help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1185
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sneddon, W. B.
Right arrow Articles by Friedman, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sneddon, W. B.
Right arrow Articles by Friedman, P. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PARATHYROID HORMONE
Endocrinology Vol. 145, No. 6 2815-2823
Copyright © 2004 by The Endocrine Society

Ligand-Selective Dissociation of Activation and Internalization of the Parathyroid Hormone (PTH) Receptor: Conditional Efficacy of PTH Peptide Fragments

W. Bruce Sneddon, Clara E. Magyar, Gordon E. Willick, Colin A. Syme, Ferruccio Galbiati, Alessandro Bisello and Peter A. Friedman

Departments of Pharmacology (W.B.S., C.E.M., F.G., P.A.F.) and Medicine (C.A.S., A.B., P.A.F.), University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261; and Institute for Biological Sciences (G.E.W), National Research Council, Ottawa, Ontario, Canada K1A 0R6

Address all correspondence and requests for reprints to: Peter A. Friedman, Ph.D., University of Pittsburgh School of Medicine, Department of Pharmacology, E-1347 Biomedical Science Tower, Pittsburgh, Pennsylvania 15261. E-mail: paf10{at}pitt.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
G protein-coupled receptors (GPCRs) mediate the action of many hormones, cytokines, and sensory and chemical signals. It is generally thought that receptor desensitization and internalization require occupancy and activation of the GPCR. PTH and PTHrP receptor (PTH1R) belongs to GPCR class B and is the major regulator of extracellular calcium homeostasis. Using kidney distal convoluted tubule cells transfected with a human PTH1R/enhanced green fluorescent protein fusion protein, quantitative, real-time fluorescence microscopy was used to analyze receptor internalization. In these cells, which are the target of the calcium-sparing action of PTH, PTH(1–34) activated adenylyl cyclase (AC) and phospholipase C (PLC) and PTH1R endocytosis. PTH(1–31), however, stimulated AC and PLC but not PTH1R endocytosis. Conversely, PTH(7–34) rapidly stimulated PTH1R internalization without activating AC or PLC. PTH(2–34) and (3–34) caused PTH1R internalization intermediate between PTH(1–34) and (7–34). PTH1R sequestration occurred in a dynamin- and clathrin-dependent manner. Directly activating AC inhibited PTH1R internalization in response to PTH(7–34). PTH1R endocytosis was sensitive to protein kinase C inhibition. PTH(1–34), (7–34), and (1–31) evoked PTH1R phosphorylation. Removal of most of the C terminus of the PTH1R eliminated receptor phosphorylation and the cAMP/protein kinase C sensitivity of internalization. PTH(1–34) and (7–34) internalized the truncated PTH1R with identical kinetics, and the response was unaffected by forskolin. Thus, the PTH1R C terminus contains regulatory sequences that are involved in, but not required for, PTH1R internalization. The results demonstrate that receptor activation and internalization can be selectively dissociated.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
G PROTEIN-COUPLED RECEPTORS (GPCRs) are the largest family of integral membrane receptors. They mediate the action of numerous hormones, cytokines, and sensory and chemical signals. The magnitude of hormone-induced physiological responses is normally tightly linked to the balance between GPCR signal generation and signal termination. GPCR activation is accompanied by biochemical events that uncouple the receptor from its cognate G protein, thereby producing a nonsignaling, desensitized receptor. Receptor desensitization and internalization require occupancy and activation, and receptor activation is generally accompanied or followed by internalization (1).

GPCRs are classified in three major groups based on sequence homologies (2). PTH and PTHrP receptor (PTH1R) is a member of class B (also called class II), which consists of peptide hormone and neuropeptide GPCRs (2). PTH1Rs are important regulators of extracellular calcium and phosphate homeostasis and are prominently expressed in bone and kidney. In recent work, we found that PTH1R activation and internalization could be dissociated in a ligand- and cell-specific fashion that was determined by the pattern of expression of the cytosolic adapter protein Na/H exchange regulatory factor 1 (ezrin-binding protein of 50 kDa) (3). Specifically, PTH(7–34) internalized the PTH1R in renal distal convoluted tubule (DCT) and rat osteosarcoma (ROS 17.2) cells, which do not express Na/H exchange regulatory factor 1, but not in renal proximal convoluted tubule or human SAOS2 osteosarcoma cells that express NHERF1. One goal of the present investigation was to determine whether PTH peptides of intermediary length exerted comparable effects.

The quantitative relations between the magnitude of PTH1R activation and internalization are not known. If activation and internalization are linked in a linear fashion, this model predicts that with greater activation, receptor internalization would be augmented. A second goal of the present study was to test this postulate by using different structural analogs of PTH.

The biologically active form of PTH possesses distinct activation regions that are segregated into amino- and carboxy-terminal domains of the peptide. N-terminal amino acids are required for stimulation of adenylyl cyclase (AC), whereas the carboxy-terminal portion of the peptide is thought to be required for high-affinity binding to the receptor (4, 5, 6). PTH peptides truncated at the N or C terminus were used to test the hypothesis that PTH1R activation and internalization occurs in a coupled manner. We found that progressively N-truncated PTH peptides internalized the PTH1R without concomitant receptor activation. Conversely, a C-truncated PTH peptide efficiently activated the PTH1R but did not induce internalization.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
The preparation, subcloning, characterization, and culture conditions of mouse DCT or proximal convoluted tubule kidney cells have been described (7). Cells were grown in a 50:50 mix of DMEM/F12 (10–092-CV; Mediatech, Inc., Herndon, VA), which was supplemented with 5% heat-inactivated FCS (Invitrogen, Carlsbad, CA) and 1% PSN (5 mg penicillin, 5 mg streptomycin, and 10 mg neomycin/ml; Invitrogen Life Technologies) in a humidified atmosphere of 95% air-5% CO2 at 37 C.

The immortalized mouse DCT cells were stably transfected with human (hPTH1R)/enhanced green fluorescent protein (EGFP) by plating cells on a 10-cm dish in growth medium (DMEM/F12, 5% FCS, and 1% PSN). When the cells were 80% confluent, they were transfected with 10 µg hPTH1R/EGFP (Dr. C. Silve, Institut National de la Santé et de la Recherche Médicale, Paris, France) expression plasmid using the Superfect reagent (Qiagen, Valencia, CA). The cells were cultured for 48 h post transfection in growth medium, when they were trypsinized and split onto three 15-cm dishes containing selection medium (growth medium supplemented with 500 µg/ml G418, Geneticin; Invitrogen). These D1 cells were fed with selection medium every 3 d for 14 d, at which time individual clones were visible. Multiple colonies were isolated and cultured in selection medium until confluent as described (8). A representative colony was chosen for fluorescence measurements. D1 cells express 105 receptors/cell as determined by Scatchard analysis of radioreceptor binding assays using [125I]hPTH(1–34) as the radioligand (9). D1 cells were enriched by flow cytometry (MoFlo; Cytomation, Ft Collins, CO) for cells expressing a high level of PTH1R/EGFP. Enriched D1 cells express 106 receptors/cell.

A truncated chimeric 480-stop PTH1R was prepared in the following manner. The hPTH1R cDNA coding for amino acids 1–480 was PCR amplified using the upper primer CGCTACCGGACTCAGATCTCG and the lower primer GAAGAATTCTGCCAGTGTCCAGC. PCR was performed on the hPTH1R/EGFP construct using Pfu turbo polymerase (Stratagene, La Jolla, CA) using the following conditions: 95 C for 2 min for one cycle; 95 C for 30 sec, 60 C for 30 sec, and 68 C for 4.5 min for 40 cycles; and 68 C for 10 min for one cycle. The lower primer inserted an EcoRI site at the 3' end of the 1.4-kb PCR product. The 1.4-kb PCR product was gel purified using Qiaex II beads (Qiagen). The truncated hPTH1R (1–480) PCR product was sequenced (ABI Prism 3700 DNA Analyzer; Applied Biosystems, Foster City, CA). The PCR product was digested with HindIII and EcoRI. The full-length hPTH1R cDNA sequence was excised from the hPTH1R/EGFP plasmid using HindIII and EcoRI and replaced by ligating the digested 1.4-kb PCR product consisting of the 480 carboxy-terminal truncated hPTH1R cDNA. The ligation mixture was transformed into competent bacteria and plated on LB agar plates containing 30 µg/ml kanamycin. Kanamycin-resistant colonies were grown, and plasmid DNA was isolated (Qiagen). The presence of the cDNA insert was confirmed using a HindIII/EcoRI double digest. Receptor internalization studies were performed on cells 24 h after they were transiently transfected with the 480-stop PTH1R/EGFP. Receptor phosphorylation studies were performed in DCT cells stably transfected with the 480-stop PTH1R/EGFP. Expression of the 480-stop PTH1R/EGFP in the stably transfected cells was confirmed using confocal microscopy.

Peptides
The synthesis, purification, and characterization of synthetic human peptides [hPTH(1–34)NH2, (2–34)NH2, and (3–34)NH2] was performed by solid phase synthesis using the Fmoc protocol and high-performance liquid chromatography purification as described previously (10). [D-Trp12, Tyr34]bPTH(7–34)NH2 was purchased from Bachem (Torrance, CA).

Quantitative, real-time fluorescence measurement of PTH1R internalization
PTH1R internalization was studied as described in cells stably transfected with the hPTH1R/EGFP (3). Cells were plated on poly-D-lysine-coated 25-mm glass coverslips and analyzed at room temperature by confocal microscopy equipped with a 488-nm Ar/Kr laser (Molecular Dynamics, Sunnyvale, CA). Emitted fluorescence was detected with a 515- to 540-nm bandpass filter. Sequential images were acquired at 1-min intervals. After obtaining three control images, the indicated ligand was introduced, and images were obtained for an additional 30–60 min to assure that internalization was complete with any given maneuver. Internalization of PTH1R/EGFP was reflected by a loss of plasma membrane fluorescence, quantified as changes in pixel intensity. PTH1R/EGFP internalization was analyzed by selecting the entire plasma membrane through a plane normal to and approximately 2–3 µm above the basal membrane surface (ImageScan; Molecular Dynamics). Fluorescence intensity was digitized at 16-bit resolution and converted to 256 grayscale levels for each image. The product of the number of pixels within the defined membrane area and the average pixel intensity was calculated for each time point. Receptor internalization is reported as the change from control.

Radioligand binding and internalization
Radioligand binding or internalization of high-performance liquid chromatography-purified [125I][Nle8,18, Tyr34]-PTH(1–34)NH2 were performed as described (3). Curves were fit using a four-point logistic algorithm (Prism; GraphPad Software, San Diego, CA).

AC activity
Cells were subcultured in 24-well plates seeded at 4 x 104 cells/well in DMEM/F12 containing 5% FCS and 1% PSN and grown to confluence. Cells were washed twice with Ca2+/Mg2+-free Hanks’ balanced salt solution and incubated with 0.5 µCi of [3H]adenine (PerkinElmer Life Sciences, Boston, MA) in fresh medium at 37 C for 2 h. The cells were treated with 1 mM 3-isobutylmethylxanthine (IBMX; Sigma Chemical Co., St. Louis, MO) in fresh medium for 15 min and incubated in the presence of the indicated PTH peptides for 5 min. The reaction was terminated by the addition of 1.2 M trichloroacetic acid, followed by neutralization with 4 N KOH. cAMP was isolated by two-column chromatography (11). Radioactivity was counted in a scintillation counter.

Phospholipase C (PLC)
DCT cells stably expressing the hPTH1R/EGFP were grown to confluence on a 12-well dish and loaded with myo-[2-3H]inositol (2 µCi/ml; ICN, Irvine, CA) by overnight incubation in serum-free, inositol-free DMEM/F12. The following day, the cells were rinsed and preincubated for 15 min in fresh serum-free, inositol-free DMEM/F12 containing 20 mM LiCl. The cells were then incubated at 37 C for 15 min or 60 min with the indicated PTH analog, after which, the medium was removed and replaced by 0.5 ml of ice-cold 20 mM formic acid. After 1 h on ice, the lysate was neutralized with 10 µl of 1 M NaOH. The lysate was then applied to Dowex 1X8 (Dow Chemical, Midland, MI) ion exchange columns 4 x 0.5 cm. The columns were washed with 3 x 5 ml of buffer A (60 mM sodium formate/5 mM sodium tetraborate). Total inositol phosphates were eluted with 1 x 5 ml of buffer B (2 M ammonium formate/100 mM formic acid), and 2 ml of each fraction was counted by ß scintillation spectrometry.

In vivo receptor phosphorylation
DCT cells stably expressing either the full-length or 480-stop PTH1R were grown to 90% confluence in six-well plates, rinsed with PBS, and then incubated overnight in serum- and antibiotic-free DMEM/F12. Cells were rinsed with PBS and incubated in phosphate-free DMEM for 45 min. To label intracellular pools of ATP, 100 µCi/well of [32P]-orthophosphate was added for an additional 2 h. At the end of the labeling period, the cells were rinsed once with media and stimulated with 1 µM of PTH(1–34), PTH(7–34), or PTH(1–31) for 40 min. To terminate ligand-induced phosphorylation, the cells were placed on ice, rinsed with ice-cold PBS, and lysed in 500 µl ice-cold Nonidet P-40 (NP-40) buffer (50 mM Tris, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40; Sigma), with the addition of a protease inhibitor cocktail consisting of 0.5 mM AEBSF (4-[2-aminoethyl]-benzenesulfonylfluoride), 150 nM aprotinin, 1 µM E-64, 0.5 mM EDTA, and 1 µM leupeptin (Calbiochem, San Diego, CA) and phosphatase inhibitors (1 mM Na-orthovanadate, 10 mM NaF, and 10 mM ß-glycerophosphate; Sigma), and incubated for 30 min on ice. A monoclonal anti-GFP antibody (A-11120; Molecular Probes, Eugene OR) was used for immunoprecipitation. The cell lysate supernatant was incubated with 2 µg of antibody for 1 h at 4 C with gentle agitation. Twenty-five microliters of Protein A-agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA) were added to the lysates and incubated with gentle agitation overnight at 4 C. The beads were washed four times in ice-cold NP-40 buffer and once in ice-cold PBS. The receptor complex was eluted from the beads by the addition of 40 µl sodium dodecyl sulfate-electrophoresis buffer and by boiling for 2–3 min. Agarose beads were pelleted by centrifugation, and 30 µl of sample was resolved on 7.5% SDS-PAGE. The incorporated [32P] was visualized in the stained and dried gels by phosphor imaging (Molecular Imager FX Pro; Bio-Rad Laboratories, Hercules, CA) after overnight exposure on a Kodak Ektascan storage phosphor screen (Kodak, Rochester, NY). The data were derived by scanning and digitizing an image; band densities were analyzed with NIH Image 1.61 (National Institutes of Health, Bethesda, MD; http://rsb.info.nih.gov/ij/index.html). Results are reported as fold basal to denote the ratio of receptor phosphorylation under basal conditions to that after PTH stimulation.

Immunoblotting
Cellular proteins were resolved by SDS-PAGE (12.5% acrylamide) and transferred to BA83 nitrocellulose membranes (0.2 µm; Schleicher & Schuell, Keene, NH). Blots were incubated for 2 h in Tris-buffered saline with Tween 20 (TBST; 10 mM Tris-HCl, pH 8.0; 150 mM NaCl, 0.2% Tween 20) containing 2% powdered skim milk and 1% BSA. After three washes with TBST, membranes were incubated for 2 h with a caveolin-1-specific primary antibody (mAb 2297; BD Transduction Laboratories, Inc., Lexington, KY; ~1,000-fold diluted in TBST) and for 1 h with horseradish peroxidase-conjugated goat antimouse IgG (~5,000-fold diluted). Bound antibodies were detected using an enhanced chemiluminescence (ECL) detection kit (Amersham Pharmacia Biotech, Piscataway, NJ).

Statistics
Data are presented as means ± SE, and n indicates the number of independent experiments. Effects of experimental treatments were assessed by paired comparisons within experiments and reported as the mean ± SEM of the number of independent experiments. Paired results were compared by ANOVA, with posttest repeated measures analyzed by the Bonferroni procedure. Single comparisons to control were analyzed by Dunnett’s test (Instat 3; GraphPad). Differences greater than P <= 0.05 were assumed to be significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PTH1R and PTH endocytosis
Live-cell, quantitative, confocal fluorescence microscopy was used to analyze the time course of PTH(1–34)-induced PTH1R internalization. Upon addition of PTH(1–34), PTH1R internalization began after a latency of 6–7 min and reached 50% at 15 min (Fig. 1Go). N-terminally truncated PTH fragments were used to identify the structural determinants required for PTH1R internalization in DCT cells. PTH(2–34) and PTH(3–34) elicited receptor internalization that was more rapid in onset and greater in magnitude than that provoked by PTH(1–34). PTH(7–34), a competitive antagonist of PTH(1–34) (6) that is not thought to possess intrinsic activity, rapidly and robustly internalized the PTH1R. PTH1R endocytosis evoked by PTH(7–34) was more extensive (Fig. 2AGo) and rapid (Fig. 2BGo) than that elicited by PTH(1–34). PTH(1–31), which stimulates calcium transport by DCT cells (7), failed to promote receptor internalization.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1. Effect of N-terminally truncated PTH fragments on PTH1R endocytosis in DCT cells. PTH1R internalization was measured by real-time quantitative confocal microscopy in D1 cells. Cells were exposed to 10–7 M of the indicated ligand. Data are presented as the mean ± SEM of three to five experiments.

 


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. Comparison of PTH(1–34)- and PTH(7–34)-induced PTH receptor endocytosis. A, Magnitude of receptor endocytosis at 15 min is shown for the full-length and a truncated 480-stop PTH1R. D1 cells and DCT cells transiently transfected with the 480-stop PTH1R/EGFP were used, respectively. B, Time course of endocytosis of full-length PTH1R in response to PTH(1–34) and PTH(7–34). C, Half-time (t1/2) for PTH(1–34)- or PTH(7–34)-induced endocytosis of the full-length or truncated 480-stop PTH1R. Half-times were computed from above results using the Boltzmann relation (Prism; GraphPad Software, Inc). **, P < 0.01 vs. PTH(1–34).

 
The effects PTH fragments on AC and PLC were examined. As shown in Fig. 3AGo, PTH(1–34) stimulated AC > PTH(2–34) >> PTH(3–34). PTH(1–31) caused a 7-fold stimulation of AC. PTH(1–34) and PTH(1–31) also activated PLC (Fig. 3BGo), whereas PTH(7–34) was without effect. To rule out the possibility that amino-truncated PTH peptide might stimulate PLC more slowly, the experiments were repeated with a 60-min exposure to PTH(2–34), PTH(3–34), and PTH(7–34), using PTH(1–34) and PTH(1–31) as controls. Comparable results were obtained. Again, only PTH(1–34) and PTH(1–31) stimulated PLC activity (data not shown). Thus, PTH(7–34), which efficiently internalized the PTH1R, had no effect on AC or PLC, and conversely, PTH(1–31), which activated both AC and PLC, did not induce receptor internalization.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3. Stimulation of AC and PLC by PTH peptide fragments. A, D1 cells were exposed to 10–7 M of the indicated peptide for 15 min at 37 C, and cAMP accumulation was measured. Data are the mean ± SEM normalized to unstimulated controls (n = 3). B, Total inositol phosphate accumulation in D1 cells in response to 10–6 M of the indicated peptide for 15 min at 37 C (n = 7). **, P < 0.01 vs. control.

 
The concentration dependence of PTH-induced PTH1R internalization was characterized (Fig. 4Go). Half-maximal internalization (EC50) of the PTH1R occurred at approximately 1 nM with PTH(1–34) and 10 nM with PTH(7–34), reflecting the reduced affinity of PTH(7–34) for the receptor. Ligand internalization paralleled that of the receptor. During the first 5 min, less than 5% of [125I]PTH(1–34) was sequestered, and 50% was endocytosed by 15 min.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. Concentration dependence of PTH1R internalization. D1 cells were exposed for 15 min to the indicated concentration of PTH(1–34) or PTH(7–34). PTH1R internalization was quantified as outlined in Materials and Methods and normalized to the maximal internalization for each peptide. Results are the mean of three experiments at each concentration for both peptides. Error bars have been omitted for clarity. The data were fit to a sigmoidal nonlinear equation, where PTH1R internalization = Bottom + (Top–Bottom)/(1 + 10^((LogEC50–Log [PTH]))) and plotted using Prism (GraphPad Software, Inc).

 
Role of PTH1R intracellular determinants on endocytosis
The PTH1R, like other GPCRs, contains multiple consensus phosphorylation sites in its intracellular tail, along with other determinants that are important for interaction with ß-arrestins and for internalization. Therefore, we examined the ability of PTH peptides to phosphorylate the PTH1R. PTH(1–34), PTH(1–31), and, to a significant though lesser extent, PTH(7–34) stimulated phosphorylation of the full-length PTH1R (Fig. 5Go, Table 1Go). In contrast, none of these ligands detectably phosphorylated the 480-stop PTH1R (Fig. 5Go, Table 1Go). Notably, although the 480-stop PTH1R was not detectably phosphorylated, it was internalized in response to PTH(1–34) and PTH(7–34) (Fig. 2AGo). The kinetics of internalization of the 480-stop PTH1R were now indistinguishable for the two peptides (Fig. 2BGo). These results show that the PTH1R intracellular tail is not required for internalization but clearly affects the kinetics of receptor endocytosis. These observations are consistent with the view that second messenger-induced PTH1R phosphorylation is not required for receptor internalization.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 5. PTH-stimulated PTH1R phosphorylation. The ability of PTH peptides to phosphorylate the full-length PTH1R (pPTH1R) or 480-stop PTH1R (pPTH1R-480 stop) was examined in D1 cells stably transfected with the indicated receptor construct. Immunoblots of full-length PTH1R and PTH1R-480 stop are shown below the respective phosphorylation. Basal PTH1R phosphorylation was minimal under resting conditions. PTH(1–34), PTH(7–34), or PTH(1–31) (10–6 M, 40 min) induced PTH1R phosphorylation. Similar results were obtained in four to six experiments (Table 1Go). Under the same conditions, PTH peptides failed to promote detectable phosphorylation of the truncated 480-stop PTH1R.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Phosphorylation of the full-length and truncated PTH1Rs by selected PTH ligands

 
Role of second messenger-dependent kinases in PTH-induced PTH1R internalization
Stimulation of calcium absorption by the PTH1R requires activation of both protein kinase A (PKA) and protein kinase C (PKC) (12). Inhibition of either pathway suppresses transport, and reconstitution of transport requires participation of both pathways. The signaling mechanisms that mediate termination of PTH1R action are uncertain. Both GPCR kinases (GRKs) (13) and the second messenger-dependent kinases PKA and PKC (14) are capable of phosphorylating the PTH1R. Phosphorylation-independent interference of PTH1R signaling by GRK2 has been described (15). Therefore, we inquired whether termination of PTH1R action involves either PKA or PKC. As shown in Fig. 6Go, inhibition of PKC by calphostin C suppressed PTH(1–34)-induced PTH1R internalization by 67% (P < 0.01) and that of PTH(7–34) by 90% (P < 0.01). Independent confirmation that PKC inhibition diminished PTH(1–34)-induced PTH1R endocytosis was obtained with bisindolylmaleimide 1, a specific PKC inhibitor chemically unrelated to calphostin C (16), and by down-regulating PKC by overnight treatment with phorbol 12-myristate 13-acetate (Table 2Go). Thus, PTH1R internalization in DCT cells occurs downstream of PKC activation, as previously demonstrated in HEK-293 cells heterologously expressing the PTH1R (17). In contrast, inhibition of PKA with Rp-adenosine-3',5'-cyclic monophosphorothioate (Rp-cAMPs) had a negligible effect on the magnitude of PTH1R internalization induced by PTH(1–34) (Fig. 6Go) and no detectable action on PTH(7–34)-induced receptor endocytosis (Fig. 6Go). Previous studies demonstrated that inhibition with the membrane-permeable PKA blocker, Rp-cAMPs, eliminated PTH-stimulated calcium entry (12). The lack of an effect of PKA blockade on PTH1R internalization is consistent with the result that AC stimulation is not sufficient to induce endocytosis.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 6. PKC dependence of PTH1R internalization. D1 cells were preincubated for 2 min with 100 n[scap]m of the PKC inhibitor calphostin-C or with 300 µM Rp-cAMPs, a specific PKA blocker. Cells were then treated with 10–7 M PTH(1–34), and receptor internalization was measured. Data are presented as percentage of PTH1R internalization after 15 min. The results are the average of three to four independent experiments. Rp-cAMPs was not used with PTH(7–34) because the latter does not stimulate AC (Fig. 3Go). **, P < 0.01 vs. respective controls.

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Effect of PKC blockade on PTH(1–34)-evoked PTH1R internalization

 
The role of AC in regulating PTH1R internalization was further analyzed by determining the effect of directly activating AC on PTH(7–34)-induced internalization of the full-length PTH1R and the phosphorylation-deficient 480-stop PTH1R. Forskolin itself had no effect on PTH1R endocytosis and did not modify PTH(1–34)-induced receptor internalization. However, concurrent addition of forskolin with PTH(7–34) significantly reduced the extent of internalization of the full-length PTH1R (Table 3Go). Thus, cAMP would seem to exert a bimodal action on PTH1R endocytosis depending on whether the receptor has been activated and presumably phosphorylated, directly or indirectly, by PKA. This idea was further examined by repeating the above experiment using a PTH1R truncated at amino acid 480 that lacks most of the C-terminal tail. Regions within the C terminus of the PTH1R are phosphorylated by GRKs and the second messenger-dependent kinases PKA and PKC (13, 18). We hypothesized that if phosphorylation by PKA was responsible for the inhibition of PTH1R endocytosis evoked by PTH(7–34) in the presence of forskolin, this effect would be absent with the 480-stop PTH1R. Forskolin did not affect the magnitude or rate of 480-stop PTH1R internalization induced by PTH(7–34) (Table 3Go). This finding is compatible with the idea that, in DCT cells, AC activation retards endocytosis of the full-length PTH1R. These results are also consistent with the observation that internalization of the 480-stop PTH1R/EGFP induced by PTH(1–34) and PTH(7–34) was indistinguishable (Fig. 2AGo), whereas the rate and magnitude of full-length PTH1R endocytosis clearly differed when triggered by PTH(1–34) or PTH(7–34) (Figs. 1Go and 2Go). Moreover, whereas full-length PTH1R internalization induced by PTH(7–34) was inhibited by PKC blockade (Fig. 6Go, Table 3Go), endocytosis of the 480-stop PTH1R/EGFP was insensitive to PKC blockade [53 ± 5, PTH(7–34) vs. 57 ± 7% internalized, PTH(7–34) + 100 nM calphostin C].


View this table:
[in this window]
[in a new window]
 
TABLE 3. Effect of forskolin on PTH(7–34)-induced endocytosis of the full-length and of a truncated PTH1R

 
Other signaling mechanisms mediating PTH1R endocytosis
GPCR internalization serves not only to turn off signaling but also to target the receptor to vesicles, where it interacts with scaffolding proteins that assemble cell-specific signaling complexes that lead to activation of MAPK (19). PTH-stimulated calcium transport in DCT cells depends on ERK1/2 activation (20). However, blockade of MAPK with PD98059, tyrosine kinase inhibition with genistein, phosphatidylinositol-3 kinase inhibition using wortmannin, or overnight pretreatment with pertussis toxin had no effect on PTH(1–34)-stimulated PTH1R internalization (data not shown). Because PTH stimulates calcium entry by DCT cells, we inquired whether calcium influx was necessary for PTH1R endocytosis. However, blockade of calcium entry with nifedipine had no effect on PTH1R internalization (data not shown). Cycloheximide, which selectively inhibits PTH- but not calcitonin-stimulated calcium entry in DCT cells (21), had no effect on PTH1R internalization (data not shown).

Clathrin and caveolae-mediated PTH1R endocytosis
Endocytosis of GPCRs typically occurs in a clathrin- and dynamin-dependent manner (22). Hypertonic sucrose, which disrupts clathrin polymerization, abolished PTH(1–34)-stimulated PTH1R internalization. These findings are consistent with previous reports that dominant negative K44A dynamin profoundly inhibited PTH1R internalization induced by either PTH(1–34) or (7–34) (3). Because dynamin is involved in endocytosis mediated by both clathrin and caveolae (23), we also examined the expression of caveolin-1 and the effects of two structurally unrelated inhibitors of caveolae-mediated endocytosis (24). As shown in Fig. 7Go, caveolin-1 is expressed by proximal convoluted tubule and DCT cells. However, the caveolae-disrupting agents 2-hydroxypropyl-ß-cyclodextrin and filipin III were without inhibitory effect on PTH(1–34) or PTH(7–34)-induced PTH1R internalization (data not shown). Colchicine, a microtubule inhibitor that interferes with PTH-stimulated calcium transport (25), was without effect on PTH1R endocytosis (3).



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 7. Caveolin-1 expression in proximal convoluted tubule (PCT) and DCT cells. Cells were subjected to immunoblot analysis with monospecific antibody probes that recognize only caveolin-1 (43 ).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A feature common to GPCRs is the cyclical process of activation, desensitization, and internalization. Depending on the particular receptor and cell background, desensitization and internalization are generally followed by resensitization and receptor recycling to the plasma membrane (1). These coordinated events protect against excessive receptor stimulation or periods of prolonged inactivity. In this manner, receptor activation and internalization are thought to go hand-in-hand, thereby regulating the balance of physiological activity of GPCRs. The present results illustrate that PTH1R signal activation and internalization, however, can be dissociated in a ligand-selective fashion.

PTH1Rs exhibit ligand-specific activation (7, 26). The present study was initiated to determine whether PTH1R inactivation also displays such behavior. The results support this hypothesis. Strikingly, PTH(7–34), which is widely accepted to be devoid of biological activity and to act as a competitive inhibitor of the PTH1R, robustly promoted receptor internalization without accompanying activation. PTH peptides with lengths between PTH(1–34) and (7–34) exhibited proportionately intermediate effects on receptor internalization and an inverse effect on activation. In contrast, PTH(1–31), which effectively stimulated both AC and PLC, failed to induce PTH1R internalization. The present findings establish that PTH1R activation alone is insufficient to induce receptor endocytosis. These results provide experimental support for earlier suggestions that PTH1R activation and sequestration require different conformations (27, 28). Presumably, occupancy of a GPCR by agonists or antagonists stabilizes distinct receptor conformations. Such discrete conformations have been hypothesized to mediate different cellular functions (29), and this may be the case for the PTH1R.

When the wild-type PTH1R was expressed in HEK-293 cells or COS-7 cells, PTH(7–34) had no discernable effect on receptor internalization (9). The constitutively active PTH1R mutant T410P PTH1R is spontaneously and persistently associated with ß-arrestin2 and traffics independently of ligand occupancy (9). In cells expressing the T410P PTH1R, PTH(7–34) acts as an inverse agonist (30), i.e. a ligand that decreases receptor signaling activity below that of unoccupied receptors. Inverse agonism is unlikely to account for the effects of PTH(7–34) in the present experiments, however, because PTH(7–34) did not inhibit basal AC or PLC activity (Fig. 3Go). Thus, the ability of PTH(7–34) to elicit PTH1R endocytosis in DCT cells is not due to constitutive receptor activity or trafficking.

Previous work has shown that PTH(1–34) (25, 31), but not PTH(7–34) (7), stimulates calcium entry in DCT cells and also activates MAPK (20). PTH1R activation has also been reported to stimulate phosphatidylinositol-3 kinase (32) and protein tyrosine kinase activation (33). However, as shown here, PTH1R internalization does not depend on calcium entry, MAPK, or phosphatidylinositol-3 kinase activation or protein tyrosine phosphorylation. The involvement of Gi/o was also ruled out because pertussis toxin did not affect PTH-induced PTH1R internalization. If these alternate signaling pathways and inverse agonism do not account for PTH1R internalization, what is the nature of the signal? Experiments investigating the role of PKA and PKC in PTH1R endocytosis provide some insight into the mechanism and regulation of PTH1R trafficking.

Inhibition of PKA with Rp-cAMPs did not block PTH1R endocytosis (Fig. 6Go), suggesting that receptor internalization is independent of PKA. However, AC activation modified the magnitude and the kinetics of the full-length PTH1R internalization (Table 3Go). This suggests that cAMP may exert an inhibitory influence on PTH1R internalization. Consistent with this argument, directly activating AC markedly reduced the magnitude but increased the t1/2 of internalization of the full-length PTH1R induced by PTH(7–34) (Table 3Go). The AC dependence and PKA independence of PTH effects on internalization suggest the possible involvement of the exchange protein activated directly by cAMP. Exchange protein activated directly by cAMP is a guanine nucleotide exchange factor that is directly activated by cAMP, independent of PKA stimulation (34). The present results are compatible with the idea that cAMP affects the magnitude and extent of PTH1R internalization through such a PKA-independent mechanism.

In contrast to the absence of an effect of PKA inhibition of PTH1R internalization, suppression of PKC by three distinct means significantly reduced PTH1R internalization evoked by PTH(1–34) or PTH(7–34) (Table 2Go, Fig. 6Go). Together, these findings suggest that at least two independent regulatory events are involved in modulating PTH1R endocytosis. The first regulatory element involves PKC, whereas the second is an AC-dependent, but apparently PKA-independent, mechanism.

The PTH1R contains multiple consensus phosphorylation sites within the intracellular tail (18, 35). In the case of the PTH1R, phosphorylation appears to be facultative for the interaction with ß-arrestin and receptor internalization (15, 18). Internalization of the secretin receptor, another class B GPCR, is likewise unaffected by GRK phosphorylation (36). When the large intracellular carboxy terminus of the PTH1R was ablated, PTH(1–34) and PTH(7–34) internalized the receptor with identical kinetics (Fig. 2AGo, Table 3Go) and reduced the magnitude of PTH(7–34)-stimulated PTH1R internalization by about 50%. It appears, therefore, that the PTH1R C terminus contains regulatory domains that are involved in, but not required for, PTH1R internalization in DCT cells. Recent work on the role of the PTH1R C terminus in receptor signaling likewise disclosed that blockade of PKC inhibited internalization of the full-length PTH1R but had no effect on a similar 490-stop PTH1R (37).

The 480-stop PTH1R internalized in response to both PTH(1–34) and (7–34). Importantly, internalization of this phosphorylation-deficient truncated PTH receptor was no longer sensitive to AC or PKC inhibition. These findings are compatible with the conclusion that phosphorylation of the C terminus by PKA or PKC exerts a regulatory effect on PTH1R internalization. It is further concluded that because the truncated receptor was internalized by PTH(1–34) and PTH(7–34), albeit with different kinetics than those of the full-length receptor, an obligate role for direct phosphorylation of the PTH1R by PKA or PKC for PTH1R internalization is excluded. Consistent with these interpretations, the truncated PTH1R was not detectably phosphorylated in response to PTH(1–34), (1–34) (Fig. 5Go, Table 1Go). Similar conclusions have been reached by others (18, 35). Although the present findings exclude an effect of PKA activation on PTH1R internalization, PKA may nonetheless modulate other steps of PTH action or PTH1R trafficking by phosphorylating scaffolding or adapter proteins that play a role in recruiting the receptor to clathrin-coated vesicles.

The full-length PTH1R was phosphorylated in response to PTH(1–34), PTH(1–31), and, to a lesser extent, by PTH(7–34) (Fig. 5Go, Table 1Go). However, PTH(1–31) failed to internalize the PTH1R (Fig. 1Go). Phosphorylation alone, therefore, is insufficient to induce PTH1R internalization. The C terminus of the receptor contains the phosphorylation sites because ablation of these sequences eliminated the ability of all three ligands to phosphorylate the PTH1R (Fig. 5Go, Table 1Go) (18, 35). Phosphorylation may, therefore, play a modulatory role but is evidently not required for PTH1R internalization. The fact that PTH(7–34), which doesn’t stimulate either AC or PLC, promoted PTH1R phosphorylation is consistent with the idea that in situ phosphorylation is mediated by GRK2. When activation of the PTH1R was blocked by introducing a zinc ion bridge between helices 3 and 6 of PTH1R, GRK2-mediated phosphorylation and PTH1R internalization proceeded normally (27). These results suggest that the PTH1R conformation necessary for G protein activation differs from the one required for GRK-mediated receptor phosphorylation. The present work supports and extends the observations of others (9, 14, 18) demonstrating that phosphorylation of the C terminus of the PTH1R either by GRKs or second messenger-dependent kinases is not required for internalization. It has been proposed that phosphorylation of the C terminus of a GPCR, however, stabilizes the association between ß-arrestin and the PTH1R (38). Phosphorylation of the intracellular tail may produce a local concentration of negative charges that promotes binding to the positively charged phosphorylation recognition domain of arrestin, thereby stabilizing the formation of the receptor-arrestin complex (39). Alternatively, the phosphorylated C terminus of the GPCR may induce a conformational change in arrestin that permits a high-affinity interaction between the two proteins (39). Phosphorylation of the C terminus and the interaction with arrestin may also play a role in PTH1R desensitization, a process that is generally associated with receptor internalization. Thus, G protein activation and receptor internalization are controlled by distinct agonist-induced conformations of the PTH1R.

The C terminus of the angiotensin II type I receptor, which like the PTH1R is not required for receptor endocytosis, nonetheless influences receptor retention in endosomal compartments and delays its recycling to the cell surface (40). A conserved NPXXY sequence at the interface between the seventh transmembrane domain and the C terminus of many GPCRs serves as an endocytic signal (41). The C terminus of the PTH1R possesses serine and threonine residues downstream of an NPXXY motif. These sequences are associated with GPCRs that are slow to recycle to the plasma membrane (1). It is unclear, however, how these sequences regulate the kinetics of GPCR internalization in response to different structural analogs of the hormone. In view of the dissimilar kinetics of full-length and truncated PTH1R internalization, the results suggest that the C-terminal segment may provide additional sites of stabilization of the PTH1R/ß-arrestin complex during intracellular trafficking (9). The present findings are compatible with the view that the PTH1R may adopt different ligand-selective conformations. The ability of these ligands to induce PTH1R endocytosis is likely to involve distinct intracellular conformations. It has been suggested that the distinct biological effects of different ligands partially depend upon their abilities to induce endocytosis (42).

The present findings provide compelling evidence that GPCR activation and receptor endocytosis can be dissociated. Such dissociation makes it likely that GPCR signaling and receptor internalization depend on different intracellular conformations of the PTH1R. Thus, the dissociation between receptor activation and internalization as shown here may represent a more common biological phenomenon that contributes to ligand and cell-specific hormone and drug action for multiple classes of GPCRs.


    Acknowledgments
 
Drs. Caroline Silve, Jeffrey Benovic, Thomas Gardella, and Orson Moe generously provided reagents as noted. We thank Drs. Pierre d’Amour, Richard Bringhurst, Stephen Ferguson, Harald Jüppner, and Henry Kronenberg for thoughtful comments and suggestions and Dr. Simon Watkins and the Center for Biological Imaging for technical advice and support.


    Footnotes
 
This work was supported by National Institutes of Health Grants DK-54171 (to P.A.F.) and DK-62078 (to A.B.), National Institutes of Health Training Grant DK07052 (to C.E.M.), and the American Heart Association (AHA) Grant 0130049N (to F.G.).

Abbreviations: AC, Adenylyl cyclase; DCT, distal convoluted tubule; EGFP, enhanced green fluorescent protein; GPCR, G protein-coupled receptor; GRK, G protein-coupled receptor kinase; NP-40, Nonidet P-40; PKA, protein kinase A; PKC, protein kinase C; PLC, phospholipase C; PTH1R, PTH and PTH-related peptide receptor; Rp-cAMPs, Rp-adenosine-3',5'-cyclic monophosphorothioate; TBST, Tris-buffered saline with Tween 20.

Received September 9, 2003.

Accepted for publication March 4, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ferguson SSG 2001 Evolving concepts in G protein-coupled receptor endocytosis: the role in receptor desensitization and signaling. Pharmacol Rev 53:1–24[Abstract/Free Full Text]
  2. Gether U 2000 Uncovering molecular mechanisms involved in activation of G protein-coupled receptors. Endocr Rev 21:90–113[Abstract/Free Full Text]
  3. Sneddon WB, Syme CA, Bisello A, Magyar CE, Rochdi MD, Parent JL, Weinman EJ, Abou-Samra AB, Friedman PA 2003 Activation-independent parathyroid hormone receptor internalization is regulated by NHERF1 (EBP50). J Biol Chem 278:43787–43796[Abstract/Free Full Text]
  4. Gardella TJ, Juppner H 2001 Molecular properties of the PTH/PTHrP receptor. Trends Endocrinol Metab 12:210–217[CrossRef][Medline]
  5. Horiuchi N, Holick MF, Potts Jr JT, Rosenblatt M 1983 A parathyroid hormone inhibitor in vivo: design and biological evaluation of a hormone analog. Science 220:1053–1055[Abstract/Free Full Text]
  6. Goldring SR, Roelke MS, Bringhurst FR, Rosenblatt M 1985 Differential effects of parathyroid hormone responsive cultured human cells on biological activity of parathyroid hormone and parathyroid hormone inhibitory analogues. Biochemistry 24:513–518[CrossRef][Medline]
  7. Friedman PA, Gesek FA, Morley P, Whitfield JF, Willick GE 1999 Cell-specific signaling and structure-activity relations of parathyroid hormone analogs in mouse kidney cells. Endocrinology 140:301–309[Abstract/Free Full Text]
  8. Karin NJ 1999 Cloning of transfected cells without cloning rings. Biotechniques 27:681–682[Medline]
  9. Ferrari SL, Bisello A 2001 Cellular distribution of constitutively active mutant parathyroid hormone (PTH)/PTH-related protein receptors and regulation of cyclic adenosine 3',5'-monophosphate signaling by ß-arrestin2. Mol Endocrinol 15:149–163[Abstract/Free Full Text]
  10. Barbier JR, Neugebauer W, Morley P, Ross V, Soska M, Whitfield JF, Willick G 1997 Bioactivities and secondary structures of constrained analogues of human parathyroid hormone: cyclic lactams of the receptor binding region. J Med Chem 40:1373–1380[CrossRef][Medline]
  11. Salomon Y, Londos C, Rodbell M 1974 A highly sensitive adenylate cyclase assay. Anal Biochem 58:541–548[CrossRef][Medline]
  12. Friedman PA, Coutermarsh BA, Kennedy SM, Gesek FA 1996 Parathyroid hormone stimulation of calcium transport is mediated by dual signaling mechanisms involving protein kinase A and protein kinase C. Endocrinology 137:13–20[Abstract]
  13. Blind E, Bambino T, Huang ZM, Bliziotes M, Nissenson RA 1996 Phosphorylation of the cytoplasmic tail of the PTH/PTHrP receptor. J Bone Miner Res 11:578–586[Medline]
  14. Blind E, Bambino T, Nissenson RA 1995 Agonist-stimulated phosphorylation of the G protein coupled receptor for parathyroid hormone (PTH) and PTH-related protein. Endocrinology 136:4271–4277[Abstract]
  15. Dicker F, Quitterer U, Winstel R, Honold K, Lohse MJ 1999 Phosphorylation-independent inhibition of parathyroid hormone receptor signaling by G protein-coupled receptor kinases. Proc Natl Acad Sci USA 96:5476–5481[Abstract/Free Full Text]
  16. Toullec D, Pianetti P, Coste H, Bellevergue P, Grand-Perret T, Ajakane M, Baudet V, Boissin P, Boursier E, Loriolle F, Duhamel K, Charon D, Kirilovsky J 1991 The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C. J Biol Chem 266:15771–15781[Abstract/Free Full Text]
  17. Ferrari SL, Behar V, Chorev M, Rosenblatt M, Bisello A 1999 Endocytosis of ligand-human parathyroid hormone receptor 1 complexes is protein kinase C-dependent and involves ß-arrestin2. Real-time monitoring by fluorescence microscopy. J Biol Chem 274:29968–29975[Abstract/Free Full Text]
  18. Malecz N, Bambino T, Bencsik M, Nissenson RA 1998 Identification of phosphorylation sites in the G protein-coupled receptor for parathyroid hormone. Receptor phosphorylation is not required for agonist-induced internalization. Mol Endocrinol 12:1846–1856[Abstract/Free Full Text]
  19. Daaka Y, Luttrell LM, Ahn S, Della Rocca GJ, Ferguson SS, Caron MG, Lefkowitz RJ 1998 Essential role for G protein-coupled receptor endocytosis in the activation of mitogen-activated protein kinase. J Biol Chem 273:685–688[Abstract/Free Full Text]
  20. Sneddon WB, Gesek FA, Friedman PA 2000 Obligate mitogen-activated protein kinase activation in parathyroid hormone stimulation of calcium transport but not calcium signaling. Endocrinology 141:4185–4193[Abstract/Free Full Text]
  21. Gesek FA, Friedman PA 1993 Calcitonin stimulates calcium transport in distal convoluted tubule cells. Am J Physiol 264:F744–F751
  22. Claing A, Laporte SA, Caron MG, Lefkowitz RJ 2002 Endocytosis of G protein-coupled receptors: roles of G protein-coupled receptor kinases and ß-arrestin proteins. Prog Neurobiol 66:61–79[CrossRef][Medline]
  23. Nabi IR, Le PU 2003 Caveolae/raft-dependent endocytosis. J Cell Biol 161:673–677[Abstract/Free Full Text]
  24. Orlandi PA, Fishman PH 1998 Filipin-dependent inhibition of cholera toxin: evidence for toxin internalization and activation through caveolae-like domains. J Cell Biol 141:905–915[Abstract/Free Full Text]
  25. Bacskai BJ, Friedman PA 1990 Activation of latent Ca2+ channels in renal epithelial cells by parathyroid hormone. Nature 347:388–391[CrossRef][Medline]
  26. Morley P, Whitfield JF, Willick GE 1999 Design and applications of parathyroid hormone analogues. Curr Med Chem 6:1095–1106[Medline]
  27. Vilardaga JP, Frank M, Krasel C, Dees C, Nissenson RA, Lohse MJ 2001 Differential conformational requirements for activation of G proteins and the regulatory proteins arrestin and G protein-coupled receptor kinase in the G protein-coupled receptor for parathyroid hormone (PTH)/PTH-related protein. J Biol Chem 276:33435–33443[Abstract/Free Full Text]
  28. Bisello A, Chorev M, Rosenblatt M, Monticelli L, Mierke DF, Ferrari SL 2002 Selective ligand-induced stabilization of active and desensitized parathyroid hormone type 1 receptor conformations. J Biol Chem 277:38524–38530[Abstract/Free Full Text]
  29. Kenakin T 1995 Agonist-receptor efficacy. II. Agonist trafficking of receptor signals. Trends Pharmacol Sci 16:232–238[CrossRef][Medline]
  30. Gardella TJ, Luck MD, Jensen GS, Schipani E, Potts Jr JT, Jüppner H 1996 Inverse agonism of amino-terminally truncated parathyroid hormone (PTH) and PTH-related peptide (PTHrP) analogs revealed with constitutively active mutant PTH/PTHrP receptors. Endocrinology 137:3936–3941[Abstract]
  31. Gesek FA, Friedman PA 1992 On the mechanism of parathyroid hormone stimulation of calcium uptake by mouse distal convoluted tubule cells. J Clin Invest 90:749–758
  32. Carpio L, Gladu J, Goltzman D, Rabbani SA 2001 Induction of osteoblast differentiation indexes by PTHrP in MG-63 cells involves multiple signaling pathways. Am J Physiol Endocrinol Metab 281:E489–E499
  33. Tyson DR, Swarthout JT, Jefcoat SC, Partridge NC 2002 PTH induction of transcriptional activity of the cAMP response element-binding protein requires the serine 129 site and glycogen synthase kinase-3 activity, but not casein kinase II sites. Endocrinology 143:674–682[Abstract/Free Full Text]
  34. de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, Wittinghofer A, Bos JL 1998 Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature 396:474–477[CrossRef][Medline]
  35. Tawfeek HA, Qian F, Abou-Samra AB 2002 Phosphorylation of the receptor for PTH and PTHrP is required for internalization and regulates receptor signaling. Mol Endocrinol 16:1–13[Abstract/Free Full Text]
  36. Walker JK, Premont RT, Barak LS, Caron MG, Shetzline MA 1999 Properties of secretin receptor internalization differ from those of the ß2-adrenergic receptor. J Biol Chem 274:31515–31523[Abstract/Free Full Text]
  37. Castro M, Dicker F, Vilardaga JP, Krasel C, Bernhardt M, Lohse MJ 2002 Dual regulation of the parathyroid hormone (PTH)/PTH-related peptide receptor signaling by protein kinase C and ß-arrestins. Endocrinology 143:3854–3865[Abstract/Free Full Text]
  38. Vilardaga JP, Krasel C, Chauvin S, Bambino T, Lohse MJ, Nissenson RA 2002 Internalization determinants of the parathyroid hormone receptor differentially regulate ß-arrestin/receptor association. J Biol Chem 277:8121–8129[Abstract/Free Full Text]
  39. Oakley RH, Laporte SA, Holt JA, Barak LS, Caron MG 2001 Molecular determinants underlying the formation of stable intracellular G protein-coupled receptor-ß-arrestin complexes after receptor endocytosis. J Biol Chem 276:19452–19460[Abstract/Free Full Text]
  40. Anborgh PH, Seachrist JL, Dale LB, Ferguson SS 2000 Receptor/ß-arrestin complex formation and the differential trafficking and resensitization of ß2-adrenergic and angiotensin II type 1A receptors. Mol Endocrinol 14:2040–2053[Abstract/Free Full Text]
  41. Kirchhausen T 1999 Adaptors for clathrin-mediated traffic. Annu Rev Cell Dev Biol 15:705–732[CrossRef][Medline]
  42. Roth BL, Willins DL 1999 What’s all the RAVE about receptor internalization? Neuron 23:629–631[CrossRef][Medline]
  43. Volonte D, Zhang K, Lisanti MP, Galbiati F 2002 Expression of caveolin-1 induces premature cellular senescence in primary cultures of murine fibroblasts. Mol Biol Cell 13:2502–2517[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
S. H H Hong, X. Lu, M. S Nanes, and J. Mitchell
Regulation of osterix (Osx, Sp7) and the Osx promoter by parathyroid hormone in osteoblasts
J. Mol. Endocrinol., November 1, 2009; 43(5): 197 - 207.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
T. de Groot, K. Lee, M. Langeslag, Q. Xi, K. Jalink, R. J.M. Bindels, and J. G.J. Hoenderop
Parathyroid Hormone Activates TRPV5 via PKA-Dependent Phosphorylation
J. Am. Soc. Nephrol., August 1, 2009; 20(8): 1693 - 1704.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Wheeler, J. L. Garrido, A. Bisello, Y. K. Kim, P. A. Friedman, and G. Romero
Regulation of Parathyroid Hormone Type 1 Receptor Dynamics, Traffic, and Signaling by the Na+/H+ Exchanger Regulatory Factor-1 in Rat Osteosarcoma ROS 17/2.8 Cells
Mol. Endocrinol., May 1, 2008; 22(5): 1163 - 1170.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Wang, A. Bisello, Y. Yang, G. G. Romero, and P. A. Friedman
NHERF1 Regulates Parathyroid Hormone Receptor Membrane Retention without Affecting Recycling
J. Biol. Chem., December 14, 2007; 282(50): 36214 - 36222.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Wheeler, W. B. Sneddon, B. Wang, P. A. Friedman, and G. Romero
NHERF-1 and the Cytoskeleton Regulate the Traffic and Membrane Dynamics of G Protein-coupled Receptors
J. Biol. Chem., August 24, 2007; 282(34): 25076 - 25087.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. B. Sneddon and P. A. Friedman
{beta}-Arrestin-Dependent Parathyroid Hormone-Stimulated Extracellular Signal-Regulated Kinase Activation and Parathyroid Hormone Type 1 Receptor Internalization
Endocrinology, August 1, 2007; 148(8): 4073 - 4079.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. B. Sneddon, Y. Yang, J. Ba, L. M. Harinstein, and P. A. Friedman
Extracellular signal-regulated kinase activation by parathyroid hormone in distal tubule cells
Am J Physiol Renal Physiol, March 1, 2007; 292(3): F1028 - F1034.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. A. Friedman and W. G. Goodman
PTH(1-84)/PTH(7-84): a balance of power
Am J Physiol Renal Physiol, May 1, 2006; 290(5): F975 - F984.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Perry, S. Junger, T. A. Kohout, S. R. J. Hoare, R. S. Struthers, D. E. Grigoriadis, and R. A. Maki
Distinct Conformations of the Corticotropin Releasing Factor Type 1 Receptor Adopted following Agonist and Antagonist Binding Are Differentially Regulated
J. Biol. Chem., March 25, 2005; 280(12): 11560 - 11568.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sneddon, W. B.
Right arrow Articles by Friedman, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sneddon, W. B.
Right arrow Articles by Friedman, P. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PARATHYROID HORMONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals