| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Pharmacology (W.B.S., C.E.M., F.G., P.A.F.) and Medicine (C.A.S., A.B., P.A.F.), University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261; and Institute for Biological Sciences (G.E.W), National Research Council, Ottawa, Ontario, Canada K1A 0R6
Address all correspondence and requests for reprints to: Peter A. Friedman, Ph.D., University of Pittsburgh School of Medicine, Department of Pharmacology, E-1347 Biomedical Science Tower, Pittsburgh, Pennsylvania 15261. E-mail: paf10{at}pitt.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
GPCRs are classified in three major groups based on sequence homologies (2). PTH and PTHrP receptor (PTH1R) is a member of class B (also called class II), which consists of peptide hormone and neuropeptide GPCRs (2). PTH1Rs are important regulators of extracellular calcium and phosphate homeostasis and are prominently expressed in bone and kidney. In recent work, we found that PTH1R activation and internalization could be dissociated in a ligand- and cell-specific fashion that was determined by the pattern of expression of the cytosolic adapter protein Na/H exchange regulatory factor 1 (ezrin-binding protein of 50 kDa) (3). Specifically, PTH(734) internalized the PTH1R in renal distal convoluted tubule (DCT) and rat osteosarcoma (ROS 17.2) cells, which do not express Na/H exchange regulatory factor 1, but not in renal proximal convoluted tubule or human SAOS2 osteosarcoma cells that express NHERF1. One goal of the present investigation was to determine whether PTH peptides of intermediary length exerted comparable effects.
The quantitative relations between the magnitude of PTH1R activation and internalization are not known. If activation and internalization are linked in a linear fashion, this model predicts that with greater activation, receptor internalization would be augmented. A second goal of the present study was to test this postulate by using different structural analogs of PTH.
The biologically active form of PTH possesses distinct activation regions that are segregated into amino- and carboxy-terminal domains of the peptide. N-terminal amino acids are required for stimulation of adenylyl cyclase (AC), whereas the carboxy-terminal portion of the peptide is thought to be required for high-affinity binding to the receptor (4, 5, 6). PTH peptides truncated at the N or C terminus were used to test the hypothesis that PTH1R activation and internalization occurs in a coupled manner. We found that progressively N-truncated PTH peptides internalized the PTH1R without concomitant receptor activation. Conversely, a C-truncated PTH peptide efficiently activated the PTH1R but did not induce internalization.
| Materials and Methods |
|---|
|
|
|---|
The immortalized mouse DCT cells were stably transfected with human (hPTH1R)/enhanced green fluorescent protein (EGFP) by plating cells on a 10-cm dish in growth medium (DMEM/F12, 5% FCS, and 1% PSN). When the cells were 80% confluent, they were transfected with 10 µg hPTH1R/EGFP (Dr. C. Silve, Institut National de la Santé et de la Recherche Médicale, Paris, France) expression plasmid using the Superfect reagent (Qiagen, Valencia, CA). The cells were cultured for 48 h post transfection in growth medium, when they were trypsinized and split onto three 15-cm dishes containing selection medium (growth medium supplemented with 500 µg/ml G418, Geneticin; Invitrogen). These D1 cells were fed with selection medium every 3 d for 14 d, at which time individual clones were visible. Multiple colonies were isolated and cultured in selection medium until confluent as described (8). A representative colony was chosen for fluorescence measurements. D1 cells express 105 receptors/cell as determined by Scatchard analysis of radioreceptor binding assays using [125I]hPTH(134) as the radioligand (9). D1 cells were enriched by flow cytometry (MoFlo; Cytomation, Ft Collins, CO) for cells expressing a high level of PTH1R/EGFP. Enriched D1 cells express 106 receptors/cell.
A truncated chimeric 480-stop PTH1R was prepared in the following manner. The hPTH1R cDNA coding for amino acids 1480 was PCR amplified using the upper primer CGCTACCGGACTCAGATCTCG and the lower primer GAAGAATTCTGCCAGTGTCCAGC. PCR was performed on the hPTH1R/EGFP construct using Pfu turbo polymerase (Stratagene, La Jolla, CA) using the following conditions: 95 C for 2 min for one cycle; 95 C for 30 sec, 60 C for 30 sec, and 68 C for 4.5 min for 40 cycles; and 68 C for 10 min for one cycle. The lower primer inserted an EcoRI site at the 3' end of the 1.4-kb PCR product. The 1.4-kb PCR product was gel purified using Qiaex II beads (Qiagen). The truncated hPTH1R (1480) PCR product was sequenced (ABI Prism 3700 DNA Analyzer; Applied Biosystems, Foster City, CA). The PCR product was digested with HindIII and EcoRI. The full-length hPTH1R cDNA sequence was excised from the hPTH1R/EGFP plasmid using HindIII and EcoRI and replaced by ligating the digested 1.4-kb PCR product consisting of the 480 carboxy-terminal truncated hPTH1R cDNA. The ligation mixture was transformed into competent bacteria and plated on LB agar plates containing 30 µg/ml kanamycin. Kanamycin-resistant colonies were grown, and plasmid DNA was isolated (Qiagen). The presence of the cDNA insert was confirmed using a HindIII/EcoRI double digest. Receptor internalization studies were performed on cells 24 h after they were transiently transfected with the 480-stop PTH1R/EGFP. Receptor phosphorylation studies were performed in DCT cells stably transfected with the 480-stop PTH1R/EGFP. Expression of the 480-stop PTH1R/EGFP in the stably transfected cells was confirmed using confocal microscopy.
Peptides
The synthesis, purification, and characterization of synthetic human peptides [hPTH(134)NH2, (234)NH2, and (334)NH2] was performed by solid phase synthesis using the Fmoc protocol and high-performance liquid chromatography purification as described previously (10). [D-Trp12, Tyr34]bPTH(734)NH2 was purchased from Bachem (Torrance, CA).
Quantitative, real-time fluorescence measurement of PTH1R internalization
PTH1R internalization was studied as described in cells stably transfected with the hPTH1R/EGFP (3). Cells were plated on poly-D-lysine-coated 25-mm glass coverslips and analyzed at room temperature by confocal microscopy equipped with a 488-nm Ar/Kr laser (Molecular Dynamics, Sunnyvale, CA). Emitted fluorescence was detected with a 515- to 540-nm bandpass filter. Sequential images were acquired at 1-min intervals. After obtaining three control images, the indicated ligand was introduced, and images were obtained for an additional 3060 min to assure that internalization was complete with any given maneuver. Internalization of PTH1R/EGFP was reflected by a loss of plasma membrane fluorescence, quantified as changes in pixel intensity. PTH1R/EGFP internalization was analyzed by selecting the entire plasma membrane through a plane normal to and approximately 23 µm above the basal membrane surface (ImageScan; Molecular Dynamics). Fluorescence intensity was digitized at 16-bit resolution and converted to 256 grayscale levels for each image. The product of the number of pixels within the defined membrane area and the average pixel intensity was calculated for each time point. Receptor internalization is reported as the change from control.
Radioligand binding and internalization
Radioligand binding or internalization of high-performance liquid chromatography-purified [125I][Nle8,18, Tyr34]-PTH(134)NH2 were performed as described (3). Curves were fit using a four-point logistic algorithm (Prism; GraphPad Software, San Diego, CA).
AC activity
Cells were subcultured in 24-well plates seeded at 4 x 104 cells/well in DMEM/F12 containing 5% FCS and 1% PSN and grown to confluence. Cells were washed twice with Ca2+/Mg2+-free Hanks balanced salt solution and incubated with 0.5 µCi of [3H]adenine (PerkinElmer Life Sciences, Boston, MA) in fresh medium at 37 C for 2 h. The cells were treated with 1 mM 3-isobutylmethylxanthine (IBMX; Sigma Chemical Co., St. Louis, MO) in fresh medium for 15 min and incubated in the presence of the indicated PTH peptides for 5 min. The reaction was terminated by the addition of 1.2 M trichloroacetic acid, followed by neutralization with 4 N KOH. cAMP was isolated by two-column chromatography (11). Radioactivity was counted in a scintillation counter.
Phospholipase C (PLC)
DCT cells stably expressing the hPTH1R/EGFP were grown to confluence on a 12-well dish and loaded with myo-[2-3H]inositol (2 µCi/ml; ICN, Irvine, CA) by overnight incubation in serum-free, inositol-free DMEM/F12. The following day, the cells were rinsed and preincubated for 15 min in fresh serum-free, inositol-free DMEM/F12 containing 20 mM LiCl. The cells were then incubated at 37 C for 15 min or 60 min with the indicated PTH analog, after which, the medium was removed and replaced by 0.5 ml of ice-cold 20 mM formic acid. After 1 h on ice, the lysate was neutralized with 10 µl of 1 M NaOH. The lysate was then applied to Dowex 1X8 (Dow Chemical, Midland, MI) ion exchange columns 4 x 0.5 cm. The columns were washed with 3 x 5 ml of buffer A (60 mM sodium formate/5 mM sodium tetraborate). Total inositol phosphates were eluted with 1 x 5 ml of buffer B (2 M ammonium formate/100 mM formic acid), and 2 ml of each fraction was counted by ß scintillation spectrometry.
In vivo receptor phosphorylation
DCT cells stably expressing either the full-length or 480-stop PTH1R were grown to 90% confluence in six-well plates, rinsed with PBS, and then incubated overnight in serum- and antibiotic-free DMEM/F12. Cells were rinsed with PBS and incubated in phosphate-free DMEM for 45 min. To label intracellular pools of ATP, 100 µCi/well of [32P]-orthophosphate was added for an additional 2 h. At the end of the labeling period, the cells were rinsed once with media and stimulated with 1 µM of PTH(134), PTH(734), or PTH(131) for 40 min. To terminate ligand-induced phosphorylation, the cells were placed on ice, rinsed with ice-cold PBS, and lysed in 500 µl ice-cold Nonidet P-40 (NP-40) buffer (50 mM Tris, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40; Sigma), with the addition of a protease inhibitor cocktail consisting of 0.5 mM AEBSF (4-[2-aminoethyl]-benzenesulfonylfluoride), 150 nM aprotinin, 1 µM E-64, 0.5 mM EDTA, and 1 µM leupeptin (Calbiochem, San Diego, CA) and phosphatase inhibitors (1 mM Na-orthovanadate, 10 mM NaF, and 10 mM ß-glycerophosphate; Sigma), and incubated for 30 min on ice. A monoclonal anti-GFP antibody (A-11120; Molecular Probes, Eugene OR) was used for immunoprecipitation. The cell lysate supernatant was incubated with 2 µg of antibody for 1 h at 4 C with gentle agitation. Twenty-five microliters of Protein A-agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA) were added to the lysates and incubated with gentle agitation overnight at 4 C. The beads were washed four times in ice-cold NP-40 buffer and once in ice-cold PBS. The receptor complex was eluted from the beads by the addition of 40 µl sodium dodecyl sulfate-electrophoresis buffer and by boiling for 23 min. Agarose beads were pelleted by centrifugation, and 30 µl of sample was resolved on 7.5% SDS-PAGE. The incorporated [32P] was visualized in the stained and dried gels by phosphor imaging (Molecular Imager FX Pro; Bio-Rad Laboratories, Hercules, CA) after overnight exposure on a Kodak Ektascan storage phosphor screen (Kodak, Rochester, NY). The data were derived by scanning and digitizing an image; band densities were analyzed with NIH Image 1.61 (National Institutes of Health, Bethesda, MD; http://rsb.info.nih.gov/ij/index.html). Results are reported as fold basal to denote the ratio of receptor phosphorylation under basal conditions to that after PTH stimulation.
Immunoblotting
Cellular proteins were resolved by SDS-PAGE (12.5% acrylamide) and transferred to BA83 nitrocellulose membranes (0.2 µm; Schleicher & Schuell, Keene, NH). Blots were incubated for 2 h in Tris-buffered saline with Tween 20 (TBST; 10 mM Tris-HCl, pH 8.0; 150 mM NaCl, 0.2% Tween 20) containing 2% powdered skim milk and 1% BSA. After three washes with TBST, membranes were incubated for 2 h with a caveolin-1-specific primary antibody (mAb 2297; BD Transduction Laboratories, Inc., Lexington, KY;
1,000-fold diluted in TBST) and for 1 h with horseradish peroxidase-conjugated goat antimouse IgG (
5,000-fold diluted). Bound antibodies were detected using an enhanced chemiluminescence (ECL) detection kit (Amersham Pharmacia Biotech, Piscataway, NJ).
Statistics
Data are presented as means ± SE, and n indicates the number of independent experiments. Effects of experimental treatments were assessed by paired comparisons within experiments and reported as the mean ± SEM of the number of independent experiments. Paired results were compared by ANOVA, with posttest repeated measures analyzed by the Bonferroni procedure. Single comparisons to control were analyzed by Dunnetts test (Instat 3; GraphPad). Differences greater than P
0.05 were assumed to be significant.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
|
Clathrin and caveolae-mediated PTH1R endocytosis
Endocytosis of GPCRs typically occurs in a clathrin- and dynamin-dependent manner (22). Hypertonic sucrose, which disrupts clathrin polymerization, abolished PTH(134)-stimulated PTH1R internalization. These findings are consistent with previous reports that dominant negative K44A dynamin profoundly inhibited PTH1R internalization induced by either PTH(134) or (734) (3). Because dynamin is involved in endocytosis mediated by both clathrin and caveolae (23), we also examined the expression of caveolin-1 and the effects of two structurally unrelated inhibitors of caveolae-mediated endocytosis (24). As shown in Fig. 7
, caveolin-1 is expressed by proximal convoluted tubule and DCT cells. However, the caveolae-disrupting agents 2-hydroxypropyl-ß-cyclodextrin and filipin III were without inhibitory effect on PTH(134) or PTH(734)-induced PTH1R internalization (data not shown). Colchicine, a microtubule inhibitor that interferes with PTH-stimulated calcium transport (25), was without effect on PTH1R endocytosis (3).
|
| Discussion |
|---|
|
|
|---|
PTH1Rs exhibit ligand-specific activation (7, 26). The present study was initiated to determine whether PTH1R inactivation also displays such behavior. The results support this hypothesis. Strikingly, PTH(734), which is widely accepted to be devoid of biological activity and to act as a competitive inhibitor of the PTH1R, robustly promoted receptor internalization without accompanying activation. PTH peptides with lengths between PTH(134) and (734) exhibited proportionately intermediate effects on receptor internalization and an inverse effect on activation. In contrast, PTH(131), which effectively stimulated both AC and PLC, failed to induce PTH1R internalization. The present findings establish that PTH1R activation alone is insufficient to induce receptor endocytosis. These results provide experimental support for earlier suggestions that PTH1R activation and sequestration require different conformations (27, 28). Presumably, occupancy of a GPCR by agonists or antagonists stabilizes distinct receptor conformations. Such discrete conformations have been hypothesized to mediate different cellular functions (29), and this may be the case for the PTH1R.
When the wild-type PTH1R was expressed in HEK-293 cells or COS-7 cells, PTH(734) had no discernable effect on receptor internalization (9). The constitutively active PTH1R mutant T410P PTH1R is spontaneously and persistently associated with ß-arrestin2 and traffics independently of ligand occupancy (9). In cells expressing the T410P PTH1R, PTH(734) acts as an inverse agonist (30), i.e. a ligand that decreases receptor signaling activity below that of unoccupied receptors. Inverse agonism is unlikely to account for the effects of PTH(734) in the present experiments, however, because PTH(734) did not inhibit basal AC or PLC activity (Fig. 3
). Thus, the ability of PTH(734) to elicit PTH1R endocytosis in DCT cells is not due to constitutive receptor activity or trafficking.
Previous work has shown that PTH(134) (25, 31), but not PTH(734) (7), stimulates calcium entry in DCT cells and also activates MAPK (20). PTH1R activation has also been reported to stimulate phosphatidylinositol-3 kinase (32) and protein tyrosine kinase activation (33). However, as shown here, PTH1R internalization does not depend on calcium entry, MAPK, or phosphatidylinositol-3 kinase activation or protein tyrosine phosphorylation. The involvement of Gi/o was also ruled out because pertussis toxin did not affect PTH-induced PTH1R internalization. If these alternate signaling pathways and inverse agonism do not account for PTH1R internalization, what is the nature of the signal? Experiments investigating the role of PKA and PKC in PTH1R endocytosis provide some insight into the mechanism and regulation of PTH1R trafficking.
Inhibition of PKA with Rp-cAMPs did not block PTH1R endocytosis (Fig. 6
), suggesting that receptor internalization is independent of PKA. However, AC activation modified the magnitude and the kinetics of the full-length PTH1R internalization (Table 3
). This suggests that cAMP may exert an inhibitory influence on PTH1R internalization. Consistent with this argument, directly activating AC markedly reduced the magnitude but increased the t1/2 of internalization of the full-length PTH1R induced by PTH(734) (Table 3
). The AC dependence and PKA independence of PTH effects on internalization suggest the possible involvement of the exchange protein activated directly by cAMP. Exchange protein activated directly by cAMP is a guanine nucleotide exchange factor that is directly activated by cAMP, independent of PKA stimulation (34). The present results are compatible with the idea that cAMP affects the magnitude and extent of PTH1R internalization through such a PKA-independent mechanism.
In contrast to the absence of an effect of PKA inhibition of PTH1R internalization, suppression of PKC by three distinct means significantly reduced PTH1R internalization evoked by PTH(134) or PTH(734) (Table 2
, Fig. 6
). Together, these findings suggest that at least two independent regulatory events are involved in modulating PTH1R endocytosis. The first regulatory element involves PKC, whereas the second is an AC-dependent, but apparently PKA-independent, mechanism.
The PTH1R contains multiple consensus phosphorylation sites within the intracellular tail (18, 35). In the case of the PTH1R, phosphorylation appears to be facultative for the interaction with ß-arrestin and receptor internalization (15, 18). Internalization of the secretin receptor, another class B GPCR, is likewise unaffected by GRK phosphorylation (36). When the large intracellular carboxy terminus of the PTH1R was ablated, PTH(134) and PTH(734) internalized the receptor with identical kinetics (Fig. 2A
, Table 3
) and reduced the magnitude of PTH(734)-stimulated PTH1R internalization by about 50%. It appears, therefore, that the PTH1R C terminus contains regulatory domains that are involved in, but not required for, PTH1R internalization in DCT cells. Recent work on the role of the PTH1R C terminus in receptor signaling likewise disclosed that blockade of PKC inhibited internalization of the full-length PTH1R but had no effect on a similar 490-stop PTH1R (37).
The 480-stop PTH1R internalized in response to both PTH(134) and (734). Importantly, internalization of this phosphorylation-deficient truncated PTH receptor was no longer sensitive to AC or PKC inhibition. These findings are compatible with the conclusion that phosphorylation of the C terminus by PKA or PKC exerts a regulatory effect on PTH1R internalization. It is further concluded that because the truncated receptor was internalized by PTH(134) and PTH(734), albeit with different kinetics than those of the full-length receptor, an obligate role for direct phosphorylation of the PTH1R by PKA or PKC for PTH1R internalization is excluded. Consistent with these interpretations, the truncated PTH1R was not detectably phosphorylated in response to PTH(134), (134) (Fig. 5
, Table 1
). Similar conclusions have been reached by others (18, 35). Although the present findings exclude an effect of PKA activation on PTH1R internalization, PKA may nonetheless modulate other steps of PTH action or PTH1R trafficking by phosphorylating scaffolding or adapter proteins that play a role in recruiting the receptor to clathrin-coated vesicles.
The full-length PTH1R was phosphorylated in response to PTH(134), PTH(131), and, to a lesser extent, by PTH(734) (Fig. 5
, Table 1
). However, PTH(131) failed to internalize the PTH1R (Fig. 1
). Phosphorylation alone, therefore, is insufficient to induce PTH1R internalization. The C terminus of the receptor contains the phosphorylation sites because ablation of these sequences eliminated the ability of all three ligands to phosphorylate the PTH1R (Fig. 5
, Table 1
) (18, 35). Phosphorylation may, therefore, play a modulatory role but is evidently not required for PTH1R internalization. The fact that PTH(734), which doesnt stimulate either AC or PLC, promoted PTH1R phosphorylation is consistent with the idea that in situ phosphorylation is mediated by GRK2. When activation of the PTH1R was blocked by introducing a zinc ion bridge between helices 3 and 6 of PTH1R, GRK2-mediated phosphorylation and PTH1R internalization proceeded normally (27). These results suggest that the PTH1R conformation necessary for G protein activation differs from the one required for GRK-mediated receptor phosphorylation. The present work supports and extends the observations of others (9, 14, 18) demonstrating that phosphorylation of the C terminus of the PTH1R either by GRKs or second messenger-dependent kinases is not required for internalization. It has been proposed that phosphorylation of the C terminus of a GPCR, however, stabilizes the association between ß-arrestin and the PTH1R (38). Phosphorylation of the intracellular tail may produce a local concentration of negative charges that promotes binding to the positively charged phosphorylation recognition domain of arrestin, thereby stabilizing the formation of the receptor-arrestin complex (39). Alternatively, the phosphorylated C terminus of the GPCR may induce a conformational change in arrestin that permits a high-affinity interaction between the two proteins (39). Phosphorylation of the C terminus and the interaction with arrestin may also play a role in PTH1R desensitization, a process that is generally associated with receptor internalization. Thus, G protein activation and receptor internalization are controlled by distinct agonist-induced conformations of the PTH1R.
The C terminus of the angiotensin II type I receptor, which like the PTH1R is not required for receptor endocytosis, nonetheless influences receptor retention in endosomal compartments and delays its recycling to the cell surface (40). A conserved NPXXY sequence at the interface between the seventh transmembrane domain and the C terminus of many GPCRs serves as an endocytic signal (41). The C terminus of the PTH1R possesses serine and threonine residues downstream of an NPXXY motif. These sequences are associated with GPCRs that are slow to recycle to the plasma membrane (1). It is unclear, however, how these sequences regulate the kinetics of GPCR internalization in response to different structural analogs of the hormone. In view of the dissimilar kinetics of full-length and truncated PTH1R internalization, the results suggest that the C-terminal segment may provide additional sites of stabilization of the PTH1R/ß-arrestin complex during intracellular trafficking (9). The present findings are compatible with the view that the PTH1R may adopt different ligand-selective conformations. The ability of these ligands to induce PTH1R endocytosis is likely to involve distinct intracellular conformations. It has been suggested that the distinct biological effects of different ligands partially depend upon their abilities to induce endocytosis (42).
The present findings provide compelling evidence that GPCR activation and receptor endocytosis can be dissociated. Such dissociation makes it likely that GPCR signaling and receptor internalization depend on different intracellular conformations of the PTH1R. Thus, the dissociation between receptor activation and internalization as shown here may represent a more common biological phenomenon that contributes to ligand and cell-specific hormone and drug action for multiple classes of GPCRs.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: AC, Adenylyl cyclase; DCT, distal convoluted tubule; EGFP, enhanced green fluorescent protein; GPCR, G protein-coupled receptor; GRK, G protein-coupled receptor kinase; NP-40, Nonidet P-40; PKA, protein kinase A; PKC, protein kinase C; PLC, phospholipase C; PTH1R, PTH and PTH-related peptide receptor; Rp-cAMPs, Rp-adenosine-3',5'-cyclic monophosphorothioate; TBST, Tris-buffered saline with Tween 20.
Received September 9, 2003.
Accepted for publication March 4, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. L. Garrido, D. Wheeler, L. L. Vega, P. A. Friedman, and G. Romero Role of Phospholipase D in Parathyroid Hormone Type 1 Receptor Signaling and Trafficking Mol. Endocrinol., December 1, 2009; 23(12): 2048 - 2059. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H H Hong, X. Lu, M. S Nanes, and J. Mitchell Regulation of osterix (Osx, Sp7) and the Osx promoter by parathyroid hormone in osteoblasts J. Mol. Endocrinol., November 1, 2009; 43(5): 197 - 207. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. de Groot, K. Lee, M. Langeslag, Q. Xi, K. Jalink, R. J.M. Bindels, and J. G.J. Hoenderop Parathyroid Hormone Activates TRPV5 via PKA-Dependent Phosphorylation J. Am. Soc. Nephrol., August 1, 2009; 20(8): 1693 - 1704. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wheeler, J. L. Garrido, A. Bisello, Y. K. Kim, P. A. Friedman, and G. Romero Regulation of Parathyroid Hormone Type 1 Receptor Dynamics, Traffic, and Signaling by the Na+/H+ Exchanger Regulatory Factor-1 in Rat Osteosarcoma ROS 17/2.8 Cells Mol. Endocrinol., May 1, 2008; 22(5): 1163 - 1170. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wang, A. Bisello, Y. Yang, G. G. Romero, and P. A. Friedman NHERF1 Regulates Parathyroid Hormone Receptor Membrane Retention without Affecting Recycling J. Biol. Chem., December 14, 2007; 282(50): 36214 - 36222. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wheeler, W. B. Sneddon, B. Wang, P. A. Friedman, and G. Romero NHERF-1 and the Cytoskeleton Regulate the Traffic and Membrane Dynamics of G Protein-coupled Receptors J. Biol. Chem., August 24, 2007; 282(34): 25076 - 25087. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. B. Sneddon and P. A. Friedman {beta}-Arrestin-Dependent Parathyroid Hormone-Stimulated Extracellular Signal-Regulated Kinase Activation and Parathyroid Hormone Type 1 Receptor Internalization Endocrinology, August 1, 2007; 148(8): 4073 - 4079. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. B. Sneddon, Y. Yang, J. Ba, L. M. Harinstein, and P. A. Friedman Extracellular signal-regulated kinase activation by parathyroid hormone in distal tubule cells Am J Physiol Renal Physiol, March 1, 2007; 292(3): F1028 - F1034. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Friedman and W. G. Goodman PTH(1-84)/PTH(7-84): a balance of power Am J Physiol Renal Physiol, May 1, 2006; 290(5): F975 - F984. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Perry, S. Junger, T. A. Kohout, S. R. J. Hoare, R. S. Struthers, D. E. Grigoriadis, and R. A. Maki Distinct Conformations of the Corticotropin Releasing Factor Type 1 Receptor Adopted following Agonist and Antagonist Binding Are Differentially Regulated J. Biol. Chem., March 25, 2005; 280(12): 11560 - 11568. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |