help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1763
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/6/2713    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alimov, A. P.
Right arrow Articles by Koszewski, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alimov, A. P.
Right arrow Articles by Koszewski, N. J.
Endocrinology Vol. 145, No. 6 2713-2720
Copyright © 2004 by The Endocrine Society

Contrasting Mammalian Parathyroid Hormone (PTH) Promoters: Nuclear Factor-Y Binds to a Deoxyribonucleic Acid Element Unique to the Human PTH Promoter and Acts as a Transcriptional Enhancer

Alexander P. Alimov, M. Chris Langub, Hartmut H. Malluche, Ok-Kyong Park-Sarge and Nicholas J. Koszewski

Division of Nephrology, Bone and Mineral Metabolism and Department of Physiology (O.-K.P.-S.), University of Kentucky Medical Center, Lexington, Kentucky 40536-0298

Address all correspondence and requests for reprints to: Dr. Nicholas J. Koszewski, Division of Nephrology, Bone and Mineral Metabolism, University of Kentucky Medical Center, Room MN562, 800 Rose Street, Lexington, Kentucky 40536-0298. E-mail: njhosz0{at}uky.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The identification of a highly conserved specificity protein 1 (Sp1) DNA element in mammalian PTH promoters was recently reported. However, the presence of a novel DNA-binding complex was subsequently observed exclusively with the human PTH (hPTH) Sp1 element in mobility shift studies. Point mutations in the hPTH Sp1 element revealed the factor recognized a CAAT-like sequence resulting from a single nucleotide difference unique to the human sequence relative to other mammalian promoters. A consensus nuclear factor Y (NF-Y) element was able to specifically compete for formation of the novel complex, whereas antiserum directed against the B-subunit of NF-Y supershifted the complex without disturbing binding by the Sp3/Sp1 proteins. Moreover, immunocytochemistry confirmed the nuclear localization of NF-Y in parathyroid gland cells. Transient expression of a dominant negative form of NF-Y impaired basal hPTH promoter activity in opossum kidney cells. Studies in Drosophila SL2 cells revealed that an intact NF-Y complex was required to strongly activate transcription from the hPTH promoter, and mutational analysis confirmed the identity of the NF-Y and Sp1 DNA elements. Finally, coexpression studies in SL2 cells indicated that NF-Y and Sp1 competed for binding to their adjoining sites in the hPTH promoter. In summary, an NF-Y enhancer DNA element has been identified that is uniquely positioned in the hPTH promoter and partially overlaps with the species-conserved Sp1 element. Binding appears to be mutually exclusive by the two transcription factors to this site and suggests that separate signaling pathways may be using this DNA locus to enhance transcription of the hPTH gene.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DESPITE THE CLEAR importance of PTH in numerous physiological processes, there is a significant gap in our knowledge of the activating and repressing factors that control its transcription. A handful of proteins have recently been shown to be important in parathyroid gland (PTG) development, including glial cells missing, Eya1 and Hoxa3/Pax1 (1, 2, 3). Several reports have described a cAMP response element (CRE) near the promoters of the human, bovine, and, more recently, murine PTH genes (4, 5, 6).

Studies of the near promoter region of the PTH promoter have been limited, but have largely focused on the human gene. In addition to the aforementioned CRE, a repressor DNA element unique to the human PTH (hPTH) promoter binds the vitamin D receptor (VDR) and appears to be limited to a single half-site (7). Follow-up studies indicated that this may reflect independent binding by the VDR or in conjunction with some different nuclear accessory factor(s) (8). However, others have found that binding to the hPTH vitamin D response element required VDR heterodimerization with the retinoid X receptor, and the half-site was actually part of a poorly conserved direct repeat element (9). Finally, an unidentified transcription factor was observed binding to a DNA sequence adjacent to the VDR element in the hPTH promoter (10); however, its identity remains unknown.

A basic local alignment search tool (BLAST 2.0) computer analysis of the near promoter region from different mammalian PTH genes was conducted to identify conserved DNA regions that may harbor binding sites for essential transcription factors involved in regulating gene activity (11). Out of this analysis, our laboratory reported the existence of a highly conserved specificity protein 1 (Sp1) DNA element that functioned as an enhancer when linked to a heterologous promoter in transfection experiments (12). Furthermore, the study revealed that bovine PTGs (bPTGs) expressed high levels of Sp3/Sp1, and that binding by these proteins to the bPTH Sp1 element increased or was stabilized by phosphatase treatment of the nuclear extracts, suggesting that the phosphorylation status of the Sp proteins in the PTGs may impact their ability to bind to DNA and affect transcription of the PTH gene.

The present study now reports that binding of bPTG nuclear extracts to the hPTH Sp1 element unexpectedly revealed the existence of a novel DNA-binding complex not seen with analogous conserved Sp1 elements from the bovine, murine, or rat PTH promoters. Analysis of the human gene revealed that the difference of a single nucleotide gave rise to a functional nuclear factor Y (NF-Y) DNA enhancer element that partially overlaps with the Sp1 binding site. The data point to the convergence of two distinct nuclear factor binding sites at this locus that can independently activate transcription of the hPTH gene.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
General
All enzymes were purchased from New England BioLabs (Beverly, MA) unless otherwise specified. Protease inhibitor cocktail (Complete, Mini) was purchased from Roche (Indianapolis, IN). Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA). The sequences (top strand) of the DNA elements used in EMSA were: hu-man PTH Sp1, AGAGTGTGCACCGCCCAATGGGTGTGTGTA; bovine PTH Sp1, AGAATGAGCACCGCCCCATGGGAGTGTGTG; rat PTH Sp1, GGAGTGGGCACCGCCCGATGAGGGTAGGTG; murine PTH Sp1, GGAGTGGGCACCACCCCATGAGGGTATGTG; consensus Sp1, GAT-CTGCTCGCCCCGCCCCGATCGAATG; consensus NF-Y, AAGAGATTAACCAATCACGTACGGTCT; consensus NF-1, CGTCCCTTGGCGTGCAGCCAATGCACA; and chicken vitellogenin II estrogen response element (ERE), CTTCCTGGTCAGCGTGACCGGAGC. The anti-NF-Y B-subunit antibody was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The opossum kidney (OK) and Drosophila SL2 cell lines were purchased from American Type Culture Collection (Manassas, VA). Lipofectamine/Plus reagent and Cellfectin were purchased from Invitrogen Life Technologies (Carlsbad, CA). Luciferin assay reagent and cell lysis buffer were purchased from Promega Corp. (Madison, WI). bPTGs were obtained from local meat-processing facilities, including C&W Meat (Cynthiana, KY) and Boone’s Abattoir (Bardstown, KY).

Preparation of nuclear extracts
Tissues were placed in ice-cold DMEM/Ham’s F-12 (1:1; no phenol red) and transported to the laboratory. It was necessary to dissect away surrounding fat from the parathyroid tissue before the extraction process. The tissues were then minced, incubated on ice in 3 vol of a cold, low salt buffer [10 mM HEPES (pH 7.), 10 mM KCl, 1.5 mM EDTA, 2.0 mM dithiothreitol, 10% glycerol, and 1x protease inhibitor cocktail] for 20 min, followed by cell disruption with a Teflon Dounce homogenizer (Kontes Co., Vineland, NJ). After a 30-min spin at 100,000 x g, the supernatants were removed, and the nuclear pellets were resuspended in 1 vol cold, high salt buffer (same as above with 400 mM KCl) and incubated on ice for 30 min with occasional gentle mixing. Samples were then spun at 100,000 x g for 30 min. The supernatant fractions were collected, aliquoted into individual tubes, snap-frozen, and stored at –70 C before use.

PCR and preparation of PTH promoter fragments
The hPTH promoter (–177 to +21) luciferase reporter plasmid (hPTHp/luc) was constructed as follows. Human genomic DNA was used as template in a PCR using the following primers: hPTHPromF, 5'-ATGGATCCAATTATCTGAAACTTAAGAAGA; and hPTHPromR, 5'-ATCTCGAGACAACTGATGAATTGGACTGCA. PCR was performed by initial denaturation at 94 C for 3 min, then for 30 cycles as follows: 94 C for 30 sec, 56 C for 15 sec, and 72 C for 1 min. The herpes simplex virus thymidine kinase/luciferase reporter vector was a gift from Dr. D. Kaetzel (University of Kentucky, Lexington, KY). The thymidine kinase promoter was excised by digestion with BamHI/XhoI, and the hPTH promoter PCR fragment was digested with the same enzymes and directionally cloned into the linearized vector to create the wild-type hPTHp/luc reporter. The inserted promoter fragment was subjected to manual sequencing analysis to verify sequence identity. The bovine PTH promoter (–170 to +24) luciferase reporter was similarly prepared using the following primers: bPTHPromF, 5'-ATGGATCCAATTATCTAAAATTTAAGAAGA; and bPTHPromR, 5'-TACTCGAGAAGGCTGATAAATTGAGCTGTA.

Selective mutation of NF-Y and Sp1 binding sites within the context of the wild-type hPTH promoter was accomplished by two-step PCR using mutant oligonucleotides and the hPTHPromF and hPTHPromR primers described above. For example, to inactivate the NF-Y site, two separate PCRs were performed to generate mutant promoter fragments with overlapping ends. One PCR consisted of hPTHPromF primer and HP-R-NFY-mut, ACACACACCCACGGGGCGGTGCACACTCTT; whereas the second reaction consisted of hPTHPromR and HP-F-NFY-mut, GTGCACCGCCCCGTGGGTGTGTGTATGTGC (mutations are underlined). PCR was performed by initial denaturation at 94 C for 3 min, then for 30 cycles as follows: 94 C for 30 sec, 56 C for 15 sec, and 72 C for 45 sec. After isolation of the two separate PCR products, aliquots of each were mixed, and PCR was performed again using the hPTHPromF and hPTHPromR primers and the conditions described above to generate the mutant NF-Y hPTH promoter fragment. The mutant promoter was isolated, digested with BamHI/XhoI, and ligated into the luciferase reporter as described above. Mutation of the Sp1 element involved the following two mutant primers: HP-R-Sp1-mut, TGGGCATAGCACACTCTTCTTAAGTTTCAG; and HP-F-Sp1-mut, TAAGAAGAGTGTGCTATGCCCAATGGGTGT. All mutant promoters were subjected to manual sequencing analysis to verify sequence identity.

EMSA
Double-stranded oligonucleotide probes were radiolabeled using the combination of T4 polynucleotide kinase and [{gamma}-32P]ATP (6000 Ci/mmol; PerkinElmer, Boston, MA). The radiolabeled DNA fragments were subsequently gel-purified before use in binding reactions. Binding reactions (20 µl total volume) were assembled in a buffer consisting of 120 mM KCl, 20 mM Tris (pH 7.5), 1.5 mM EDTA, 2 mM dithiothreitol, 5% glycerol, 0.5% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate, 10 mM NaF, 100 µM Na3VO4, 1.5 µg poly (2'-deoxyinosinic-2'-deoxycytidylic acid) sodium salt, 100 µM leupeptin, and nuclear extract for 30 min at 4 C. Where indicated, samples were incubated with the indicated antiserum for 30 min before addition of the radiolabeled DNA probe. For cold competition experiments, the unlabeled competitor DNA was allowed to incubate with the samples for 30 min before addition of the radiolabeled DNA probe. After a 30-min incubation at 4 C with the radiolabeled DNA probe, the samples were loaded onto prerun 4% polyacrylamide gels (29:1), and electrophoresis was performed at approximately 14 V/cm for about 2 h with buffer cooling. Gels were transferred and dried, and autoradiography was performed overnight with enhancer screens.

Immunostaining
The bPTGs were immediately frozen, stored at –80 C and processed as follows. Ten-micrometer cryostat sections of the PTG on slides were thawed briefly at room temperature, fixed with 4% paraformaldehyde for 20 min, and subsequently repeatedly rinsed in PBS.

The manufacturer’s instructions using the Vectastain Elite avidin-biotin complex (ABC; Vector Laboratories, Inc., Burlingame, CA), avidin/biotin blocking, and diaminobenzidine chromogen kits were followed. Briefly, tissue sections were blocked with normal blocking serum, followed by incubations with avidin/biotin blocking reagents. Application of primary antibody (anti-NF-Y B-subunit) in PBS and 0.1% Triton X-100 followed, and slides were incubated at 4 C overnight. The next day, rinses in PBS were performed as well as incubations in secondary antibody and ABC complex. The use of diaminobenzidine chromogen reaction localized NF-Y in the PTG as a brown reaction product over positively labeled PTG cell nuclei. The tissue sections were counterstained with methyl green and immediately dehydrated in graded alcohols, cleared in xylene, and coverslippped using DPX mountant (Sigma-Aldrich, St. Louis, MO).

A preliminary titration experiment using 1:200, 1:1000, 1:2000, and 1:5000 dilutions was performed to determine the optimal antibody concentration for NF-Y B polyclonal antibody. The optimal primary antibody concentration was determined to be 1:2000. The titration experiment was also applied using 1:200, 1:300, and 1:500 of the secondary antibody, with 1:300 being the optimal dilution. Hence, these dilutions were used for the final staining experiments. Negative controls included PTG incubated without primary or secondary antibodies or ABC complex and subsequently processed following the detailed protocol.

Immunostained tissue sections were analyzed using an Axioplan microscope (Zeiss, Inc., Thornton, NY). Digital images were archived using a 330 CCD camera system (DAGE MTI, Michigan City, IN) linked to a Scion CG7/Apple computer (Apple Computer, Cupertino, CA). Color figures were generated using PhotoShop 7.0 software (Adobe Systems, Mountain View, CA).

Transient transfection
OK cells were maintained in DMEM/Ham’s F-12 (1:1) with 10% charcoal-stripped fetal bovine serum containing penicillin (100 U/ml) and streptomycin (100 µg/ml) at 37 C. Cells were plated in 24-well plates the day before transfection and were transfected in triplicate using Lipofectamine (1.5 µl/well) and Plus reagent (1.5 µl/well) with the hPTHp/luc construct (100 ng), cytomegalovirus-ß-galactosidase expression vector (5 ng) made up to 500 ng total DNA/well with carrier plasmid DNA in serum-free medium. Expression vectors for wild-type NF-Y A or dominant negative NF-Y Am29 were added as indicated in Fig. 5Go and balanced by the addition of pcDNA3.1 expression vector. After 3 h, serum was added to a 1% final concentration, and incubation was continued at 37 C for an additional 42 h. Lysates were prepared by washing the cells with PBS solution (twice), followed by overlaying with lysis buffer and two rounds of freeze-thawing.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 5. Transient transfection analysis in OK cells. A, OK cells were transfected with hPTHp/luc reporter in the absence (Con) or presence of increasing amounts (0.1, 1.0, and 10.0 ng) of wild-type NF-Y A-subunit or dominant negative NF-Y Am29 expression vectors. a, P < 0.05 vs. control; b, P < 0.05 vs. the same concentration of transfected wild-type expression vector.

 
Drosophila SL2 cells were maintained in Drosophila SL2 medium supplemented with 10% fetal bovine serum at 27 C. Cells were distributed in 24-well plates the day before transfection and were transfected in triplicate with the indicated PTH promoter luciferase reporter construct (100 ng unless otherwise noted), p97b-ß-galactosidase expression vector (50 ng), the indicated pPAC expression vectors, and carrier plasmid DNA made up to 500 ng total DNA/well. SL2 cells were transfected using Cellfectin (4 µl/well; Invitrogen, Carlsbad, CA) for 3 h in medium lacking serum, followed by supplementation to 7% serum and continued incubation for 42 h. Lysates were prepared by washing the cells with PBS (twice), followed by overlaying with lysis buffer and two rounds of freeze-thawing.

In all cases luciferase activities were determined and normalized with respect to values for ß-galactosidase enzymatic activity, and average values ± SE were calculated. Statistical analysis was performed using PSI-Plot software (Pearl River, NY), and results are representative of at least two independent experiments.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Regions of the PTH promoter that exhibited a high degree of DNA sequence conservation based on a cross-species BLAST 2.0 analysis were the initial focus of study in the laboratory. The presence of a highly conserved Sp1 DNA element in mammalian PTH promoters was established by this analysis and, furthermore, that Sp3 and Sp1 were highly expressed in bPTGs and specifically interacted with this sequence (12). As shown in Fig. 1AGo, Sp-binding complexes formed from bPTG nuclear extracts and radiolabeled bPTH Sp1 element could be specifically competed by excess cold competitor PTH Sp1 oligonucleotides from the rat, mouse, and human genes. Analogous complex formation and cold competition results were obtained when radiolabeled rat and murine PTH Sp1 oligonucleotides were examined in mobility shift assays (data not shown). In the course of follow-up studies, however, an anomaly was observed unique to the hPTH Sp1 element: the appearance of an additional, specific DNA-binding complex in EMSA (Fig. 1BGo). The novel DNA-binding complex exhibited self-competition with addition of an excess of the hPTH Sp1 oligonucleotide, but could not be competed for by the other three mammalian PTH Sp1 elements, suggesting that some unique difference exclusive to the human element was giving rise to this new complex.



View larger version (79K):
[in this window]
[in a new window]
 
FIG. 1. Mobility shift cold competition analysis with radiolabeled bovine (A) and human (B) PTH Sp1 elements using bPTG nuclear extract. Con, Control binding; Bov, excess bPTH Sp1 competitor; Rat, excess rat PTH Sp1; Mur, excess murine PTH Sp1; Hum, excess hPTH Sp1; ERE, excess ERE. Bound Sp3/Sp1 (Sp) and novel (X) complexes are indicated. NS, Nonspecific binding; F, free probe.

 
Examination of the DNA region surrounding the human and bovine PTH Sp1 elements used in EMSA revealed that they differed principally by three nucleotides (Fig. 2Go). Individual mutations were then introduced into the human sequence at each of those positions to mimic the bovine sequence, and these mutant oligonucleotides were subsequently used as cold competitors in EMSA with complexes formed on the wild-type hPTH Sp1 probe. By this analysis it was found that mutations at the first (Hum1->Bov1; lane 1) and third (Hum3->Bov3; lane 3) positions were able to compete for all three specific complexes, analogous to the wild-type human element (Fig. 2Go). However, mutation of the second position (Hum2->Bov2; lane 2) produced an oligonucleotide that could compete for Sp protein binding, but not the novel complex. Conversely, mutation of the wild-type bovine sequence to mimic the human nucleotide at this position resulted in an oligonucleotide competitor that could displace all three complexes (Bov2->Hum2; lane 4). Finally, direct binding analysis using the mutated (Hum2->Bov2) hPTH Sp1 element as a probe in EMSA revealed the absence of the additional complex (Fig. 2Go, lane M). Thus, a single nucleotide difference between the hPTH Sp1 element and the other mammalian PTH Sp1 elements appeared to give rise to the new binding complex: CCGCCCAATGG (hum) vs. CCGCCCCATGG (bovine/mouse; rat = G at this position).



View larger version (59K):
[in this window]
[in a new window]
 
FIG. 2. Mobility shift point mutation analysis of unknown transcription factor binding to the hPTH Sp1 element. Differences between human and bovine PTH Sp1 sequences are underlined. C, Control binding by bPTG nuclear extract to hPTH Sp1 element. Mutant sequences (no. 1–4) used as excess cold competitors are indicated by the number over the corresponding lane of the mobility shift experiment. M, Extract binding to radiolabeled mutant 2 sequence. Bound Sp3/Sp1 (Sp) and novel (X) complexes are indicated. Only the bound complexes are shown.

 
Based on the CAAT-like nature of the human sequence that conferred binding by the novel complex, additional cold competition studies with consensus NF-Y- and NF-1-binding sites that possess CAAT motifs were pursued. This analysis established that the complex formed by the bPTG nuclear extract with the hPTH Sp1 DNA element was specific for the NF-Y sequence (Fig. 3AGo). The identity of this novel band was confirmed when anti-NF-Y antiserum supershifted this complex, whereas normal serum had no effect (Fig. 3BGo). Thus, somewhat unexpectedly based on the high sequence conservation evident in this region of mammalian PTH promoters, the human gene possesses a unique NF-Y DNA element overlapping the species-conserved Sp1 element.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3. NF-Y binds to the hPTH Sp1 element. A, Mobility shift cold competition analysis of bPTG nuclear extract binding to hPTH Sp1 element. C, Control binding by bPTG extract; hSP1, excess hPTH Sp1 competitor; ERE, excess ERE; NF-Y, excess consensus NF-Y element; NF-1, excess consensus NF-1 element. NF-Y and Sp protein complexes are indicated. B, Antiserum analysis of bPTG nuclear extract binding to hPTH Sp1 element. {alpha}-NF-Y, anti-NF-Y B-subunit antiserum; Serum; normal rabbit serum. The NF-Y complex is indicated. Only the bound complexes are shown in both A and B.

 
Strong, specific NF-Y complex formation was also evident when the bPTG nuclear extract was incubated with a radiolabeled consensus NF-Y probe (Fig. 4AGo). Competition for complex formation was observed by the addition of an excess of consensus NF-Y and hPTH Sp1 oligonucleotides, whereas addition of an excess of an ERE or the bPTH Sp1 element was unable to compete for the binding interaction. This bound complex also supershifted with an anti-NF-Y B-subunit antibody, whereas normal serum had no effect. Immunostaining with the anti-NF-Y B-subunit antibody revealed abundant bPTG cells with positive nuclear labeling (Fig. 4BGo). Not all bPTG cells exhibited immunostaining in their respective nuclei. Representative negative control sections processed without the primary antibody or secondary antibody, or the ABC complex did not exhibit specific staining in the bPTG cells (Fig. 4CGo).



View larger version (89K):
[in this window]
[in a new window]
 
FIG. 4. NF-Y expression in bPTGs. A, Mobility shift of bPTG nuclear extract binding to consensus NF-Y DNA element. C, Control binding by bPTG extract; NF-Y, excess consensus NF-Y element competitor; ERE, excess ERE; hPTH, excess hPTH Sp1; bPTH, excess bPTH Sp1; {alpha}-NF-Y, anti-NF-Y B-subunit antiserum; Serum, normal rabbit serum. NF-Y complexes and free (F) probe are indicated. B, Positive immunostaining of bPTG cell nuclei (dark brown reaction product) using the anti-NF-Y B-subunit antiserum. C, Representative negative control of adjacent bPTG section shows absence of specific staining. Tissues in B and C counterstained with methyl green. Scale bars, 25 µm.

 
Transfection studies were then used to assess a functional role for NF-Y and the hPTH promoter. NF-Y is a trimeric complex composed of three individual subunits, termed A, B, and C, that are required for high affinity DNA-binding interactions (13, 14). Dominant negative forms of NF-Y A have been used to assist in discerning NF-Y’s role in gene transcription (15). Because of the lack of a suitable cell line that mimics a parathyroid chief cell, OK cells were transfected with the hPTHp/luc reporter construct and increasing amounts of expression vectors for wild-type NF-Y A-subunit or a dominant negative form of the A-subunit, NF-Y Am29. Although some changes in basal activity were observed with wild-type NF-Y A cotransfection, these were not statistically different from the control (Fig. 5Go). However, when the analogous experiment was performed using an expression vector for the dominant negative form, there was a significant decrease in basal hPTH promoter activity. Conversely, cotransfection of NF-Y Am29 failed to impact basal activity of the pGL3p luciferase reporter driven by the simian virus 40 promoter (data not shown). The ability of the dominant negative form of NF-Y A to decrease activity of the hPTH promoter suggests that the endogenously expressed NF-Y complex in OK cells contributes to basal expression associated with the transfected promoter construct.

Dissecting the individual and combined contributions of NF-Y and Sp proteins to hPTH promoter activity in OK cells is hampered by endogenous expression of both transcription factors. Therefore, the following transfection experiments were performed in Drosophila SL2 cells, which, unlike OK cells, lack expression of these mammalian factors, but have proven useful for studying their effects on transcription (16). Transfection of expression vectors for the individual A-, B-, or C-subunits of NF-Y into Drosophila SL2 cells failed to increase luciferase activity from the hPTH promoter (Fig. 6AGo). Likewise, transfection of combinations of AB-, BC-, or AC-subunits also did not stimulate luciferase activity. However, when the combination of all three subunits was simultaneously cotransfected into these cells, a dramatic increase in reporter gene activity was observed (Fig. 6AGo). These data demonstrate that NF-Y acted to stimulate transcription from the hPTH promoter and confirm that an intact NF-Y complex was required to carry out this function.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 6. NF-Y response in Drosophila SL2 cells. A, SL2 cells were transfected with hPTHp/luc reporter plasmid and the indicated expression vectors for the NF-Y complex subunits (14 ng/subunit). B, SL2 cells were transfected with either human (Hum; left panel) or bovine (Bov; right panel) PTH promoter reporter plasmids, and either an expression vector for Sp1 (5 ng) or the intact NF-Y complex (5 ng/subunit) as indicated.

 
A comparison was then made between the abilities of the hPTH and bPTH promoters to respond to NF-Y and Sp1 in Drosophila SL2 cells. Transfection of the hPTH promoter construct produced strong enhancement of reporter activity when either Sp1 or NF-Y was cotransfected into the cells, confirming the presence of response elements for these factors in this part of the promoter (Fig. 6BGo). A strong induction of luciferase activity was also observed when the analogous bPTH promoter construct was cotransfected with an Sp1 expression vector, but was nonresponsive to the presence of the NF-Y complex (Fig. 6BGo). Thus, the data are consistent with the earlier results of the EMSA experiments and demonstrate that the hPTH promoter harbors an ability to respond to NF-Y, whereas the corresponding promoter region from the bPTH gene lacks this capacity.

To establish that the individual DNA elements identified in the EMSA studies were responsible for transducing the corresponding enhancer activities, mutant hPTH promoter constructs were generated that eliminated binding to the NF-Y or Sp1 elements. When evaluated in EMSA, these mutant elements failed to significantly compete for specific binding by the matching factor (data not shown). Transfection of the hPTH mutant NF-Y promoter (NF-Ymut) into Drosophila SL2 cells was able to support robust induction of the reporter when cotransfected with an Sp1 expression vector; however, luciferase activity was highly attenuated compared with the wild-type human promoter when cotransfected with the NF-Y complex (Fig. 7Go). Similarly, the hPTH mutant Sp1 promoter (Sp1mut) responded strongly to the presence of the NF-Y complex, but exhibited an approximately 70% decline in luciferase expression compared with the wild type when an expression vector for Sp1 was included. Thus, the identified NF-Y and Sp1 DNA elements appear to be the principal cis-acting sequences responsible for transducing the enhancer activities of those factors in the hPTH promoter.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 7. Mutant promoter analysis in Drosophila SL2 cells. Cells were transfected with the wild-type (WT) hPTHp/luc reporter plasmid, the hPTH mutant NF-Y promoter construct (NF-Ymut), or the hPTH mutant Sp1 promoter construct (Sp1mut). Each of the promoters (100 ng) was cotransfected with an expression vector for either Sp1 (5 ng) or the intact NF-Y complex (5 ng/subunit) as indicated.

 
In light of the overlapping nature of the NF-Y/Sp1 response elements, the contribution of simultaneous expression of NF-Y and Sp1 to promoter activity was evaluated. Transfection experiments were performed using limiting amounts of the reporter, and two different levels of expression of the transcriptional enhancers. As shown in Fig. 8Go, transfection of cells with low amounts of either factor alone produced a significant increase in promoter activity, which was largely additive when both were simultaneously cotransfected into the same cells. However, although reporter activity increased significantly when the amounts of transfected expression vector for the individual factors were increased, the combination of a high level of expression of the two enhancers in the same cells produced only an intermediate level of stimulation.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 8. NF-Y and Sp1 compete for the hPTH Sp1 element. Studies were performed in Drosophila SL2 cells using a limited amount (10 ng) of hPTHp/luc promoter construct. Cells were cotransfected with an expression vector(s) for Sp1 or the NF-Y complex as indicated. +, 4.3 ng/well; 2+, 17.2 ng/well.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Studies of factors controlling PTH gene transcription have been severely hampered by the lack of suitable transformed cell lines that would facilitate analysis of the promoter. To overcome this limitation, our group has focused on the near promoter region of mammalian PTH promoters that exhibits a high degree of sequence conservation. This report now describes binding by the NF-Y complex isolated from bPTG nuclear extracts to a specific DNA element arising from a single nucleotide difference in the hPTH gene promoter. The NF-Y element is unique to the human gene, as corresponding sequence regions from other mammalian PTH promoters failed to bind NF-Y directly or displace this complex from the human binding complex in cold competition mobility shift assays. Immunocytochemistry using an anti-NF-Y B-subunit antiserum also demonstrated strong, positive nuclear labeling of bPTG cells. It is of interest to note that although nuclear immunolabeling with the anti-NF-Y antibody in bPTG cells was widespread, there were distinct cells that appeared not to express the protein. The pattern of staining is similar to that exhibited by other nuclear factors we recently reported, including Sp1 and Sp3 in the bPTG (12). This might be related to the metabolic stage of each individual bPTG cell, in which those with positive labeling could be actively involved with the transcriptional mechanism, whereas others without labeling might be in a state of quiescence relative to NF-Y-related function. Alternatively, protease activity and/or inactivity might play a role.

Transfection studies in Drosophila SL2 cells indicated that NF-Y acts as a potent enhancer of hPTH gene transcription using the minimal promoter (–177 to +21) construct, whereas negligible stimulation was observed from the analogous bovine promoter reporter. The NF-Y-binding site in the hPTH promoter also partially overlaps with the species-conserved Sp1 DNA element found in various mammalian PTH promoters. Our transfection studies indicated that coexpression of both factors produced an additive effect at low levels of expression and an intermediate level of activation at higher levels of expression. We interpret these results to suggest that as the level of expression of the two factors increased, a competitive situation developed for the limited amounts of hPTH promoter construct, and the corresponding overlapping NF-Y/Sp1 DNA elements present in them. In this scenario a distribution of NF-Y-bound or Sp1-bound hPTH promoters would be formed, and accordingly, an intermediate level of reporter activity would be observed. EMSA using larger amounts of bPTG nuclear extracts also failed to detect higher order bound complexes that would be indicative of simultaneous binding by both factors (data not shown). Alternatively, based on the ability of NF-Y and Sp1 to physically interact with each other and cooperate to stimulate gene transcription (17, 18, 19, 20, 21), we cannot rule out the possibility that a heterocomplex involving both factors is anchored to this site and produces an intermediate level of gene activation.

An analogous situation for NF-Y and Sp1 DNA response elements has been described in the promoter of the human Sp1 gene (22). An upstream Sp1-binding site overlapped with an NF-Y element resulting in a competitive DNA-binding scenario for these enhancers of Sp1 gene transcription. Transfection studies were also consistent with an additive effect when both factors were expressed. Overlapping Sp1 and NF-Y elements have been observed in the promoter of the human neuronal nicotinic receptor ß4-subunit gene (23). However, it appeared that NF-Y had a repressive effect on ß4 promoter activity and may be counteracting the strong enhancer activity associated with the adjoining Sp1 element.

Like NF-Y and Sp1, the long form of Sp3 also activated transcription of the hPTH promoter in Drosophila SL2 cells (data not shown). Thus, although Sp3 can act as a repressor of Sp1-derived gene activation (24, 25), it appears that in the present case at least three distinct factors are capable of interacting with this site and activating transcription of the hPTH gene. Further studies will be required to sort out the subtleties that presumably exist between these different factors in altering transcription from this position in the human gene. For example, we have shown in an earlier study that phosphatase treatment of bPTG nuclear extracts significantly stabilizes Sp1/3 in vitro DNA-binding capabilities to the bPTH Sp1 element (12). Moreover, the relative levels of expression in the PTG and the relative affinities of these factors for their respective DNA-binding sites will need to be evaluated to ascertain their roles in PTH gene transcription. However, it should be pointed out that although Drosophila SL2 cells have proven to be a useful model in delineating the effects of NF-Y and Sp proteins on other mammalian gene promoters (16, 17, 26), there is still the possibility that the activities of these proteins on the PTH promoter in parathyroid cells may be different from those seen in the insect cells.

The identification of NF-Y together with the Sp family adds significantly to the understanding of the transcriptional enhancers regulating hPTH gene expression. It also separates the organization of the human gene from those of other mammalian promoters. This is not to say that NF-Y does not contribute to PTH gene expression in the other species. In fact, our group has tentatively identified at least one NF-Y-binding site several hundred base pairs further upstream in the bPTH promoter at approximately –460 (data not shown). What is unique to the human gene is the positioning of enhancer elements for NF-Y and Sp proteins in an overlapping position in this part of the promoter. We can only speculate that one factor may be involved in basal transcriptional activity of the promoter, whereas the other may be linked to situations requiring enhancement above and beyond basal levels. It will be of some interest to determine why the human gene has evolved in this manner and to what extent this confers some selective advantage, if, indeed, it does, in regulating the transcription of this physiologically critical, calcitropic peptide hormone.

It will also be important to assess whether interactions with other nuclear factors that regulate the PTH gene play some role in this process. The cAMP response element-binding protein/activating transcription factor family, the vitamin D receptor, and an unidentified transcription factor all bind to nearby sites (4, 5, 6, 7, 10) and could conceivably interact with proteins bound at the NF-Y/Sp1 locus to either facilitate enhancement or repression of hPTH gene expression. Different extracellular stimuli have also been shown to affect transcription of the PTH gene (27, 28, 29, 30, 31), and whether a connection exists between various external stimuli and the activity of the NF-Y and Sp proteins to alter transcription of the PTH gene awaits further elucidation.

The finding that NF-Y and the Sp family are capable of acting as enhancers of hPTH gene transcription also provides targets for evaluation of their potential roles in the etiology of different parathyroid disease states. Notably, primary hyperparathyroidism is prevalent in postmenopausal women and is a contributing factor to their bone loss (32, 33). Furthermore, secondary hyperparathyroidism is endemic in individuals experiencing loss of kidney function and represents a significant challenge to the physician in terms of establishing appropriate serum PTH concentrations (34, 35). The involvement of either transcription factor in the development of hyperparathyroidism might then open the door to new treatment modalities that would target the actions of these factors within the PTG. Conversely, impaired activity of either of these factors may play some role in the many manifestations of hypoparathyroid disease (36). Therefore, it will be important to perform studies to determine how NF-Y and Sp proteins are regulated in the PTG and to evaluate their exact roles in transcribing the PTH gene both under normal conditions as well as in disease states associated with altered expression profiles of the peptide hormone.


    Acknowledgments
 
We thank H. Gravatte, T. Sexton, and J. van Willigen for their excellent technical assistance. We also extend our sincere thanks to C&W Meats (Cynthiana, KY) and Boone’s Abattoir (Bardstown, KY) for their assistance in procuring bPTGs. In addition, we acknowledge the generous contributions by Dr. R. Mantovani (Modeno, Italy) of wild-type (NF-Y A13) and mutant (NF-Y A13m29) NF-YA mammalian expression vectors, by Dr. G. Suske (Marburg, Germany) of the Sp1 Drosophila expression vector, and by Dr. T. Osborne (Irvine, CA) of the individual NF-Y A, B, and C Drosophila expression vectors.


    Footnotes
 
This work was supported by National Institutes of Health Grants DK-54276 (to N.J.K.), DK-02830 (to M.C.L.), DK-51530 (to H.H.M.), and HD-41609 (to O.-K.P.-S.) and the University of Kentucky Medical Center Research Fund (to N.J.K.).

Current address for M.C.L.: National Institutes of Health, 6701 Rockledge Drive, Room 4112, MSC 7814, Bethesda, Maryland 20892-7814.

Abbreviations: ABC, Avidin-biotin complex; BLAST, basic local alignment search tool; bPTG, bovine parathyroid gland; bPTH, bovine PTH; CRE, cAMP response element; ERE, estrogen response element; hPTH, human PTH; NF-1, nuclear factor 1; NF-Y, nuclear factor Y; OK, opossum kidney; Sp1, specificity protein 1; Sp3, specificity protein 3; VDR, vitamin D receptor.

Received December 30, 2003.

Accepted for publication February 23, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Xu PX, Zheng W, Laclef C, Maire P, Maas RL, Peters H, Xu X 2002 Eya1 is required for the morphogenesis of mammalian thymus, parathyroid and thyroid. Development 129:3033–3044[Abstract/Free Full Text]
  2. Su D, Ellis S, Napier A, Lee K, Manley NR 2001 Hoxa3 and pax1 regulate epithelial cell death and proliferation during thymus and parathyroid organogenesis. Dev Biol 236:316–329[CrossRef][Medline]
  3. Gordon J, Bennett AR, Blackburn CC, Manley NR 2001 Gcm2 and Foxn1 mark early parathyroid- and thymus-specific domains in the developing third pharyngeal pouch. Mech Dev 103:141–143[CrossRef][Medline]
  4. Rupp E, Mayer H, Wingender E 1990 The promoter of the human parathyroid hormone gene contains a functional cyclic AMP-response element. Nucleic Acids Res 18:5677–5683[Abstract/Free Full Text]
  5. Deutsch PJ, Hoeffler JP, Jameson JL, Lin JC, Habener JF 1988 Structural determinants for transcriptional activation by cAMP-responsive DNA elements. J Biol Chem 263:18466–18472[Abstract/Free Full Text]
  6. He B, Tong TK, Hiou-Tim FF, Al-Akad B, Kronenberg HM, Karaplis AC 2002 The murine gene encoding parathyroid hormone: genomic organization, nucleotide sequence and transcriptional regulation. J Mol Endocrinol 29:193–203[Abstract]
  7. Demay MB, Kiernan MS, DeLuca HF, Kronenberg HM 1992 Sequences in the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D3 receptor and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci USA 89:8097–8101[Abstract/Free Full Text]
  8. Mackey SL, Heymont JL, Kronenberg HM, Demay MB 1996 Vitamin D receptor binding to the negative human parathyroid hormone vitamin D response element does not require the retinoid X receptor. Mol Endocrinol 10:298–305[Abstract]
  9. Darwish HM, DeLuca HF 1996 Analysis of binding of the 1,25-dihydroxyvitamin D3 receptor to positive and negative vitamin D response elements. Arch Biochem Biophys 334:223–234[CrossRef][Medline]
  10. Darwish HM, DeLuca HF 1999 Identification of a transcription factor that binds to the promoter region of the human parathyroid hormone gene. Arch Biochem Biophys 365:123–130[CrossRef][Medline]
  11. Tatusova TA, Madden TL 1999 BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett 174:247–250[CrossRef][Medline]
  12. Alimov AP, Langub MC, Malluche HH, Koszewski NJ 2003 Sp3/Sp1 in the parathyroid gland: identification of an Sp1 deoxyribonucleic acid element in the parathyroid hormone promoter. Endocrinology 144:3138–3147[Abstract/Free Full Text]
  13. Sinha S, Maity SN, Lu J, de Crombrugghe B 1995 Recombinant rat CBF-C, the third subunit of CBF/NFY, allows formation of a protein-DNA complex with CBF-A and CBF-B and with yeast HAP2 and HAP3. Proc Natl Acad Sci USA 92:1624–1628[Abstract/Free Full Text]
  14. Sinha S, Kim IS, Sohn KY, de Crombrugghe B, Maity SN 1996 Three classes of mutations in the A subunit of the CCAAT-binding factor CBF delineate functional domains involved in the three-step assembly of the CBF-DNA complex. Mol Cell Biol 16:328–337[Abstract]
  15. Mantovani R, Li XY, Pessara U, Hooft van Huisjduijnen R, Benoist C, Mathis D 1994 Dominant negative analogs of NF-YA. J Biol Chem 269:20340–20346[Abstract/Free Full Text]
  16. Suske G 2000 Transient transfection of Schneider cells in the study of transcription factors. Methods Mol Biol 130:175–187[Medline]
  17. Yamada K, Tanaka T, Miyamoto K, Noguchi T 2000 Sp family members and nuclear factor-Y cooperatively stimulate transcription from the rat pyruvate kinase M gene distal promoter region via their direct interactions. J Biol Chem 275:18129–18137[Abstract/Free Full Text]
  18. Liang F, Schaufele F, Gardner DG 2001 Functional interaction of NF-Y and Sp1 is required for type A natriuretic peptide receptor gene transcription. J Biol Chem 276:1516–1522[Abstract/Free Full Text]
  19. Roder K, Wolf SS, Larkin KJ, Schweizer M 1999 Interaction between the two ubiquitously expressed transcription factors NF-Y and Sp1. Gene 234:61–69[CrossRef][Medline]
  20. Ge Y, Konrad MA, Matherly LH, Taub JW 2001 Transcriptional regulation of the human cystathionine ß-synthase-1b basal promoter: synergistic transactivation by transcription factors NF-Y and Sp1/Sp3. Biochem J 357:97–105[CrossRef][Medline]
  21. Murakami Y, Ikeda U, Shimada K, Kawakami K 1997 Promoter of the Na,K-ATPase {alpha}3 subunit gene is composed of cis elements to which NF-Y and Sp1/Sp3 bind in rat cardiocytes. Biochim Biophys Acta 1352:311–324[Medline]
  22. Nicolas M, Noe V, Ciudad CJ 2003 Transcriptional regulation of the human Sp1 gene promoter by the specificity protein (Sp) family members nuclear factor Y (NF-Y) and E2F. Biochem J 371:265–275[CrossRef][Medline]
  23. Valor LM, Campos-Caro A, Carrasco-Serrano C, Ortiz JA, Ballesta JJ, Criado M 2002 Transcription factors NF-Y and Sp1 are important determinants of the promoter activity of the bovine and human neuronal nicotinic receptor ß4 subunit genes. J Biol Chem 277:8866–8876[Abstract/Free Full Text]
  24. Hagen G, Muller S, Beato M, Suske G 1994 Sp1-mediated transcriptional activation is repressed by Sp3. EMBO J 13:3843–3851[Medline]
  25. Dennig J, Beato M, Suske G 1996 An inhibitor domain in Sp3 regulates its glutamine-rich activation domains. EMBO J 15:5659–5667[Medline]
  26. Luo D, Rando TA 2003 The regulation of catalase gene expression in mouse muscle cells is dependent on the CCAAT-binding factor NF-Y. Biochem Biophys Res Commun 303:609–618[CrossRef][Medline]
  27. Hernandez A, Concepcion MT, Rodriguez M, Salido E, Torres A 1996 High phosphorus diet increases preproPTH mRNA independent of calcium and calcitriol in normal rats. Kidney Int 50:1872–1878[Medline]
  28. Naveh-Many T, Friedlaender MM, Mayer H, Silver J 1989 Calcium regulates parathyroid hormone messenger ribonucleic acid (mRNA), but not calcitonin mRNA in vivo in the rat. Dominant role of 1,25-dihydroxyvitamin D. Endocrinology 125:275–280[Abstract]
  29. MacDonald PN, Ritter C, Brown AJ, Slatopolsky E 1994 Retinoic acid suppresses parathyroid hormone (PTH) secretion and preproPTH mRNA levels in bovine parathyroid cell culture. J Clin Invest 93:725–730
  30. Russell J, Lettieri D, Sherwood LM 1986 Suppression by 1,25(OH)2D3 of transcription of the pre-proparathyroid hormone gene. Endocrinology 119:2864–2866[Abstract]
  31. Silver J, Naveh-Many T, Mayer H, Schmelzer HJ, Popovtzer MM 1986 Regulation by vitamin D metabolites of parathyroid hormone gene transcription in vivo in the rat. J Clin Invest 78:1296–1301
  32. Khosla S, Melton III J 2002 Fracture risk in primary hyperparathyroidism. J Bone Miner Res 17(Suppl 2):N103–N107
  33. Krebs LJ, Arnold A 2002 Molecular basis of hyperparathyroidism and potential targets for drug development. Curr Drug Targets Immune Endocr Metab Disord 2:167–179
  34. Malluche HH, Mawad H, Trueba D, Monier-Faugere MC 2003 Parathyroid hormone assays: evolution and revolutions in the care of dialysis patients. Clin Nephrol 59:313–318[Medline]
  35. Silver J, Kilav R, Sela-Brown A, Naveh-Many T 2000 Molecular mechanisms of secondary hyperparathyroidism. Pediatr Nephrol 14:626–628[CrossRef][Medline]
  36. Garfield N, Karaplis AC 2001 Genetics and animal models of hypoparathyroidism. Trends Endocrinol Metab 12:288–294[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
A. P. Alimov, O.-K. Park-Sarge, K. D. Sarge, H. H. Malluche, and N. J. Koszewski
Transactivation of the Parathyroid Hormone Promoter by Specificity Proteins and the Nuclear Factor Y Complex
Endocrinology, August 1, 2005; 146(8): 3409 - 3416.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. J. Koszewski, A. P. Alimov, O.-K. Park-Sarge, and H. H. Malluche
Suppression of the Human Parathyroid Hormone Promoter by Vitamin D Involves Displacement of NF-Y Binding to the Vitamin D Response Element
J. Biol. Chem., October 8, 2004; 279(41): 42431 - 42437.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/6/2713    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alimov, A. P.
Right arrow Articles by Koszewski, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alimov, A. P.
Right arrow Articles by Koszewski, N. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals