| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Third Department of Internal Medicine, Faculty of Medicine, University of Yamanashi, Yamanashi 409-3898, Japan
Address all correspondence and requests for reprints to: Tetsuro Kobayashi, M.D., Ph.D., Professor and Chairman, Third Department of Internal Medicine, Faculty of Medicine, University of Yamanashi, 1110 Tamaho, Yamanashi 409-3898, Japan. E-mail: tetsurou{at}yamanashi.ac.jp.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A unique property of thyroid follicular cells is the ability to trap and concentrate iodide, which depends on expression of the sodium/iodide symporter (NIS), thyroglobulin (Tg), and thyroperoxidase (TPO) (4). Several reports indicated that, because of ability for iodide trapping and concentration, radioiodide is an effective therapy in the treatment of differentiated thyroid carcinomas (5, 6, 7). NIS protein mediates iodide uptake in normal and well-differentiated neoplastic thyroid cells. TPO iodinates Tg, which leads to iodide retention within thyroid follicles. Concentration of these thyroid-specific functions suggests that restoring lost expression of NIS, TPO, and Tg could provide a basis for radioiodide treatment of thyroid carcinomas. Loss of thyroid-specific functions associated with dedifferentiation in poorly differentiated and anaplastic thyroid cancer cells ordinarily renders them unresponsive to radioiodide therapy. We reported that Na131I administration did not decrease volumes of experimental tumors formed by malignantly transformed rat thyroid cells Tc-rNIS that were stably transfected with rat NIS cDNA but possessed no TPO or Tg expression (8). Concomitant re-expression of NIS, TPO, and Tg therefore would seem necessary for the iodide uptake and retention that could permit effective radioiodide therapy.
Histone acetylation is known to induce changes in nucleosomal conformation that make DNA more accessible to transcription factors (9). Acetylation of histone lysine residues reduces the overall positive charge of the histone, and thus decreases its affinity for the negatively charged DNA molecule (10). Recent reports have shown that histone deacetylase (HDAC) inhibitors (HDACI) can induce expression of silenced genes in cancer cells (11). In bladder carcinoma cells, for example, the HDACI, suberoylanilide hydroxamine acid, induces an increase in p21WAF1 mRNA and protein. Thus, HDACI-induced restoration of tumor suppression- or apoptosis-inducing genes in poorly differentiated cancer, including thyroid cancer, might offer a novel therapeutic strategy.
To develop a way to sensitize anaplastic thyroid carcinoma to radioiodide therapy, we investigated re-expression of thyroid-specific genes, NIS, TPO, and Tg, induced by HDACI. We then examined radioiodide uptake and organification to confirm the function of the re-expressed thyroid-specific genes in vitro and in vivo models.
Expression of thyroid-specific genes is controlled by the interaction of a complement of thyroid-specific transcription factors with their respective promoters (12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22). At least three transcription factors have been identified: thyroid transcription factor (TTF)-1 (12), TTF-2 (20), and Pax-8 (23). TTF-1, a homeodomain-containing transcription factor expressed in thyroid and lung (12, 24), interacts with all thyroid-specific genes important for thyroid function (12, 13, 16, 17, 18, 19). Pax-8, a member of the family of paired box-containing genes, is expressed in the thyroid and kidney (16, 23) and binds to promoter and enhancer sequences in thyroid-specific genes (15, 21, 22, 25). We recently demonstrated that overexpression of TTF-1 could restore Tg promoter activity in Tg-nonproducing poorly differentiated thyroid cancer cell lines, which suggested that TTF-1 is important in the restoration of thyroid-specific gene expression in thyroid cancer cells (24). In an attempt to determine the mechanism by which HDACI induce restoration of thyroid-specific gene expression, we characterized the effect of HDACI on expression of thyroid-specific transcription factors.
| Materials and Methods |
|---|
|
|
|---|
Cell culture
BHP1821v cells, derived from human papillary thyroid cancer, were provided by Dr. J. M. Hershman (Endocrine Research Laboratory, West Los Angeles Veterans Affairs Medical Center, Los Angeles, CA). BHP1821v cells expressing Pax-8, but neither TTF-1 nor Tg genes, were isolated from BHP1821 (26). The BHPcell lines were maintained in RPMI 1640 medium supplemented with 10% fetal calf serum. A human anaplastic thyroid carcinoma cell line, ARO (27), that lacks Pax-8, Tg, and NIS and also shows decreased expression of TTF-1, was donated by Dr. H. Namba (Department of Molecular Medicine, Atomic Bomb Disease Institute, Nagasaki University School of Medicine, Nagasaki, Japan) and incubated with RPMI 1640 containing 10% fetal calf serum.
FRTL-Tc cells (28) were grown in Coons modified Hams F-12 medium supplemented with 5% calf serum containing a mixture of five hormones: insulin (10 µg/ml), cortisol (0.4 ng/ml), transferrin (5 µg/ml), glycyl-L-histidyl-L-lysine acetate (10 ng/ml), and somatostatin (10 ng/ml). Rat NIS cDNA (29 to 1975 bp, with A in ATG designated as +1) (29) was subcloned into the eukaryotic expression vector pcDNA3 (Invitrogen, San Diego, CA) and introduced into FRTL-Tc cells by electroporation. Stably transfected cells were selected using G418 and then cloned by limited dilution. The cloned cell line (Tc-rNIS) (8) that exhibited the highest iodide uptake activity was used for the subsequent experiments.
Determination of mRNA levels using real-time kinetic quantitative RT-PCR in vitro and in vivo
In an in vitro and in vivo study, total RNA was isolated from cultured cells using RNeasy Mini kit (QIAGEN, Hilden, Germany). After quantification by spectrophotometry, 5 µg total RNA was reverse-transcribed into cDNA with 160 µM deoxynucleotide triphosphate, 50 ng random hexamer primers, and 200 U Superscript II, per the manufacturers recommendations (Invitrogen Corp., Carlsbad, CA). Oligonucleotide primers and TaqMan probes for NIS (30), Tg (31), TPO, and TSH receptor (TSH-R) (32) genes are shown in Table 1
. These primers were designed to be intron spanning. The monitoring of negative control for each target showed an absence of carryover. One of each type of amplicon, corresponding to each target, was migrated on agarose gel electrophoresis and showed a unique band at the expected size. The primers and TaqMan probes of TPO gene were designed using the computer program Primer Express (PerkinElmer Corp., PE Applied Biosystems, Foster City, CA).
|
To validate the quantitative PCR method, standard curves for NIS, TPO, Tg, TSH-R, and GAPDH were constructed from cDNA fragments. The efficiency of each standard curve, as determined by its slope, allowed us to quantify the threshold cycle method according to the manufacturers instructions. The amount of targeted mRNA was determined by standard curve. For each sample, the targeted mRNA amount was divided by GAPDH to determine a normalized ratio. The crossing points were all less than 30 cycles that are in the linear range of amplification.
Detection of TTF-1 and Pax-8 gene expression using RT-PCR
To determine expression of human TTF-1 and Pax-8 in BHP1821v and ARO cells, 5 µg total RNA was reverse-transcribed as described above. The cDNAs were amplified using the following intron-flanking primers: human TTF-1 5' (sense),512AACCTGGGCAACATGAGCGAGCT534; TTF-1 3' (antisense),771AGCTCGTACACCTGCGCCTGCGA GAAGA734; human Pax-8 5' (sense),10GATGCCTCACAACTCCATCAGATC33; and Pax-8 3' (antisense)603TCATCCATTTTCCTCTTGTCGCTG586. The amplification reaction was carried out for 30 cycles, and considered at 94 C for 1 min, 60 C for 1 min, and 72 C for 2 min, followed by a final 10 min elongation at 72 C. All PCR products were analyzed by electrophoresis through 2% agarose gels followed by ethidium bromide staining to ensure amplification of the appropriately sized product.
Immunoperoxidase staining of cells
Immunostaining of thyroid cancer cells treated with HDACI was performed to confirm expression of the NIS, TPO, and Tg proteins in response to HDACI. After treatment of the cells, they were fixed for 15 min in 10 C methanol, air-dried, and then washed three times with PBS. The fixed cells were incubated with an anti-Tg monoclonal (NeoMarkers, Fremont, CA), anti-TPO monoclonal (HyTest Ltd, Eurocity, Turku, Finland), or anti-NIS polyclonal antibody (33) for 30 min and washed with three changes of PBS. Cells then were incubated with biotinylated secondary antibody, washed, and exposed to avidin-biotinylated horseradish peroxidase enzyme reagent and peroxidase substrate (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Then, nuclei were stained with Mayer-hematoxilin (Wako, Osaka, Japan). Cells were examined for staining after rinsing with H2O.
Radioiodide uptake assay
Cells were grown in six-well plates, washed with Hanks balanced salt solution (HBSS), and incubated for 1 h at 37 C with 1000 µl HBSS containing 0.2 µCi carrier-free Na125I (Amersham Pharmacia Biotech, Piscataway, NJ) and 10 µM NaI with or without 300 µM NaClO4 (34). The medium containing 125I was removed, and the cell monolayer was washed twice with 1 ml HBSS. Cell-associated radioactivity of each sample was measured with a
-counter after extraction with ethanol.
Radioiodide organification assay in vitro
After the BHP1821v cells were incubated with 3 ng/ml depsipeptide, one of HDACI, for 72 h, 300 µM methimazole (MMI), a TPO-specific inhibitor, was added 24 h before the assay. Depsipeptide-treated BHP1821v cells were then exposed to 125I (0.2 µCi/well in six-well plates) in HBSS containing 10 µM NaI at 37 C for 1 h. Medium containing 125I was removed and washed with fresh medium. Cell lysates were prepared with 1 ml of 0.1-N NaOH, and the radioiodide accumulation of the cells was measured with a
-counter. Proteins in the cell lysates were precipitated by the addition of 1 ml TCA (final concentration, 20%). Assay tubes were centrifuged at 3300 x g for 30 min, and supernatants containing free radioiodide were removed. The precipitated proteins were washed again with 20% TCA, and radioactivity in the pellets were measured with a
-counter. To measure the Tg- and TPO-independent nonspecific incorporation of 125I into the protein fraction, iodination was measured in NIS-transfected FRTL-Tc, which expresses neither Tg nor TPO.
To investigate the molecular size of radioiodinated intracellular protein substrates, BHP1821v cells, which were preincubated with or without 3 ng/ml depsipeptide for 48 h in a 10-cm culture dish, were exposed to 125I (20 µCi/dish) in HBSS at 37 C for 1 h. Medium containing 125I was removed and washed with fresh medium. Cell lysates were prepared with 1 ml of 0.1 N NaOH, and proteins in the cell lysates were precipitated by the addition of 1 ml TCA (final concentration, 20%), and pellets were washed again with 20% TCA. The cell pellets were dissolved with 100 µl of 10-mM HEPES/NaOH (pH 7.9), 0.1 mM EDTA, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, 1.5 mM phenylmethylsulfonylfluoride, and 10 µg/ml leupeptin. Thirty micrograms of protein extracts of lysate were resolved by SDS-PAGE (35) and processed for analysis by autoradiography. Radioactivity was analyzed using a BAS 2500 image analyzer (Fuji Film Co., Tokyo, Japan).
Analysis of iodide accumulation in vivo
A total of 1 x 107 BHP1821v cells were transplanted in abdominal sc tissue of 8-wk-old male nude mice (BALB/C nu/nu mice). These mice were fed a low-iodide diet (Oriental Yeast, Tokyo, Japan) and were given 100 µg/kg·d L-T4 (Wako) in their drinking water before the formation of tumors (8). Three weeks after the tumors reached approximately 1 cm in diameter, 5 µg/g·d depsipeptide or the vehicle, 0.1% DMSO (Sigma-Aldrich Corp., St. Louis, MO) in 100 µl PBS, was injected ip for 4 d. A total of 10 µCi Na125I (Amersham Pharmacia Biotech) in PBS was injected ip.
Three, 12, and 48 h later, the mice were killed, and radioactivity was analyzed with a BAS2500 image analyzer (Fuji Film Corp.). The mice were exposed to the imaging plates for 5 min. To investigate the ratio of tumor radioactivity to liver radioactivity, their tumors and organs were removed, and their weight and radioactivity were measured.
Three hours after injection of Na125I, tumors were removed. Part of the tumor tissue was homogenated. After preparation of tissue lysate with 300 µl of 1-N NaOH, insoluble material was removed from the lysate by centrifugation at 3300 x g for 10 min at 4 C. Protein in the tissue lysates were precipitated by the addition of 600 µl of 40% TCA. The precipitated proteins were collected by centrifugation at 3300 x g for 20 min, and washed twice. Radioactivity in the pellets was measured with a
-counter. Soluble protein was quantified by the Bradford method using RCDC Protein Assay (Bio-Rad Co., Hercules, CA).
Our institutional committee on animal care approved these studies.
Cytotoxic assay with depsipeptide treatment in vitro
Viabilities of cells treated with depsipeptide were measured with a nonradioactive cell proliferation assay, Cell Counting Kit-8 (Dojindo, Kumamoto, Japan). One day after plating 4 x 103 cells/well in triplicate wells of 96-well culture plates, cells were treated with 1, 3, and 10 ng/ml depsipeptide. Cell viability was assayed 48 h after incubation. Survival of cells is presented as a percentage of the absorbance with depsipeptide-treated cells divided by that with cells not exposed to depsipeptide.
Statistical analysis
All data are expressed as mean ± SEM. Differences between groups were examined for statistical significance using Students t test and a P value < 0.05 was considered significant unless otherwise indicated.
| Results |
|---|
|
|
|---|
|
We also investigated time dependence of the HDACI-induced expression of thyroid-specific genes. Amounts of thyroid-specific genes mRNA reached a maximum 48 h after addition of 3 ng/ml depsipeptide to BHP1821v cells. In ARO cells, re-expression of NIS and TPO reached a maximum after 12 h, whereas Tg gene gradually increased and peaked 48 h after the incubation with 3 ng/ml of depsipeptide (Fig. 2
).
|
|
To evaluate the effect of TSH, we performed the iodide uptake assay pretreated with or without TSH. There were no differences in the amount of depsipeptide-induced iodide uptake between TSH-treated and untreated cells (data not shown). In addition, no expression of TSH-R mRNA was observed in either depsipeptide- or TSA-treated BHP1821v or ARO cells (data not shown). These results indicate that TSH-R gene expression is hardly influenced by HDACI, and depsipeptide-induced iodide uptake is TSH-independent.
Immunocytochemical demonstration of HDACI-induced NIS, TPO, and Tg proteins expression in BHP1821v and ARO cells
To analyze whether HDACI-up-regulated NIS, TPO, or Tg mRNAs is translated to corresponding protein product, immunoreactive NIS, TPO, or Tg proteins expressed in BHP1821v and ARO cells were stained with anti-NIS, anti-TPO, or anti-Tg antibody. The presence of the NIS protein was detected by immunocytochemistry in HDACI-treated BHP1821v and ARO cells and was observed in the cell membrane and cytosol (Fig. 4
, B, C, K, and L). On the contrary, untreated cells were not stained (Fig. 4
, A and J). Treatment with anti-TPO antibody did not yield any staining in BHP1821v or ARO cells untreated with HDACI (Fig. 4
, D and M). In contrast, marked staining was observed in both cell lines treated with HDACI (depsipeptide at 3 ng/ml or TSA at 300 ng/ml) for 48 h (Fig. 4
, E, F, N, and O). This TPO immunostaining was localized in the region of cell membrane and cytosol. Expressed immunoreactive Tg protein also was stained with anti-Tg monoclonal antibody in BHP1821v and ARO cells treated with depsipeptide (3 ng/ml) or TSA (300 ng/ml). Tg protein was detected in the area of the cytosol (Fig. 4
, H, I, Q, and R). No Tg staining was observed in untreated cells (Fig. 4
, G and P). These results clearly show that HDACI induced the expression of NIS, TPO, and Tg proteins, whereas re-expressed NIS and TPO protein were localized in either region of cell membrane and cytosol.
|
|
These results indicate that TPO induced by HDACI was capable of facilitating iodide organification into protein substrates, in which the HDACI-induced expression of Tg played a crucial role on this effect.
Depsipeptide leads to efficient iodide accumulation in vivo
To evaluate the efficiency of depsipeptide in vivo, BHP1821v cells were transplanted on the left flank of nude mice by sc injection of 1 x 107 cells. One week after transplantation, the cells formed small tumors at the injection site. The tumors grew very rapidly and were 1 cm in diameter 3 wk after transplantation. At this point, we injected 5 µg/g·d depsipeptide or DMSO in PBS ip for 4 d. To prevent radioiodide uptake by thyroid gland, mice were treated with L-T4.
Autoradiographic imaging of the depsipeptide-treated mice displayed the accumulation of radioiodide in the physiological NIS-expressed organs, thyroid, stomach, and bladder. However, 48 h after, no accumulation was observed in stomach and bladder (Fig. 6A
). In contrast, depsipeptide-treated tumors could accumulate 125I, as revealed by imaging at 12 and 48 h (Fig. 6A
). Radioactivity in the tumors, thyroid, stomach, and liver were measured and were represented as a percent of the maximum uptake (Fig. 6A
). The disappearance of radioiodide from the stomach paralleled the decrease in radioactivity from the liver. In contrast, the depsipeptide-treated tumors could reserve approximately 3.52% of maximum uptake 48 h after injection (Fig. 6A
). The percentage of injected dose per gram of tissue of depsipeptide-treated tumors at 48 h after injection of 125I was 0.70 ± 0.16%, whereas 0.14 ± 0.04% of radioiodide remained in DMSO-treated tumors (P < 0.05). In addition, radioiodide measurement by whole-body scanning showed that values of 5.95 ± 0.39% and 1.49 ± 0.93% of whole-body retention at 48 h were detected in tumors treated with depsipeptide and DMSO, respectively. Radioiodide accumulation in thyroid glands gradually increased and peaked 48 h after injection.
|
To analyze iodide organification in vivo, we measured protein-bound radioiodide in xenotransplanted tumors. A total of 10 µCi of Na125I was injected into the mice treated with depsipeptide or DMSO. The removed tumors were disrupted, and intracellular protein was extracted. The protein-bound radioiodide in depsipeptide-treated mice was 36.74 ± 7.0 cpm/mg, whereas that in DMSO-treated mice was 6.16 ± 3.6 cpm/mg (P < 0.05) (Fig. 6C
).
To investigate the effects of the HDACI on the expression of NIS, TPO, Tg, and TSH-R in vivo, we analyzed the mRNA levels of these thyroid-specific genes in depsipeptide- or DMSO-treated tumors using quantitative real-time PCR (Table 2
). The mice were treated with 5 µg/g·d depsipeptide or DMSO in PBS for 4 d. In DMSO-treated mice, NIS, TPO, Tg, and TSH-R mRNA were not observed. Re-expression of NIS, TPO, and Tg was detected in depsipeptide-treated tumors, whereas the induction of TSH-R mRNA was not observed. These results clearly demonstrated that depsipeptide could induce the expression of thyroid-specific genes that is necessary for effective cell processing of iodide, and this depsipeptide-induced radioiodide uptake is TSH-independent.
|
|
Cycloheximide diminishes depsipeptide-induced NIS gene expression and enhances the TPO and Tg gene expression
HDACI directly activates the regulatory machinery of transcription via an increase of acetylated histones (38), but also can modulate expression of certain transcription factors, including TTF-1 (Fig. 7
). To investigate whether new protein synthesis was necessary for induction of thyroid-specific genes in depsipeptide-treated BHP1821v and ARO cells, we measured expression of thyroid-specific genes with or without cycloheximide (Biomol Corp., Plymouth Meeting, PA) treatment. After BHP1821v and ARO cells were incubated with 3 ng/ml depsipeptide in the presence or absence of 30 µg/ml cycloheximide for 24 h, expression levels of thyroid-specific genes were quantified by real-time RT-PCR. Cycloheximide partly, but significantly, inhibited the depsipeptide-induced up-regulation of NIS mRNA (Fig. 8
); approximately 70% of induced NIS gene expression was abolished. Thus, a portion of depsipeptide-induced up-regulation of NIS mRNA required ongoing protein synthesis.
|
Depsipeptide exhibits cytotoxic effect against BHP1821v and ARO cells in vitro
We examined the effect of depsipeptide on viabilities of ARO and BHP1821v cells. In both cell lines, 1 ng/ml depsipeptide exhibited no cytotoxicity. Administration of 3 ng/ml depsipeptide was not cytotoxic in BHP1821v, whereas 51% of ARO cells resulted in cell death (P < 0.05). Almost 90% cell death was observed in ARO and BHP1821v cells treated with 10 ng/ml depsipeptide (P < 0.05) (Fig. 9
). In comparison with depsipeptide-induced expression of thyroid-specific genes, higher concentrations of depsipeptide were required for the cytotoxic effect.
|
| Discussion |
|---|
|
|
|---|
We have reported that, despite radioiodide accumulation, Na131I did not significantly change the volume of experimental tumors formed by rat undifferentiated thyroid cells with or without transfection with NIS (8). In that study, extracorporeal measurement of radioactivity in the tumors revealed that 125I accumulation peaked at 90 min and decreased to 50% 6 h after injection in vivo. In contrast, 125I uptake in thyroid glands gradually increased and peaked 48 h after injection. These results demonstrated the differences between NIS-expressed tumor and thyroid glands in time-dependent iodide accumulations may be related to their abilities to organify iodide. These results indicate that cytotoxic efficacy of radioiodide may be limited by the radioiodide efflux, and that enhancing the intracellular retention of iodide is necessary for effective radioiodide therapy. Rapid washout of radioiodide from tumors and low binding of radioiodide are probably consequences of the absence of TPO and Tg gene expression.
Our present study is the first report showing simultaneous induction of NIS, TPO, and Tg gene expression and iodide organification by HDACI in undifferentiated papillary thyroid cancer cells in vitro. Furthermore, we demonstrated HDACI-induced radioiodide accumulation in tumors formed with thyroid cancer cells in vivo. Certain reagents or transcription factors have been found to induce re-expression of thyroid-specific genes. Fagin et al. (40) reported that papillary thyroid cancer cells transfected with wild-type p53 showed re-expression of TPO mRNA and protein. Re-expression of Pax-8 mRNA, which specifically activates the TPO promoter, also was demonstrated. Schmutzler (41) reported that all-trans retinoic acid increased NIS mRNA in human follicular thyroid cancer cells. Venkataraman et al. (42) similarly found that 5-azacytidine could restore the expression of NIS mRNA and radioiodide uptake in benign thyroid adenoma cells. Kitazono et al. (43, 44) reported that HDACI induced the re-expression of NIS and Tg mRNA in human anaplastic thyroid cancer cells.
TPO is the primary enzyme involved in iodide organification (45), being active at the apical pole of the thyrocytes, where oxidizing H2O2 is produced (46). It has been shown that TPO can also be active intracellularly in the presence of H2O2, leading to low levels of intracellularly iodinated proteins (47). Recently, Huang et al. (48) reported that an increase of iodide organification was observed in NIS- and TPO-cotransfected lung cancer cells. Boland et al. (49) reported that the levels of iodide organification obtained were too low to increase the iodide retention time in the thyroid cancer cells cotransfected with NIS and TPO. These reports suggested that expression of Tg was required for the effective iodide retention and organification. In this report, radiolabeled protein greater than 210 kDa was specifically observed, and iodide organification was detected in depsipeptide-treated thyroid cancer cells. These results supported the hypothesis that the induction of iodide organification may require combined expression of NIS, TPO, and Tg, and TPO induced by depsipeptide was capable of facilitating iodide organification into protein substrates, in which the HDACI-induced expression of Tg could play a crucial role on this effect. However, the fact that smear bands appeared suggests a possibility that some other protein substrates might be iodinated in the process of depsipeptide-induced iodide organification.
In the present report, we demonstrated that inhibition of histone deacetylation by HDACI induced the expression of thyroid-specific genes in thyroid cancer cells. Acetylation and deacetylation of histones plays a significant role in regulation of gene transcription in many cell types (38). Histone acetylation alters nucleosomal conformation, which in turn can increase accessibility of transcriptional regulatory proteins to chromatin templates (50). HDAC oppose these events by catalyzing removal of acetyl groups from the amino-terminal lysine residues of core nucleosomal histones (51). Although HDACI act on the general regulatory machinery of transcription, our results demonstrated that HDACI do not do so nonspecifically. For example, HDACI did not increase expression of the GAPDH and Pax-8 genes (Figs. 1
and 7
).
TTF-1 and Pax-8 are major transcription factors regulating the Tg and TPO promoter activity positively. We observed that depsipeptide could increase in the expression level of TTF-1. In contrast, the expression levels of Pax-8 mRNA were decreased in depsipeptide-treated BHP1821v cells, and were not observed in depsipeptide-treated ARO cells. We detected that overexpression of TTF-1 using an adenovirus vector inhibited the expression of Pax-8 mRNA in BHP1821v cells (12, 13, 16, 17, 18, 19). Therefore, we suspect that re-expressed TTF-1 induced by HDACI could influence the reduction of Pax-8 mRNA in BHP1821v cells. Because depsipeptide exhibited an opposite effect on the expression of TTF-1 and Pax-8, we studied the effect of cycloheximide on Tg and TPO gene expression to determine whether HDACI acts through newly synthesized transcription factors or, instead, directly activates the transcriptional machinery for thyroid-specific genes. Figure 8
shows that the presence of cycloheximide did not decrease the levels of HDACI-induced TPO or Tg expression. These results suggested that HDACI-induced re-expression of TPO or Tg genes was not mediated by newly produced trans-activating factors.
Moreover, cycloheximide increased the expression of TPO and Tg mRNA in depsipeptide-treated and untreated cells. We suspect that unknown proteins inhibit TPO and Tg gene expression in cancer cells, and cycloheximide might block the synthesis of these unknown proteins.
In contrast, this study revealed that up-regulation of the NIS gene partly involved newly produced proteins, presumably some transcription factors. In our study, HDACI solely induced expression of TTF-1. Kitazono et al. (52) demonstrated that TTF-1 gene was re-expressed in thyroid cancer cells by simultaneous treatment with depsipeptide and 8-Br-cAMP. In the rat NIS gene, TTF-1 was shown to activate the rat NIS promoter by a direct interaction with its proximal enhancer region (18). Further, Taki et al. (22) found a TTF-1-binding site in the human NIS upstream enhancer, but TTF-1 did not act as a trans-activating factor on the human NIS upstream element. Schmitt et al. (53) also reported that transcription of a TTF-1 expression vector showed no effect on luciferase activity driven by the 9-kb NIS promoter. We presently suspect that an unidentified protein activated by HDACI was involved in NIS gene induction. It is also possible that newly synthesized TTF-1 is involved in the induction of NIS gene expression via interactions of the NIS gene other than these previously investigated.
HDACI was identified as an antitumor agent (54). In human bladder cancer cells, HDACI induced apoptosis, which might be related to the re-expression of p21, c-myc, and gelsolin genes (11). In human breast cancer cells, increased p21, phosphorylation of Bcl-2, and apoptosis have been observed after treatment with depsipeptide (55). In the case of thyroid cancer, Greenberg et al. (56) demonstrated that 500 nM TSA induced apoptosis and cell-cycle arrest in anaplastic thyroid cancer cells. In our study, poorly differentiated and anaplastic thyroid cancer cells treated with 30 ng/ml (99 nM) TSA showed re-expression of the thyroid-specific genes that are required for effective radioiodide therapy (Fig. 1B
). HDACI previously have been shown to simultaneously induce differentiation and apoptosis, as well as cell-cycle arrest, in breast cancer, bladder cancer, and leukemia in mice (11, 54, 55, 57, 58). In this study, 10 ng/ml depsipeptide could induce cell-death concomitantly with iodide accumulation in poorly differentiated and anaplastic thyroid cancer cells (Figs. 3
and 9
). It is reasonable to speculate that the depsipeptide-induced cell-death can be a beneficial effect, from the standpoint of cancer therapy using radioiodide.
Depsipeptide, a strong inhibitor of histone deacetylase, is currently in phase I trials in the United States. These trials suggest that the maximum tolerated plasma concentration is about 472.6 ng/ml (59). In this study we confirmed that a low-dose depsipeptide concentration (110 ng/ml) induced iodide uptake and organification in poorly differentiated thyroid cancer cells. Furthermore, depsipeptide-treated tumors could specifically accumulate radioiodide, as revealed by imaging experiments and radioiodide concentration in vivo. Schlumberger et al. (60) reported that the presence of 131I uptake that could be detected using whole-body scanning was one of the most important prognostic factors in thyroid cancer patients with metastases. Although the tumoral uptake was dependent on tumor size, it was reported that most of positive scans were above 0.7% of whole-body retention 48 h after administration of radioiodide (61, 62). In the present study, whole-body scanning performed 48 h after injection (Fig. 6A
) showed that depsipeptide- and DMSO-treated tumors could accumulate 5.95 ± 0.39% and 1.49 ± 0.93% of whole-body retention, respectively (P < 0.01). We therefore speculate that this HDACI-induced iodide retention may confer some therapeutic effects on poorly differentiated and anaplastic thyroid carcinoma.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received September 19, 2003.
Accepted for publication February 9, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Hoftijzer, K. A Heemstra, H. Morreau, M. P Stokkel, E. P Corssmit, H. Gelderblom, K. Weijers, A. M Pereira, M. Huijberts, E. Kapiteijn, et al. Beneficial effects of sorafenib on tumor progression, but not on radioiodine uptake, in patients with differentiated thyroid carcinoma Eur. J. Endocrinol., December 1, 2009; 161(6): 923 - 931. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A Woyach and M. H Shah New therapeutic advances in the management of progressive thyroid cancer Endocr. Relat. Cancer, September 1, 2009; 16(3): 715 - 731. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Marlow, L. A. Reynolds, A. S. Cleland, S. J. Cooper, M. L. Gumz, S. Kurakata, K. Fujiwara, Y. Zhang, T. Sebo, C. Grant, et al. Reactivation of Suppressed RhoB is a Critical Step for the Inhibition of Anaplastic Thyroid Cancer Growth Cancer Res., February 15, 2009; 69(4): 1536 - 1544. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Woyach, R. T. Kloos, M. D. Ringel, D. Arbogast, M. Collamore, J. A. Zwiebel, M. Grever, M. Villalona-Calero, and M. H. Shah Lack of Therapeutic Effect of the Histone Deacetylase Inhibitor Vorinostat in Patients with Metastatic Radioiodine-Refractory Thyroid Carcinoma J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 164 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kondo, X. Zhu, S. L. Asa, and S. Ezzat The Cancer/Testis Antigen Melanoma-Associated Antigen-A3/A6 Is a Novel Target of Fibroblast Growth Factor Receptor 2-IIIb through Histone H3 Modifications in Thyroid Cancer Clin. Cancer Res., August 15, 2007; 13(16): 4713 - 4720. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing Gene Methylation in Thyroid Tumorigenesis Endocrinology, March 1, 2007; 148(3): 948 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, G. M. Venkataraman, and K. B. Ain Protein Synthesis Inhibitors, in Synergy with 5-Azacytidine, Restore Sodium/Iodide Symporter Gene Expression in Human Thyroid Adenoma Cell Line, KAK-1, Suggesting Trans-Active Transcriptional Repressor J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1080 - 1087. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Riesco-Eizaguirre and P. Santisteban A perspective view of sodium iodide symporter research and its clinical implications. Eur. J. Endocrinol., October 1, 2006; 155(4): 495 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Kogai, K Taki, and G A Brent Enhancement of sodium/iodide symporter expression in thyroid and breast cancer. Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Singh, R Bollmann, H Ahmadzadehfar, H J Biersack, and S Ezziddin Unusual case of well-differentiated papillary thyroid carcinoma lacking thyroglobulin expression while still concentrating radioiodine. Br. J. Radiol., September 1, 2006; 79(945): e84 - e87. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. M. Au, C. McBride, K. G. Wilhelm Jr., R. J. Koenig, B. Speller, L. Cheung, M. Messina, J. Wentworth, V. Tasevski, D. Learoyd, et al. PAX8-Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) Disrupts Normal PAX8 or PPAR{gamma} Transcriptional Function and Stimulates Follicular Thyroid Cell Growth Endocrinology, January 1, 2006; 147(1): 367 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Bravo, M. E.R. Garcia-Rendueles, R. Seoane, V. Dosil, J. Cameselle-Teijeiro, L. Lopez-Lazaro, J. Zalvide, F. Barreiro, C. M. Pombo, and C. V. Alvarez Plitidepsin Has a Cytostatic Effect in Human Undifferentiated (Anaplastic) Thyroid Carcinoma Clin. Cancer Res., November 1, 2005; 11(21): 7664 - 7673. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Landriscina, A. Fabiano, S. Altamura, C. Bagala, A. Piscazzi, A. Cassano, C. Spadafora, F. Giorgino, C. Barone, and M. Cignarelli Reverse Transcriptase Inhibitors Down-Regulate Cell Proliferation in Vitro and in Vivo and Restore Thyrotropin Signaling and Iodine Uptake in Human Thyroid Anaplastic Carcinoma J. Clin. Endocrinol. Metab., October 1, 2005; 90(10): 5663 - 5671. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Puppin, F. D'Aurizio, A. V. D'Elia, L. Cesaratto, G. Tell, D. Russo, S. Filetti, E. Ferretti, E. Tosi, T. Mattei, et al. Effects of Histone Acetylation on Sodium Iodide Symporter Promoter and Expression of Thyroid-Specific Transcription Factors Endocrinology, September 1, 2005; 146(9): 3967 - 3974. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. K. Kelly, O. A. O'Connor, L. M. Krug, J. H. Chiao, M. Heaney, T. Curley, B. MacGregore-Cortelli, W. Tong, J. P. Secrist, L. Schwartz, et al. Phase I Study of an Oral Histone Deacetylase Inhibitor, Suberoylanilide Hydroxamic Acid, in Patients With Advanced Cancer J. Clin. Oncol., June 10, 2005; 23(17): 3923 - 3931. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Robbins and M. J. Schlumberger The Evolving Role of 131I for the Treatment of Differentiated Thyroid Carcinoma J. Nucl. Med., January 1, 2005; 46(1_suppl): 28S - 37S. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, H. Shimura, A. Miyazaki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi Adenovirus-Mediated Transfer of Thyroid Transcription Factor-1 Induces Radioiodide Organification and Retention in Thyroid Cancer Cells Endocrinology, November 1, 2004; 145(11): 5397 - 5405. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Marsee, A. Venkateswaran, H. Tao, D. Vadysirisack, Z. Zhang, D. D. Vandre, and S. M. Jhiang Inhibition of Heat Shock Protein 90, a Novel RET/PTC1-associated Protein, Increases Radioiodide Accumulation in Thyroid Cells J. Biol. Chem., October 15, 2004; 279(42): 43990 - 43997. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |