaceuticals AG (D.K., W.J., E.C., J.G., M.N.), D-82152 Martinsried, Germany; GSF National Research Center for Environment and Health (H.F., M.H.A.), Institute of Experimental Genetics, D-85764 Oberschleissheim, Germany; Department of Psychiatry (M.T.), Obesity Research Center, University of CincinnatiGenome Research Institute, Cincinnati, Ohio 45267-0559
Address all correspondence and requests for reprints to: Carola W. E. Meyer, Department of Biology and Animal Physiology, Karl-von-Frisch Strasse, Philipps University Marburg, D-35043 Marburg, Germany. E-mail: meyerc{at}staff.uni-marburg.de.
| Abstract |
|---|
|
|
|---|
g missense mutation in exon 5 of the GH gene, which translates to a D167G amino acid exchange in the mature protein. Mice carrying the mutation are characterized by dwarfism, predominantly due to the reduction (sma1/+) or absence (sma1/sma1) of the GH-mediated peripubertal growth spurt, with sma1/+ mice displaying a less pronounced phenotype. All genotypes are viable and fertile, and the mode of inheritance is in accordance with a semidominant Mendelian trait. Adult SMA1 mice accumulate excessive amounts of sc and visceral fat in the presence of elevated plasma ghrelin levels, possibly reflecting altered energy partitioning. Our results suggest impaired storage and/or secretion of pituitary GH in mutants, resulting in reduced pituitary GH and reduced GH-stimulated IGF-1 expression. Generation and identification of the SMA1 mouse exemplifies the power of the combination of random mouse mutagenesis with a highly detailed phenotype-analysis as a successful strategy for the detection and analysis of novel gene-function relationships. | Introduction |
|---|
|
|
|---|
Significant progress in our understanding of the regulatory interface between growth control, energy metabolism, and fat mass regulation has been achieved by studying the recently discovered gastric hormone ghrelin, which potently stimulates GH release from the pituitary (11, 12) but also promotes the accretion of fat mass (13). When injected into mice and rats, ghrelin promotes a positive energy balance (13, 14, 15), and circulating ghrelin levels are preprandially elevated and postprandially decreased in humans and rodents, possibly representing a link between nutritional status and the neuroendocrine control of orexigenic drive, resting metabolic rate, tissue growth, and body composition.
Here we report the identification and phenotypic characterization of a novel missense mutation in the GH gene leading to semidominant dwarfism, hyperghrelinemia, and obesity. The mutation (sma1) was generated and identified in a large-scale, ethyl-nitroso-urea (ENU), random mouse mutagenesis program (GSF, Munich, Germany) (16, 17). This program represents a powerful phenotype-driven approach to gene-function analysis and increases existing mouse mutant resources.
| Materials and Methods |
|---|
|
|
|---|
Mapping of the mutation
Mapping of the mutation was performed at Ingenium Pharmaceuticals (Ifacredo, France), using a standard outcross/backcross strategy to C57BL/6Jico mice in combination with microsatellite markers specific for the C3HeB/FeJ and C57BL/6Jico strain. Genomic DNA was purified from tailtips of wild-type C3HeB/FeJ and C57BL/6Jico mice as well as from C3HeB/FeJ-sma1/+ (F1 generation) and [(C3HeB/FeJ-sma1/+ x C57BL/6Jico) x C57BL/6Jico] mutant backcross mice by using the DNeasy 96 tissue kit (QIAGEN, Hilden, Germany) according to the manufacturers protocol. PCRs were performed with fluorescent-labeled primers (MWG Biotech, Ebersberg, Germany), whose sequences were taken as previously published (Ref. 20 , http://www.genome.wi.mit.edu). The PCRs were performed in a Tetrad thermal cycler PTC 225 device (MJ Research Inc., Waltham, MA.) in a 10-µl reaction volume using Pharmacia Taq-DNA polymerase (Amersham Pharmacia Biotech, Piscataway, NJ). A 4-min denaturation step was followed by 28 amplification cycles comprising each of 30 sec denaturation and 30 sec annealing at the respective temperatures (given in Ref. 20), and 30 sec extension at 72 C. Samples were labeled with different dyes (20), and products were separated on an ABI 377 DNA sequencing device (PE Applied Biosystems, Foster City, CA) using internal length standards in every lane. Analysis was done with Genescan version 3.0 and Genotyper version 2.1 software (PE Applied Biosystems).
For amplification, the nucleotide sequence of the Mus musculus GH gene and its promoter were taken from GenBank/EMBL database (GenBank accession no. Z46663). The after GH-specific primer pairs designed by DOPE Interactiva (http://doprimer.interactiva.de) were used: 11M-Gh-F2: TCGGACCGTGTCTATGAGAAA; 11M-Gh-R2: GCTTCCAGGAACAAGATTGACA; 11M-Gh-F3: TAAGAGATCTAGCCACAGGGA; 11M-Gh-R3: CACTGCTGTTGGGAAAAGAAAG; 11M-Gh-F5: TCCTACCCTTGGATTCAAAA; 11M-Gh-R5: ACCAGCTTGTGTCTCGTCA; 11M-Gh-F6: CCGTTTGTGGAAGCAGGAA; 11M-Gh-R6: ATAACCCCAGGCTAGTCCAT; 11M-Gh-F8: GACAGTGCCCTCTAGTGCTCAGTG; 11M-Gh-R8: TTATCGTCTCATCGCCACCTTTGC. These were set up in 25-µl PCRs carried out on 10 ng genomic DNA, using Pharmacia Taq-DNA polymerase (Amersham Pharmacia Biotech) for 28 amplification cycles consisting of 30 sec denaturation at 94 C, 30 sec annealing at 55 C, and 90 sec extension at 72 C. PCR amplicons were purified by using the QIAquick PCR purification kit (QIAGEN) according to the manufacturers protocol. PCR products were sequenced using the PCR primer pair 11M-Gh-F2 and 11M-Gh-R2 and Big Dye thermal cycle sequencing kit (PE Applied Biosystems, PRISM). The reaction products were analyzed on an ABI 377 DNA sequencing device. Sequences were edited manually, and contingency assembly for mutation detection were performed using Sequencer version 4.0.5.
Genotyping
Because the sma1 point mutation affects a restriction site for AVAII (New England Biolabs, Beverly, MA) a combined PCR and digestion strategy could be employed for identification of mutants. After DNA extraction from tail tip tissue (0.51 cm) according to http://www.jax.org/resources/documents/imr/protocols, a 621-bp fragment covering part of exon 4 and exon 5 of the GH gene was amplified using the primer pair 5'-TCG GAC CGT GTC TAT GAG AAA-3' (forward) and 5'-GCT TCC AGG AAC AAG ATT GAC A-3' (reverse) (MWG Biotech). For amplification, 40 cycles consisting of 60 sec denaturation at 94 C, 60 sec annealing at 55 C, and 180 sec extension at 72 C were performed in a final volume of 50 µl. Sixteen microliters of the 621-bp amplicon were digested with 10 U AVAII and the resulting fragments separated on a 1.5% agarose gel. All mice in the colony were genotyped using this strategy.
Breeding and housing conditions of studied animals
For phenotypic characterization at Marburg University, a breeding colony was established from four dwarf males of the C3HeB/FeJ background (N2 to the first ENU-derived dwarf) and eight nonrelated wild-type C3HeB/FeJ females. Mice were kept in a non-SPF animal facility on a 12-h light,12-h dark cycle (lights on 0600 h) at an ambient temperature of 23 ± 2 C and fed Altromin 1314 standard breeding chow (Lage, Germany) ad libitum. For breeding, males were usually maintained with two females for a maximum period of 6 wk. Males were separated from females as soon as pregnancy was assessed from weight gain in females. Breeding cages were inspected for newborns every day, and gestation duration was calculated from the time interval between first day in breeding pair and resulting offspring day of birth. Offspring were weaned at 21 d, individually marked, and housed in groups of two to four individuals of the same sex. Because the number of mice per cage can influence uncoupling protein (UCP)-1 content in brown adipose tissue (BAT) and thereby affect energy expenditure (21), mice were kept singly for 2 wk before metabolic experiments. All experiments were performed in accordance with the German animal welfare laws.
Body weight and length measurements
Body weight was determined from d 7 to d 84 every 7 ± 1 d. Furless juveniles were individually marked by different patterns of foot paintings (Edding) and later by fur cuts. In a separate group of mice, body length was assessed on d 56 ± 1 (wk 8) (nose to anus distance in millimeters, d = ± 1 mm). For this procedure, all mice were briefly anesthetized with Halothan (Fluothane, Zeneca, Plankstadt, Germany) and placed dorsally in an extended position next to a ruler.
Pituitary GH immunostaining
Pituitary glands were obtained from dissected animals, fixed in 4% buffered formalin, and embedded in Technovit 7100 resin (Heraeus Kulzer, Hanau, Germany). For immunofluorescence 1.5-µm sections were blocked with 2% normal goat serum and incubated with an anti-GH polyclonal rabbit antibody [mouse GH (mGH); Diagnostic International GmbH, Germany] for 1 h (dilution: 1:500 in 1% BSA) at room temperature. The secondary antibody, Alexa Fluor 568 goat antirabbit IgG (H+L) (Molecular Probes Inc., Eugene, OR), was incubated for 1 h (dilution: 1:250 in 2% normal mouse serum) at room temperature. Nuclei were stained for two min with 4',6-diamidino-2-phenylindole (Sigma, St. Louis, MO) and sections were covered with fluorescent mounting medium (Dako Corp., Carpinteria, CA). Pictures were taken by a Axiovision system (Carl Zeiss, Göttingen, Germany) using double-exposure technique and 750 ms time of exposure for detecting the GH-immunostaining signal. For Western blot analysis of pituitary GH, shock-frozen pituitaries were sonicated in 12 µl radioimmunoprecipitation assay buffer [50 mM Tris-HCl (pH 7.5); 150 mM NaCl; 1% Nonindet-P40; 0.25% sodium desoxycholate, 1 mM EDTA]. An aliquot of the homogenate (1 µl) was briefly boiled in sodium dodecyl sulfate (SDS) buffer [2% SDS, 60 mM Tris-HCl (pH 6.8), 10% glycerol, 5%-dithiothreitol, 0.01% bromphenole blue], fractionated in 15% SDS-PAGE, and transferred by semidry blotting to nitrocellulose membrane (HybondC; Amersham Pharmacia Biotech). Membranes were probed using a rabbit antirat-GH antibody (1:90,000), obtained through the National Hormone and Pituitary Program (Dr. A. F. Parlow, National Institute of Diabetes and Digestive and Kidney Diseases, Torrance, CA). Immunoreactive GH protein was detected by enhanced chemiluminescence (Super Signal, Pierce, IL).
Measurement of major urinary protein (MUP)
Urine was collected from unrestricted 3-month-old mice between 0800 and 0900 h and centrifuged briefly for 3 min at 8800 x g. Two microliters of the supernatant were boiled in SDS buffer as described above. Samples were fractionated in 12% SDS-PAGE and subsequently stained with Coomassie blue. MUP (
20 kDa) represents the major protein component of mouse urine. MUP expression requires pulsatile occupancy of liver GHRs, and adult males secrete more than 3 times as much MUP as do females (22).
Blood chemistry and organ preparations
For organ preparation, previously nonfasted mice were anesthetized with CO2 and killed by bleeding of the vena cava inferior. Dissections were always carried out between 0900 and 1200 Central European Time. Blood samples of 0.30.5 ml were collected from the thoracic cavity with a syringe rinsed in 100 mM EDTA, 0.9% NaCl (pH 7.0). The plasma concentrations of IGF-1 were determined by enzyme immunoassay 102900(102900, Diagnostic Systems Laboratories Inc., Webster, TX), and leptin was determined using a commercially available ELISA (Crystal Chem Inc., Chicago, IL). Blood samples for GH and ghrelin analysis were taken by retroorbital puncture. Ghrelin levels were measured using a commercially available RIA (Phoenixpeptide, Belmont, CA), and GH determinations were performed with a commercially available ELISA (IBL-Hamburg GmbH, Hamburg, Germany) using a specific polyclonal rabbit-antirat GH antibody (intraassay variation < 3.7%, interassay variation < 7.1%, lower detection limit: 0.11 µIU/ml, no cross-reactivity with human chorionic gonadotropin or human PL). Organs were quickly removed and weighed, and interscapular BAT (iBAT) and pituitaries were frozen in liquid nitrogen for subsequent Northern or Western blotting analysis.
Body composition
Body fat content was determined by 16-h Soxhlet extraction of dried carcasses using chloroform as the extracting agent. Before carcass analysis, the gastrointestinal tract and brain were removed (
23 g/animal). Fat-free dry mass (FFDM) is dry carcass mass minus fat mass.
Food intake
Seven-day cumulative food intake was determined at an age of 23 and 56 months in single mice maintained in their home cage in the animal facility.
Analysis of UCP1 expression
Total RNA was isolated from iBAT by single-step acid guanidinium-phenol-chloroform extraction using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA), and 10 µg RNA were separated by electrophoresis in a formaldehyde-agarose minigel. RNA was transferred to a Hybond-N membrane (Amersham Pharmacia Biotech) and hybridized with a 1.10-kb 32P-labeled hamster UCP1 cDNA probe and a 1.14-kb 32P-labeled ß-actin probe for 24 h at 63 C as described previously (23). UCP1 and ß-actin mRNA hybridization signals were quantified by PhosphorImager (Storm 860, Molecular Dynamics, Amersham Pharmacia Biotech). UCP1 signals were normalized by ß-actin expression. UCP1 protein content in iBAT was determined by Western blot analysis as published previously (24).
Statistical analysis
Unless otherwise stated, all comparisons were performed on a parametric basis by one-way-ANOVA, using body weight as a cofactor as indicated (analysis of covariance), and the resulting estimations of effect size include the 95% confidence intervals. Subsequent multiple post hoc comparisons were adjusted according to the method by Bonferroni, and different superscript letters (a, b, c) in figures, tables, and text indicate significant differences between genotypes as revealed by these multiple post hoc comparisons. For analysis of growth curves, repeated-measurement ANOVA was employed. Correlation coefficients were calculated according to Pearson. All results were considered statistically significant at P < 0.05.
| Results |
|---|
|
|
|---|
g transition (position 3144 of the nucleic acid sequence, GenBank accession no. Z46663) in exon 5 of the GH gene of C3HeB/FeJ-SMA1 heterozygous and homozygous mutant animals. This transition translates into a D167G amino acid exchange in the C-terminal helix of the mature protein (D193G of the propeptide), a domain that is highly conserved throughout species (Fig. 1D
|
|
In accordance with reduced body weight and size, which persist for lifetime, SMA1 mice have reduced mean organ sizes (Fig. 3
). In +/+ and sma1/+, all organ weights except brain weight display high correlation coefficients with body weight (+/+: 0.580
r2
0.935; sma1/+: 0.708
r2
0.994, all P < 0.05; testes weight in +/+ (P = 0.17); n = 67). Correlation coefficients are lower in sma1/sma1 (r2
0.707) and do not reach statistical significance, which may result from low sample size (n = 5). Liver mass in sma1/+ and sma1/sma1 is nonproportionally reduced, i.e. lower than expected from the relationship of body mass and liver mass in wild-type mice (P < 0.001, 95% confidence interval: 0.30.6 g for mean analysis of covariance estimated difference of liver weight between mutants of either genotype and +/+ at a body weight of 21.9 g). Except for their smaller size, all organs dissected did not exhibit gross anatomic abnormalities.
|
x (+/+)
] (16%; P = 0.002;
2 = 12.457) and sma1/sma1 inbreeding (32%; P
0.001;
2 = 33.401), compared with [(+/+) x (+/+)] breeding pairs (5%). In contrast, postnatal mortality in single pups within a litter was observed in very few cases only, which in sma1/+ inbreeding did not selectively affect sma1/sma1 animals. This indicates that offspring genotype had no effect on postnatal survival.
Median litter size at weaning (all pups surviving) is influenced by parental genotype combination, with lowest number of pups in sma1/sma1 inbreeding and intermediate litter size in sma1/+ inbreeding (Table 1
). Participation of either sma1/+ male or female in matings to +/+ does not affect median litter size. In contrast, maximal litter size is dependent on the female genotype, possibly reflecting maternal-fetal size mismatch or fetal undernutrition in mutants.
|
x (+/+)
] breeding, and the resulting distribution frequencies of phenotypes are in accordance with a semidominant Mendelian trait (Table 2
2 = 3.081; df = 2). The frequency distribution of each sex among genotypes is equal in all groups (data not shown).
|
Pituitary architecture and GH immunostaining
The pituitary gland is reduced in overall size and weight in adult mutants at 3 months (median weight: +/+ 0.0015 g; sma1/+: 0.0010 g; sma1/sma1: 0.0006 g; n = 56 per genotype), and the anterior lobe is nonproportionally reduced in relation to the posterior lobe (Fig. 4
, AC). The acidophil cells of the anterior lobe, normally numerous and readily identified in control mice due to their strongly acidophil granules in cytoplasm, are nondetectable in the pituitaries of both sma1/+ and sma1/sma1 mice (Fig. 4
, DF). By immunofluorescence (Fig. 4
, GI) we could detect strong GH immunostaining in wild-type mice but only traces of GH in sma1/+ and almost no GH immunostaining in pituitaries of sma1/sma1. Interestingly, the residual GH immunostaining in sma1/sma1 appears to be related to single cells, with the majority of pituitary cells displaying almost no fluorescence at all. These graded results were confirmed by Western blot analysis of pituitary protein content, which showed greatly reduced pituitary GH in homozygous SMA1 and reduced GH immunostaining in heterozygous SMA1 (Fig. 5A
).
|
|
SMA1 are small and mice become obese
As expected from the dwarf phenotype, the FFDM of SMA1 is significantly reduced, with more than 50% of the reduction already observed in heterozygous mice (Table 3
). The FFDM of the examined mice is significantly correlated with body weight in all genotypes at 23 months and 56 months, respectively (all P < 0.001, 0.800
r2
0.987, except sma1/sma1 at 56 months: P = 0.112, r2 = 0.256). The reduction in FFDM of SMA1 is nonproportional with body weight (see the supplemental figure, A and B, published on The Endocrine Societys Journals Online Web site at http://endo.endojournals.org), suggesting altered body composition in mutants.
|
r2
0.990), after strong linear and parallel relationships, which allow reliable estimations of individual body fat content in mice aged 25 months simply by weighing a mouse (see the supplemental figure, C and D, and the supplemental table). Clearly, total fat mass is overproportionally enlarged in mutants, and percentage body fat can amount up to 46% of total body mass in some sma1/sma1 mice at 56 months (Table 3
An analysis of body fat distribution by determining selected fat depot weights in an additional group of male mice demonstrates that obesity is predominantly due to a nonproportional enlargement of the posterior subcutaneous depot (combined inguinal and dorsolumbar pads) (Table 4
). The volumes of site-specific fat depots are all strongly correlated with body weight (0.733
r2
0.670; all P < 0.001; n = 1012), and the nonproportional increase observed in total body fat of mutants is reflected in each fat depot (data not shown).
|
In accordance with white adipose tissue depot weights, mean iBAT weight is not significantly different between genotypes in younger mice, and it is lower in older SMA1 mice (Table 4
). When viewed from a weight-adjusted approach, however, iBAT is nonproportionally enlarged in mutants of both age classes (Fig. 6A
). Total RNA from iBAT yielded 1.3 ± 0.3 µg/mg (+/+), 1.3 ± 0.4 µg/mg (sma1/+), and 1.3 ± 0.2 µg/mg (sma1/sma1) at 23 months and 0.9 ± 0.2 µg/mg (+/+), 1.3 ± 0.2 µg/mg (sma1/+), and 1.0 ± 0.2 µg/mg (sma1/sma1) at 56 months, respectively (P = 0.38 (genotype); P = 0.01 (age); P = 0.27 (genotype x age); ANOVA P = 0.08; df = 5; F = 2.26). UCP-1 expression is not altered in iBAT of SMA1 mice as revealed by Northern blot and Western blot analysis (Fig. 6
, B and C).
|
Other phenotypic observations
Over all, sma1/+ and sma1/sma1 appear healthy and vigorous, but there is a clear delay in maturation and the development in the homozygous SMA1 phenotype. Up to 3 months of age, sma/sma1 individuals appear pedomorphic and resemble +/+ weanlings, both in appearance and behavior (i.e. characteristic vigorous tail shaking when anxious). Fur cuts, applied as individual tags, remained visible for a longer period in sma1/sma1 mice, compared with +/+ and sma1/+ mice. Similarly, disproportional accumulation of body fat is already visible at 3 months, but sma1/sma1 mice catch up with +/+ and sma1/+ with respect to their total body fat, thereby dramatically increasing percentage body fat.
| Discussion |
|---|
|
|
|---|
The reduction in size of SMA1 appears to be promoted predominantly by the inability of the mutated GH to stimulate postnatal growth either directly or indirectly via circulating IGF-1 levels, which are gradually reduced as a consequence of genotype heterocygotic or homocygotic for the GH point mutation. During puberty, increasing circulating IGF-1 has been demonstrated to be directly related to the peripubertal GH spurt, in line with its predominant role in bone formation and lean mass increase (25). Surprisingly, in mice aged 23 months, our measurements demonstrate low to undetectable plasma GH levels in both sma1/+ and sma1/sma1, suggesting both genotypes to be peripherally GH deficient at this age. However, because GH is released from the pituitary in an ultradian, pulsatile pattern (26), failure to detect GH in a single plasma specimen does not necessarily indicate absence of GH secretion. Indeed, the genotypic gradations seen in IGF-1 production, and persistence of the dimorphic pattern of urinary MUP excretion in sma1/+, compared with sma1/sma1 individuals, support reduced, albeit intact, secretion pattern of GH in sma1/+ but not sma1/sma1 (22).
As judged from spontaneous dwarf rats, dr/dr rats, which do not produce GH due to abnormal mRNA splicing, expression of one intact allele is sufficient to support normal growth in heterozygous individuals (27). Similarly, growth failure in humans and rodents caused by GH deficiency due to impaired responsiveness of pituitary somatotrophs to GHRH (28, 29) as well as in states of GH resistance or insensitivity (Laron syndrome), expression of one allele can support normal growth in the heterozygous genotype (30, 31, 32). Contrasting these observations, in SMA1 one intact allele is clearly not sufficient for restoring the wild-type phenotype. It remains to be elucidated how a GH gene dosage effect could be translated into a dominant GH reduction, giving rise to a semidominant, IGF-1-dependent phenotype. The finding that in heterozygous SMA1 both FFDM and IGF-1 levels are more than 50% reduced, compared with wild-type mice, already suggests that the SMA1 phenotype is caused by more complex growth interference than expected from a simple GH-gene dosage relationship.
In the absence of significant amounts of immunodetectable GH in the blood of heterozygous mice, there is intermediate to subintermediate GH immunostaining in anterior pituitary and GH immunostaining in residual cells of sma1/sma1. The graded result of pituitary GH immunoreactivity was confirmed by Western blot analysis, and total pituitary GH content is dramatically reduced as the number of somatotroph cells decreases. The combined findings therefore strongly suggest both impairment in pituitary GH storage, possibly due to reduced number of somatotroph cells, and impaired GH secretion in SMA1 mice.
In humans, clinical syndromes associated with reduced or absent GH expression and a deficiency in IGF-1 can be inherited as an autosomal recessive (isolated GH deficiency-1) or an autosomal dominant (isolated GH deficiency-II) trait (33, 34, 35). The latter have been hypothesized to result from mutant allele products that interfere with normal storage or secretion of the wild-type-protein (36, 37). In fact, only recently McGuinness et al. (38) reported that one of the GH gene splice variants,
exon3human GH (hGH), generates a 17.5-kDa hGH that lacks amino acids 3271 and can exert a dominant-negative effect on wild-type-hGH production both in vitro and in vivo. The dominant-negative
exon3hGH has been shown to inhibit wild-type-hGH secretion in a concentration-dependent manner (39), and the anterior pituitaries of
exon3hGH-transgenic mice showed marked hypoplasia and a profound reduction in cells staining for GH by immunohistochemistry.
Based on our phenotypic analysis of SMA1, we propose the structure of the mature sma1-GH to be altered, thereby preventing correct folding, storage, or secretion and hence signaling due to deleterious folding of the GH molecule at the level of the somtatotrophic pituitary cell. Support for this hypothesis derives from crystal structure analysis of the hGH molecule (40), which shares 62% sequence identity (73% similarity) with mouse GH (mGH). The inspection of hGH D169 (positional homologue to mGH D167) reveals that the residue is directed to the core of the protein with each side chain oxygen atom being involved in intramolecular hydrogen bonds. The O
1 of D169 forms a hydrogen bond to O
of S55 as well as to N
1 of W86. A weaker hydrophobic interaction connects O
2 of D169 and N
of K172. Given the perfect conservation at the homologous position of S55, W86, and D169 in all published GH sequences, this observation strongly points to stabilizing role of D169, an assumption that also fits well with the poor expression rate of both a human D169A mutant (41) and the murine SMA1 D167G variants in Escherichia coli (Wolf S. and G. Franke, Ingenium Pharmaceuticals, personal communication).
The fact that single immunopositive cells are visible in sma1/sma1 pituitaries is in agreement with a temporal and/or spatial degradation process, which may take place in somatotroph subpopulations of the pituitary and ultimately cause hypoplasia of the anterior lobe. Transgenic mice expressing thymidine kinase and acquiring pharmacological sensitivity to synthetic nucleosides (42), or transgenics expressing diphtheria toxin A genes under the control of the GH promoter (43), have demonstrated the existence of a common somatomammotroph stem cell precursor, which expresses GH and prolactin and has the capacity for self-regeneration. This population of self renewing cells is present in spatially distinct proliferative zones of the pituitary (44), and its mitotic activity may account for continuous residual GH immunostaining in sma1/sma1 mice before subsequent degradation.
However, in vitro studies of bovine GH (bGH) variants have also demonstrated the importance of the residues encoded by exon IV and also exon V (mGH residues 125190) for proper sorting of the GH protein to the secretory granules (45). Furthermore, dwarfism via impaired GH signaling has also been induced by functional antagonism due to overexpression of a mutated bGH analog (bGH119K) (46). In these transgenic mice, the degree of growth suppression was correlated with serum levels of bGH analog, and IGF-1 levels were markedly reduced (47). At the present state of phenotypic analysis of SMA1, dominant-negative action of sma1-GH, possibly driven by increased hypothalamic releasing activity via ghrelin and other GH secretagogues, and its increasing interference with residual wild-type GH is the most favorable hypothesis that we can presently put forward to explain the semidominant, IGF-correlated phenotype, which is unique among models of heritable dwarfism and IGHD syndrome in man (34). Further research on SMA1 is required to fully understand all mechanisms involved in the generation of the semidominant phenotype.
Obesity is frequently associated with impairments of the GH axis in rodents as well as humans, and the finding that SMA1 mice become obese certainly appears to be in agreement with the reduction or lack of lipolytic activity caused by reduced or absent biofunctional GH levels in heterozygous or homozygous SMA1 mice, respectively. In lit/lit mice, a model for isolated GH deficiency, obesity is evident starting from puberty (2). Transgenic mice developed by Kopchick and coworkers (48), which express a functional GHR antagonist (bGHG119K), display obesity of a similar magnitude (20% at 23 months) when compared with sma1/sma1 mice, and are of similar size and weight. Very recently GHR/BP-KO mice have been reported to exhibit increased adipose tissue mass as well (49).
From a thermoregulatory perspective, we would expect small mice (i.e. sma1/+ and sma1/sma1) to be confronted with higher thermogenic demands due to a relatively larger surface area compared with +/+ mice, thereby counteracting obesity. In small mammals, BAT represents the major source of nonshivering thermogenesis, i.e. heat generated by uncoupling the respiratory chain from ATP-synthesis via UCP1 (50, 51). The recruitment of BAT thermogenic capacity not only involves UCP1 synthesis but also increased mitochondrial biogenesis and proliferation of tissue mass (52). In agreement, Li et al. (49) have reported increased mRNA levels of UCP-1 in BAT of GHR/BP KO and bGHG119K mice and reduced levels in giant mice overexpressing bGH, suggesting GH to negatively regulate UCP1-expression. In contrast, in the present study the GH deficiency in SMA1 had no effect on UCP1 mRNA and protein levels, even though iBAT was nonproportionally enlarged. Because the nonproportional increase of tissue mass was not accompanied by increased UCP1 synthesis, and RNA content per milligram tissue was similar in all genotypes, the effect of genotype on iBAT mass is most likely related to increased triglyceride storage rather than increased thermogenic capacity per se. Further investigation on nonshivering thermogenesis, body temperature, and energy balance will be necessary to resolve the metabolic phenotypes in SMA1 and other obese dwarf models.
In addition to its GH-releasing ability, ghrelin may be one endocrine player in the promotion of elevated body fat content in SMA1 because it has been shown to potently stimulate food intake and reduce fat oxidation, thereby inducing obesity in rodents. However, with the exception of patients with Prader-Willi syndrome, ghrelin secretion patterns are generally markedly reduced in obese compared with normal-weight rodents and humans (53, 54). Furthermore, ghrelin is not elevated in GH-deficient dwarf rats but is in hypophysectomized rats (15), which suffer from multiple endocrine deficiencies. In accordance with these findings, a marked increase in plasma ghrelin of hypothyroid rats, but reduced levels in the same model of GH-deficient dwarf rats has been reported in a different study (55). At present, to our knowledge SMA1 is the only published obese animal model exhibiting hyperghrelinemia, and thus SMA1 could provide an attractive research tool to further investigate the interactions between growth and energy homeostasis as well as for the screening and testing of novel ghrelin receptor antagonists, which are currently under development in numerous academic and for-profit laboratories. However, because GH deficiency in SMA1 will almost certainly affect other GH-dependent pathways such as lipoprotein lipase activity, glucose uptake, and food intake (56), the amount of body fat observed in SMA1 and other GH-deficient rodents and subjects is also likely to reflect the lack of additional direct metabolic actions of GH. With respect to possible altered energy partitioning in SMA1, we hypothesize that in heterozygous SMA1 earlier onset of excessive nonproportional fat accumulation may be promoted by combined effects of elevated ghrelin levels, reduced directly GH-dependent lipolytic activity, and increased caloric intake or feed/gain efficiency.
In summary, we conclude that that the D167G mutation in the SMA1 mouse GH leads to a variant protein that most probably exerts the majority of its effects through disturbance of postnatal growth via some yet unknown mechanism that affects pituitary GH storage and release. The semidominant phenotype of SMA1 is unique among dwarf rodent models and will provide new insights into the mechanisms of GH/IGF-1-mediated growth. Furthermore, SMA1 mice are obese and display elevated ghrelin levels, thereby linking the metabolic and the growth axis in a unique semidominant way, which could establish SMA1 a suitable research tool for the investigation of future roles for ghrelin receptor agonists and antagonists in the regulation of energy balance and nutrient partitioning.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: BAT, Brown adipose tissue; bGH, bovine GH; ENU, ethyl-nitroso-urea; FFDM, fat-free dry mass; GHR, GH receptor; hGH, human GH; iBAT, interscapular BAT; mGH, mouse GH; MUP, major urinary protein; SDS, sodium dodecyl sulfate; UCP, uncoupling protein; WAT, white adipose tissue.
Received August 27, 2003.
Accepted for publication January 9, 2004.
| References |
|---|
|
|
|---|
-cells of humans and rats and stimulates insulin secretion. Diabetes 51:124129This article has been cited by other articles:
![]() |
D. E. Berryman, E. O. List, A. J. Palmer, M.-Y. Chung, J. Wright-Piekarski, E. Lubbers, P. O'Connor, S. Okada, and J. J. Kopchick Two-Year Body Composition Analyses of Long-Lived GHR Null Mice J Gerontol A Biol Sci Med Sci, November 9, 2009; (2009) glp175v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Gelling, W. Yan, S. Al-Noori, A. Pardini, G. J. Morton, K. Ogimoto, M. W. Schwartz, and P. J. Dempsey Deficiency of TNF{alpha} Converting Enzyme (TACE/ADAM17) Causes a Lean, Hypermetabolic Phenotype in Mice Endocrinology, December 1, 2008; 149(12): 6053 - 6064. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Speakman, C. Hambly, S. Mitchell, and E. Krol The contribution of animal models to the study of obesity Lab Anim, October 1, 2008; 42(4): 413 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M A Arafat, B Otto, H Rochlitz, M Tschop, V Bahr, M Mohlig, S Diederich, J Spranger, and A F H Pfeiffer Glucagon inhibits ghrelin secretion in humans Eur. J. Endocrinol., September 1, 2005; 153(3): 397 - 402. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Speakman Body size, energy metabolism and lifespan J. Exp. Biol., May 1, 2005; 208(9): 1717 - 1730. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Goldstone, M. Patterson, N. Kalingag, M. A. Ghatei, A. E. Brynes, S. R. Bloom, A. B. Grossman, and M. Korbonits Fasting and Postprandial Hyperghrelinemia in Prader-Willi Syndrome Is Partially Explained by Hypoinsulinemia, and Is Not Due to Peptide YY3-36 Deficiency or Seen in Hypothalamic Obesity Due to Craniopharyngioma J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2681 - 2690. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alba and R. Salvatori A Mouse with Targeted Ablation of the Growth Hormone-Releasing Hormone Gene: A New Model of Isolated Growth Hormone Deficiency Endocrinology, September 1, 2004; 145(9): 4134 - 4143. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |