help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1433
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuwabara, K.
Right arrow Articles by Yamashita, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuwabara, K.
Right arrow Articles by Yamashita, N.
Endocrinology Vol. 145, No. 7 3324-3330
Copyright © 2004 by The Endocrine Society

Differential Regulation of Cell Migration and Proliferation through Proline-Rich Tyrosine Kinase 2 in Endothelial Cells

Koichiro Kuwabara, Takashi Nakaoka, Kaori Sato, Toshihide Nishishita, Terukatsu Sasaki and Naohide Yamashita

From Department of Advanced Medical Science (K.K., T.Na., K.S., T.Ni., N.Y.), The Institute of Medical Science, The University of Tokyo, Tokyo 108-8639, Japan; and Department of Biochemistry (T.S.), Cancer Research Institute, Sapporo Medical University School of Medicine, Sapporo 060-8556, Japan

Address all correspondence and requests for reprints to: Naohide Yamashita, Department of Advanced Medical Science, The Institute of Medical Science, The University of Tokyo, 4-6-1, Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. E-mail: yama-nao{at}ims.u-tokyo.ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Proline-rich tyrosine kinase 2 (Pyk2), a member of the focal adhesion kinase family, is thought to act as a key component in vasculogenesis and angiogenesis. Therefore, we studied the effect of mutant Pyk2 expression on the migration and proliferation in endothelial cells (ECs). Two types of mutant Pyk2 were examined by adenovirus vectors AxCA-Pyk2K457A, expressing a kinase inactive mutant, and AxCA-Pyk2Y402F, expressing a tyrosine autophosphorylation site mutant, in addition to AxCA-Pyk2, expressing wild-type Pyk2. Migration of ECs infected with AxCA-Pyk2Y402F increased to a level similar to that of ECs infected with AxCA-Pyk2. The size of effect was dependent on the amount of applied adenoviruses within the range of 3–30 multiplicity of infection. In contrast, AxCA-Pyk2K457A infection did not show any significant effect on cell migration. Western blotting showed that both phosphorylation of Pyk2 Y881 and association of p130Cas with Pyk2 were enhanced in ECs infected with AxCA-Pyk2Y402F as well as with AxCA-Pyk2, but not in ECs infected with AxCA-Pyk2K457A. Therefore, signaling mediated by Pyk2 Y881 and p130Cas may be involved in the migration of ECs infected either with AxCA-Pyk2Y402F or with AxCA-Pyk2. In proliferation assay, AxCA-Pyk2 infection suppressed EC proliferation significantly; however, neither AxCA-Pyk2Y402F nor AxCA-Pyk2K457A showed such an inhibitory effect. Thus, the two Pyk2 mutants revealed that Pyk2 signaling differentially regulates cell migration and proliferation pathways.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MIGRATION AND PROLIFERATION of endothelial cells (ECs) constitute an essential part of vasculogenesis and angiogenesis. Chemokines and their receptors have been reported to play important roles in vasculogenesis and angiogenesis as well as in inflammatory responses (1). Several members of the chemokine superfamily, including stromal-derived factor-1{alpha} (SDF-1{alpha}), act as potent chemoattractants for ECs (2). CXC chemokine receptor 4 (CXCR4), a member of the G protein-coupled receptor family, is a specific receptor for SDF-1{alpha}. The expression of CXCR4 on the EC membrane is stimulated by vascular endothelial growth factor (VEGF) or basic fibroblast growth factor, both of which are well-known vasculogenic and angiogenic factors (3). Signal transduction through CXCR4 and through another type of chemokine receptor (CC-chemokine receptor 5) leads to activation of proline-rich tyrosine kinase 2 (Pyk2; also known as related adhesion focal tyrosine kinase, focal adhesion kinase 2, cell adhesion kinase ß (CAKß), or calcium-dependent tyrosin kinase), a member of the focal adhesion kinase (FAK) family (4). FAK stimulates migration of Chinese hamster ovary cells, which depends upon autophosphorylation of FAK Y397 (5). Upon Y397 autophosphorylation, Src tyrosine kinase is recruited to FAK, and the subsequent tyrosine phosphorylation of p130Cas is crucial in FAK-stimulated cell migration (6, 7). Although Pyk2 structurally resembles FAK, their functions are different from each other in the following points. FAK colocalizes with paxillin in the cytoplasm, and this association appears to be involved in cell migration (8). On the other hand, Pyk2 is also able to associate with paxillin, but endogenous Pyk2 does not colocalize with paxillin in the cytoplasm (9, 10). Moreover, tyrosine phosphorylation of FAK and Pyk2 is regulated differently during epithelial-mesenchymal transdifferentiation in cell migration (11) and in neuronal activation (12). From these findings, it is suggested that FAK and Pyk2 are involved in different signaling events (10). Pyk2 is implicated in multiple cellular processes such as neurotransmission (13), T and B cell signaling (14), actin-cytoskeleton organization, and cell proliferation (15). In this study, we focused on the role of Pyk2 in vasculogenesis and angiogenesis to examine the effect of two Pyk2 mutants on migration and proliferation in ECs.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents
Anti-ERK1/2 polyclonal antibody (pAb) and antiphosphorylated ERK1/2 pAb (anti-ACTIVE MAPK pAb) were purchased from Promega Corp. (Madison, WI). Anti-p130Cas pAb and protein G-agarose beads were purchased from Upstate Biotechnology (Lake Placid, NY). VEGF was purchased from R&D Systems Inc. (Minneapolis, MN). Recombinant human SDF-1{alpha} was purchased from PeproTech EC Ltd. (London, UK). Bovine albumin fraction V solution was purchased from Invitrogen Corp. (Carlsbad, CA). Enhanced chemiluminescence Western blotting detection reagents and nitrocellulose membrane (Hybond-ECL) were purchased from Amersham Biosciences UK Ltd. (Buckinghamshire, UK). Nitrocellulose transfer membrane (PROTRAN) was purchased from Schleicher & Schuell GmbH (Dassel, Germany). Anti-Pyk2/CAKß pAb, anti-Pyk2 [pY402] phosphospecific antibody, anti-Pyk2 [pY579] phosphospecific antibody, anti-Pyk2 [pY580] phosphospecific antibody, anti-Pyk2 [pY881] phosphospecific antibody, biotin-conjugated goat F(ab')2 antirabbit Ig, biotin-conjugated goat F(ab')2 antimouse Ig, and streptavidin-horseradish peroxidase were purchased from Biosource International, Inc. (Camarillo, CA). Micro-BCA protein assay reagent was purchased from Pierce Biotechnology, Inc. (Rockford, IL). EBM-2 (EC basal medium), EGM-2 (EC medium), EGM-2 MV (microvascular EC medium), and GA-1000 (aqueous solution of gentamicin sulfate and amphotericin-B) were purchased from Cambrex Bio Science Walkersville, Inc. (Walkersville, MD).

Construction of Pyk2 mutants
Full-length Pyk2 cDNA was cloned into pBSSK(+) (Pyk2SK). Pyk2 has four potential phosphorylatable tyrosyl residues (Y402, Y579, Y580, and Y881). We mutated Y402, an autophosphorylation site analogous to Y397 in FAK (16), and K457, which is essential for the tyrosine kinase activity (17). Mutagenesis was performed using the Muta-Gene phagemid in vitro mutagenesis kit (Bio-Rad Laboratories, Inc., Hercules, CA) as described previously (18). The mutagenesis primer ATGTAGCTGTCGCGACCTGCAAGAA is specific for Y402F, a substitution of the authentic tyrosine 402 with phenylalanine; mutagenesis primer AGTCAGACATCTTTGCAGAGATTCC is specific for K457A, a substitution of the authentic lysine 457 with alanine. Pyk2 plasmid was digested with HpaI and ScaI, and the resultant 1.3-kbp fragment was cloned into the EcoRV site of pBSSK(+). The orientation was checked by restriction with AvrII and EcoRI. The clone with the right orientation was then transfected into cj239 to generate uracil-containing single-stranded DNA as mutagenesis template. Mutagenesis primers were annealed to the template, followed by conversion of closed circular DNA. The mutation was confirmed by sequencing. Finally, the authentic 0.9-kbp fragment in Pyk2SK, which was restricted with AvrII and PinAI, was replaced with the corresponding mutant fragment to obtain mutant full-length cDNA, Pyk2Y402F and Pyk2K457A, respectively.

Construction of adenoviruses AxCA-Pyk2Y402F and AxCA-Pyk2K457A
A replication-deficient adenovirus was created using the Adenovirus Kit (Takara Bio Inc., Shiga, Japan), essentially as described previously (19). The mutant cDNA containing the complete coding region of Pyk2 was blunt-ended and cloned into the SwaI site of a cosmid, pAxCAwt. The orientation of the insert was checked by restriction with BamHI. The resulting cosmid was cotransfected to the 293 embryonic cell line with an EcoT221-digested DNA-terminal protein complex to generate the replication-deficient adenoviruses, AxCA-Pyk2Y402F and AxCA-Pyk2K457A. The obtained viral clones were isolated, screened for the insert, and propagated. The viruses were titrated and stocked in PBS containing 10% glycerol at –80 C. AxCA-LacZ (a replication-deficient adenovirus carrying the Escherichia coli ß-galactosidase gene) and Ad5dlx (20), which were kindly provided by Professor Izumu Saito (Institute of Medical Science, University of Tokyo, Tokyo, Japan), and AxCA (a vector containing no foreign gene) (21), which was kindly provided by Professor Yoh Takuwa (School of Graduate Medical Science, Kanazawa University, Kanazawa, Japan), were used as negative controls. A wild-type Pyk2-expressing adenovirus vector was used as a positive control.

Cells
Human umbilical vascular ECs (hUVECs) and human dermal microvascular endothelial cells (hMVECs-d) were purchased from Bio Whittaker (San Diego, CA). hUVECs were grown in EGM-2 containing 2% fetal bovine serum, and hMVECs-d were grown in EGM-2 MV containing 5% fetal bovine serum. In the case of serum deprivation, EBM-2 supplemented with GA-1000 and 44 pmol/liter VEGF was used as basal media for both hUVECs and hMVECs-d.

Western blotting analysis
hMVECs-d uninfected or infected with adenoviruses were lysed in extraction buffer (125 mmol/liter Tris, pH 6.8; 4% sodium dodecyl sulfate, 20% glycerol, and 0.002% bromophenol blue), followed by boiling for 3 min. After adjustment for protein concentration, 2-mercaptoethanol was added to the sample (final 5%). Next, samples separated on a 4–20% gradient sodium dodecyl sulfate-polyacrylamide gel were transferred onto nitrocellulose membranes. The membranes were soaked in 10 mmol/liter Tris-HCl and 140 mmol/liter NaCl (pH 7.5) [Tris-buffered saline (TBS)] containing 4% skim milk for 2 h at room temperature (RT). The blots were incubated with the indicated primary antibody in TBS with 0.1% Tween 20 (TBS-T) at 4 C overnight. After washing in TBS-T, the blots were further incubated with biotin-conjugated secondary antibody in TBS-T containing 0.1% BSA for 2 h at RT. After the reaction with streptavidin-horseradish peroxidase in TBS-T containing 0.1% BSA for 1 h at RT, the detection was performed using enhanced chemiluminescence Western blotting detection reagents. Primary antibodies and biotin-conjugated secondary antibodies were used at recommended dilution, and streptavidin-horseradish peroxidase was used at 0.1 g/liter.

Cell migration assay
Chemotaxis assay was performed by the Boyden chamber method using a filter of 6.5-mm diameter and 8.0-mm pore size (Transwell; Corning Inc., Corning, NY) as reported by Bleul et al. (22). The filters were presoaked in PBS containing 0.1% gelatin for 30 min. Typically, at a confluency of 70–90%, growth media were replaced with basal media. Replication-deficient adenovirus, AxCA, AxCA-Pyk2, AxCA-Pyk2Y402F, or AxCA-Pyk2K457A, was added to the basal media at the indicated multiplicity of infection (MOI). After a 24-h incubation period at 37 C under 5% CO2, the cells were detached by 0.025% trypsin and 0.01% EDTA, followed by centrifugation. The cell pellet was resuspended in PBS and maintained at 4 C for 2 h. Then, typically 3.0 x 105 hUVECs or hMVECs-d resuspended in 100 µl of PBS were transferred to the upper compartment of the Transwell, while the bottom well was filled with 600 µl of RPMI 1640 medium with or without 125 nmol/liter SDF-1{alpha}. The chambers were incubated for 2 h at 37 C under 5% CO2. At the end of incubation, the upper surface of the filters was mechanically scraped off, and the filters were fixed in methanol and stained with hematoxylin and eosin to estimate the number of cells that had migrated through the pores in the filters. The stained cells were counted as the mean number of the cells per five to nine high-power fields. Each independent experiment was repeated at least twice.

Immunoprecipitation
Cells seeded on 10-cm tissue culture plates were lysed in 0.9 ml RIPA buffer (50 mmol/liter Tris-HCl, 150 mmol/liter NaCl, 1 mmol/liter EDTA, 1% Nonidet P-40, 0.25% sodium deoxycholate, pH 7.4) containing 1 mmol/liter Na3VO4, 10 mmol/liter Na4P2O7, 10 mmol/liter NaF, and proteinase inhibitors (1 mmol/liter phenylmethylsulfonyl fluoride, 7 mmol/liter leupeptin, 4 mmol/liter pepstatin A, and 0.4 mmol/liter aprotinin). Phenylmethylsulfonyl fluoride was dissolved in dimethyl sulfoxide at 100 mmol/liter and added to the buffer just before use. The cell lysate was collected into a 1.5-ml tube after passing through 22-gauge needle and maintained on ice for 30 min. After microcentrifugation at 104 x g for 10 min at 4 C, the supernatants were transferred to other tubes. To each tube, 1 µg of anti-p130Cas pAb was added and incubated for 2 h at 4 C by gentle rocking. Twenty milliliters of 50% slurry of protein G-agarose beads were added, and incubation was further continued for 16 h. The beads were washed extensively in PBS and then boiled in 40 µl of extraction buffer for 3 min and subjected to Western blotting by anti-Pyk2/CAKß pAb as described earlier.

Cell proliferation assay
hMVECs-d were plated in a 96-well tissue culture dish at 2.8 x 103 cells per well in 100 µl of medium. After incubation for 24–48 h at 37 C under 5% CO2, 100 µl of medium containing the indicated amount of adenoviruses was replaced with the medium in wells, and the incubation was further continued for 72 h. Then, 10 µl of Cell Counting Kit-8 (Dojindo Laboratories Inc., Kumamoto, Japan) reagent was added to each well. After 4-h incubation at 37 C under 5% CO2, optical density at 450 nm was determined using an ELISA reader.

Statistical analysis
The Wilcoxon rank sum test was used to evaluate the statistical significance of differences between two groups. P < 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of mutant Pyk2 protein in hMVECs-d
In the present study, we used adenoviruses expressing wild-type Pyk2 and the following two types of Pyk2 mutants: AxCA-Pyk2K457A, expressing a kinase inactive mutant, and AxCA-Pyk2Y402F, expressing a tyrosine autophosphorylation site mutant. Expression of wild-type and mutant Pyk2 proteins was confirmed by Western blotting. Lysates from cells infected with AxCA-Pyk2, AxCA-Pyk2Y402F, and AxCA-Pyk2K457A clearly reacted with anti-Pyk2/CAKß pAb, which reacts with the C terminus of the Pyk2 protein, whereas lysates from neither AxCA-infected cells nor uninfected cells showed detectable reactivity (Fig. 1AGo). The detected bands in lanes 1, 2, and 3 corresponded to 116 kDa, which is consistent with the molecular mass of Pyk2 protein.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1. A, Western blotting (WB) analysis of wild-type or mutant Pyk2 expression in hMVECs-d. hMVECs-d were uninfected (no virus) or infected with AxCA-Pyk2 (3 MOI), AxCA-Pyk2Y402F (30 MOI), AxCA-Pyk2K457A (30 MOI), or AxCA (30 MOI). After 24-h serum deprivation, the cells were lysed to subject to Western blotting with anti-Pyk2/CAKß pAb. B, Inhibitory effect of AxCA-Pyk2Y402F or AxCA-Pyk2K457A infection on hMVECs-d ERK1/2 phosphorylation. hMVECs-d were uninfected (no virus) or infected with AxCA-Pyk2 (3 MOI), AxCA-Pyk2Y402F (30 MOI), AxCA-Pyk2K457A (30 MOI), or AxCA (30 MOI). After 24-h serum deprivation, the cells were stimulated by 12.5 nmol/liter SDF-1{alpha} in EBM-2 for 5 min and lysed to subject to Western blotting with antiphosphorylated ERK1/2 pAb (anti-ACTIVE MAPK pAb).

 
Then we examined the effect of the Pyk2 mutants on SDF-1{alpha}-stimulated ERK1/2 activation in hMVECs-d. Phosphorylation of ERK1/2 was detected in lysates from hMVECs-d both infected with AxCA-Pyk2 and uninfected (Fig. 1BGo). It was, however, decreased in lysates from cells infected both with AxCA-Pyk2Y402F and with AxCA-Pyk2K457A, indicating that the two Pyk2 mutants inhibited the SDF-1{alpha}-stimulated ERK1/2 activation.

Pyk2Y402F increases the migration of human ECs
We examined the effects of infection either with AxCA-Pyk2Y402F or with AxCAPyk2K457A on cell migration both in hUVECs and in hMVECs-d. Figure 2AGo shows the representative result of migration assay in hUVECs. Compared with the control (uninfected cells), the migration of hUVECs infected with AxCA-Pyk2Y402F (30 MOI) and AxCA-Pyk2 (3 MOI) increased significantly to 180 ± 9% (mean ± SE, n = 9; P < 0.01) and 183 ± 16% (P < 0.01), respectively. The effect of infection with these constructs was similar to that of application with 125 nmol/liter SDF-1{alpha}, which increased the migration of hUVECs to 168 ± 14% (P < 0.01) (23). In contrast, the migration of hUVECs infected with AxCA (30 MOI) or AxCA-Pyk2K457A (30 MOI) was not different from that of the control. The migration of hUVECs infected with another control vector (Ad5dlx) was not different from that of uninfected cells (data not shown). Similar results were reproduced in two independent experiments. In the migration assay, we used AxCA-Pyk2 at 3 MOI because AxCA-Pyk2 infection at higher MOI was detrimental to hUVECs and hMVECs-d (described in Discussion) and because the level of Pyk2 expression in ECs infected at 3 MOI with AxCA-Pyk2 was comparable to the level of mutant Pyk2 expression in ECs infected at 30 MOI either with AxCA-Pyk2Y402F or with AxCA-Pyk2K457A.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 2. A, Migration assay of hUVECs infected with wild-type or mutant Pyk2-expressing adenovirus. hUVECs were uninfected (no virus) or infected with AxCA (30 MOI), AxCA-Pyk2K457A (30 MOI), AxCA-Pyk2Y402F (30 MOI), or AxCA-Pyk2 (3 MOI), and after 24 h of serum deprivation, they were applied to cell migration assay. Uninfected hUVECs were also stimulated with 125 nmol/liter SDF-1{alpha} as positive control. Results shown are expressed as the mean and SE of relative migration rate (normalized to uninfected cells as 1.0) calculated from nine microscopic fields in each condition. **, Statistical significance compared with uninfected cells (no virus) assessed as P < 0.01 by the Wilcoxon rank sum test. B, Stimulatory effect of AxCA-Pyk2Y402F infection on hMVECs-d migration. hMVECs-d were uninfected (no virus) or infected with AxCA-Pyk2K457A or AxCA-Pyk2Y402F at 30 MOI. After 24-h serum deprivation, migration of the cells was examined. Results shown are expressed as the mean and SE of relative migration rate (normalized to uninfected cells as 1.0) calculated from five microscopic fields in each condition. **, Statistical significance compared with uninfected cells (no virus) assessed as P < 0.01 by the Wilcoxon rank sum test. C, The dependency of EC migration on the MOI of AxCA-Pyk2Y402F. hMVECs-d were uninfected (no virus) or infected with AxCA-Pyk2Y402F at the concentration of 3, 10, or 30 MOI, and after 24-h serum deprivation, migration of the cells was examined. Results shown are expressed as the mean and SE of relative migration rate (normalized to uninfected cells as 1.0) calculated from five microscopic fields in each condition. **, Statistical significance compared with uninfected cells (no virus) assessed as P < 0.01 by the Wilcoxon rank sum test.

 
To investigate whether the stimulation of cell migration by Pyk2Y402F was unique to hUVECs, we examined the migration of hMVECs-d. As shown in Fig. 2BGo, the migration of hMVECs-d infected with AxCA-Pyk2Y402F (30 MOI) increased significantly compared with control (266 ± 11%; P < 0.01), whereas the migration in hMVECs-d infected with AxCA-Pyk2K457A did not differ significantly from control. Similar results were reproduced in two independent experiments. Therefore, we concluded that the stimulatory effect of Pyk2Y402F on cell migration was common to both hUVECs and hMVECs-d.

Next, we examined the dependency of EC migration on the MOI of AxCA-Pyk2Y402F (Fig. 2CGo). The migration of hMVECs-d infected with AxCA-Pyk2Y402F was 152 ± 11% at 3 MOI, 168 ± 5% at 10 MOI, and 213 ± 8% at 30 MOI, relative to uninfected hMVECs-d. Thus, hMVECs-d migration stimulated by AxCA-Pyk2Y402F is dependent on the infected MOI. Similar results were reproduced in two independent experiments.

Tyrosine phosphorylation of mutant Pyk2 proteins in hMVECs-d
SDF-1{alpha} and VEGF are known to stimulate EC migration vigorously (3, 24, 25). To examine the involvement of four potential phosphorylatable tyrosyl residues of Pyk2 (Y402, Y579, Y580, and Y881) in EC migration, the lysates from hUVECs, stimulated either with SDF-1{alpha} or with VEGF, were subjected to Western blotting with anti-Pyk2 phosphospecific pAbs toward [pY402], [pY881], [pY579], and [pY580]. As shown in Fig. 3Go, the phosphorylation of Y402 and Y881 was clearly stimulated either with SDF-1{alpha} or with VEGF at 5 min; however, phosphorylation of Y579 and Y580 was not clearly detected, suggesting potential involvement of phosphorylation of Y402 and Y881, but not of Y579 and Y580, in the pathway stimulated by SDF-1{alpha} and VEGF.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 3. Phosphorylation of Pyk2 tyrosyl residues induced by SDF-1{alpha} or VEGF in hUVECs. Lysates from hUVECs stimulated either with SDF-1{alpha} (12.5 nmol/liter) or with VEGF (2.2 nmol/liter) for 2 or 5 min were subjected to Western blotting with the following four kinds of anti-Pyk2 phosphospecific pAbs: anti-Pyk2 [pY402] pAb, anti-Pyk2 [pY579] pAb, anti-Pyk2 [pY580] pAb, and anti-Pyk2 [pY881] pAb.

 
We also subjected lysates from hMVECs-d infected with adenoviruses to Western blotting with the four kinds of anti-Pyk2 phosphospecific pAbs. The reaction of anti-Pyk2 [pY881] phosphospecific pAb with lysates from hMVECs infected with AxCA-Pyk2 or AxCA-Pyk2Y402F was much greater than that with lysates from uninfected cells or cells infected with AxCA-Pyk2K457A or AxCA (Fig. 4AGo). Anti-Pyk2 [pY402] phosphospecific pAb clearly reacted with lysates from cells infected either with AxCA-Pyk2 or with AxCA-Pyk2K457A. As expected, lysates from cells infected with AxCA-Pyk2Y402F did not react with anti-Pyk2 [pY402] pAb (Fig. 4BGo). Neither anti-Pyk2 [pY579] phosphospecific pAb nor anti-Pyk2 [pY580] phosphospecific pAb clearly reacted with lysates from cells infected with AxCA-Pyk2Y402F or with AxCA-Pyk2K457A (Fig. 4Go, C and D). These results suggested that Y881 phosphorylation might be associated with an increased cell migration potential, whereas loss of Y402 did not affect the migration potential. Besides, the findings that phosphorylation of neither Y579 nor Y580 was activated in AxCA-Pyk2Y402F-infected ECs, which showed high migratory potential, suggested that phosphorylation of neither Y579 nor Y580 was significantly involved in the stimulated migratory activity of ECs infected with AxCA-Pyk2Y402F.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 4. The effect of AxCA-Pyk2Y402F or AxCA-Pyk2K457A infection to hMVECs-d on Pyk2 tyrosine phosphorylation. hMVECs-d were uninfected (no virus) or infected with AxCA-Pyk2 (3 MOI), AxCA-Pyk2Y402F (30 MOI), AxCA-Pyk2K457A (30 MOI), or AxCA (30 MOI). After 24-h serum deprivation, the cells were lysed to react with anti-Pyk2 [pY881] phosphospecific pAb (A), anti-Pyk2 [pY402] phosphospecific pAb (B), anti-Pyk2 [pY579] phosphospecific pAb (C), or anti-Pyk2 [pY580] phosphospecific pAb (D). WB, Western blotting.

 
The association of p130Cas with Pyk2 in AxCA-Pyk2Y402F-infected hMVECs-d
Because activation of p130Cas is implicated in FAK-mediated cell migration (8), we evaluated the association of p130Cas with wild-type or mutant Pyk2 in hMVECs-d. Cell lysates were immunoprecipitated with anti-p130Cas pAb and blotted with anti-Pyk2/CAKß pAb. The association of p130Cas with Pyk2 was more prominent in cells expressing AxCA-Pyk2 or AxCA-Pyk2Y402F when compared with uninfected cells or cells infected with AxCA-Pyk2K457A or Ad5dlx (Fig. 5Go). Thus, the association of p130Cas with Pyk2 coincided with an increase in cell migration. The association of p130Cas with Pyk2 in cells infected with AxCA-Pyk2K457A was less apparent than in uninfected cells or cells infected with Ad5dlx, suggesting that Pyk2K457A exerted some inhibitory effect on this pathway.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 5. Association of p130Cas with Pyk2/CAKß in hMVECs-d. The hMVECs-d were uninfected (no virus) or infected with AxCA-Pyk2 (3 MOI), AxCA-Pyk2Y402F (30 MOI), AxCA-Pyk2K457A (30 MOI), or Ad5dlx (30 MOI). After 24-h serum deprivation, each cell lysate was immunoprecipitated with anti-p130Cas pAb and then immunoblotted with anti-Pyk2/CAKß pAb. IP, Immunoprecipitation; WB, Western blotting.

 
Proliferation of mutant Pyk2-expressing hMVECs-d
We examined the effects of infection either with AxCA-Pyk2Y402F or with AxCA-Pyk2K457A on cell proliferation in hMVECs-d (Fig. 6Go). AxCA-infected cells proliferated more actively than uninfected cells (138 ± 19%, n = 4; P < 0.05), suggesting that the infection of adenovirus vector itself might positively affect cell proliferation. AxCA-Pyk2 significantly inhibited the cell proliferation of hMVECs-d at 3 MOI (78 ± 1%; P < 0.01). Because AxCA-Pyk2 stimulated cell migration at 3 MOI (see Fig. 2Go), this inhibition was not ascribed to the cell damage caused by AxCA-Pyk2 infection. Proliferation of neither AxCA-Pyk2Y402F- nor AxCA-Pyk2K457A-infected cells (124 ± 6% and 121 ± 5%, respectively) differed significantly from that of AxCA-infected cells. Similar results were reproduced in two independent experiments. Therefore, we concluded that neither AxCA-Pyk2Y402F nor AxCA-Pyk2K457A negatively affected cell proliferation unlike AxCA-Pyk2.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 6. Proliferation assay of hMVECs-d infected with wild-type or mutant Pyk2-expressing adenovirus. hMVECs-d were uninfected (no virus) or infected with AxCA (30 MOI), AxCA-Pyk2 (3 MOI), AxCA-Pyk2Y402F (30 MOI), or AxCA-Pyk2K457A (30 MOI) and incubated in EGM-2 MV for 72 h. Four hours after application with Kit-8 solution, the absorbance was read. Results shown are expressed as the mean and SE of relative absorbance rate (normalized to uninfected cells as 1.0) calculated from eight (uninfected cells) or four wells (infected cells) of each condition. * and **, Statistical significance compared with uninfected cells (no virus) assessed as P < 0.05 and P < 0.01 by the Wilcoxon rank sum test, respectively.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We constructed adenovirus vectors expressing a tyrosine autophosphorylation site mutant, AxCA-Pyk2Y402F, and a kinase inactive Pyk2 mutant, AxCA-Pyk2K457A. Western blotting revealed that both mutants inhibited the SDF-1{alpha}-stimulated ERK1/2 activation. Cell migration assay in hUVECs and hMVECs-d showed that overexpression of Pyk2Y402F stimulated cell migration, as did wild-type Pyk2, but that overexpression of Pyk2K457A did not affect cell migration significantly. In accordance with these results, phosphorylation of Pyk2 Y881 and association of p130Cas with Pyk2 were enhanced in hMVECs-d infected either with AxCA-Pyk2Y402F or with AxCA-Pyk2 and not in hMVECs-d infected with AxCA-Pyk2K457A. In contrast, cell proliferation assay showed that overexpression of wild-type Pyk2 suppressed cell proliferation, whereas overexpression of neither Pyk2 mutant affected cell proliferation.

Y402 in Pyk2 is an autophosphorylation site analogous to Y397 in FAK (26). Overexpression of FAK in Chinese hamster ovary cells has been shown to increase cellular migration on fibronectin (5). In this case, mutating the autophosphorylation site Y397 in FAK abolished its ability to stimulate cell migration, whereas overexpression of kinase-inactive FAK promoted cell migration. As opposed to those findings, our study showed that the autophosphorylation site-mutated Pyk2Y402F promoted cell migration, whereas kinase-defective Pyk2K457A did not significantly affect cell migration. Therefore, signaling through Y402 in Pyk2 is associated with a cellular function different from that through Y397 in FAK. It is noteworthy that phosphorylation status of Pyk2 was involved in increased cell migration of glioblastoma cell lines (27), suggesting that Pyk2 Y881 is closely involved in tumorigenesis. It might be possible that Pyk2 Y881 could be a molecular target of cancer therapy.

In the case of FAK, phosphorylation of Y397 is important for cell migration, which means that involvement of Src family kinase is essential for FAK-mediated cell migration. In contrast, EC migration did not need Pyk2 Y402 phosphorylation in our study, suggesting that Pyk2-mediated EC migration may not depend on Src family kinase recruitment. Phosphorylation of Pyk2 Y881 paralleled cell migration in our study. It is possible that Y881 in Pyk2Y402F was phosphorylated by natural Pyk2 itself in ECs or its activating Src family kinase. Although FAK and Pyk2 are structurally similar, they antagonize each other in certain circumstances. For example, overexpression of Pyk2 in fibroblasts leads to reorganization of cytoskeleton, which is suppressed by overexpression of FAK (15). Another study shows that FAK is required for cell survival in fibroblasts, whereas Pyk2 induces apoptosis (28). Phosphorylation of Y579 and Y580 in Pyk2 might be involved in EC migration.

It is reported that Pyk2 is abundantly expressed in pulmonary EC and plays an important role in cell migration (29). In contrast to our study, Tang et al. (29) showed that Pyk2Y402F did not significantly affect cell migration, whereas Pyk2K457A decreased it. This discrepancy may be attributable to the differences in experimental conditions. For example, Tang et al. (29) examined the effect of Pyk2 mutants on serum-stimulated cell migration, whereas we observed Pyk2Y402F-promoted cell migration in a serum-free environment. It is also possible that different EC respond to Pyk2Y402F in a different manner; in our study, overexpression of Pyk2Y402F promoted cell migration in both hMVEC-d and hUVEC, whereas Tang et al. (29) used pulmonary EC for their study.

A variety of extracellular signals that elevate intracellular calcium concentration and stress signals mediated by TNF-{alpha} or UV irradiation lead to activation of Pyk2 (13, 30). A model has been presented in which Pyk2 acts as bifurcation point of two signaling pathways, one leading to activation of ERK1/2 through Src recruitment and the other linking to tyrosine phosphorylation of p130Cas and its subsequent association with phosphatidylinositol 3-kinase (31). Pyk2 is also implicated in the c-Jun N-terminal protein kinase/stress-activated protein kinase pathway (16). In PC-12 cells, Pyk2 tyrosine phosphorylation and activation are stimulated by neuronal stimuli and stress signals, leading to the modulation of the potassium channel and activation of the c-Jun N-terminal protein kinase/stress-activated protein kinase signaling pathway, respectively (32). Our results are consistent with this model. The association of p130Cas with Pyk2 was detected in AxCA-Pyk2Y402F- as well as AxCA-Pyk2-infected hMVECs-d, but it was not detected in AxCA-Pyk2K457A-infected cells. Because association of p130Cas with Pyk2 is implicated in cell migration in several types of cells (6, 33, 34, 35), it is likely that overexpression of Pyk2Y402F promoted cell migration through association of p130Cas with Pyk2. It is not clear, however, what kinases are responsible for tyrosine phosphorylation of p130Cas in AxCA-Pyk2Y402Finfected hMVECs-d. Pyk2, Src, and Fyn tyrosine kinase are implicated in the phosphorylation of p130Cas dependent on the cell types (36, 37). Because no detectable bands were apparent in the control adenovirus-infected hMVECs-d in our study, association of p130Cas with Pyk2Y402F was not caused by a nonspecific effect of adenovirus infection.

Adenovirus-mediated overexpression of neither Pyk2Y402F nor Pyk2K457A affected cell proliferation, whereas overexpression of wild-type Pyk2 inhibited it. Overexpression of Pyk2 has been reported to induce apoptosis (28), which is consistent with the present results. Neither of the mutations in Y402 nor in K457 inhibited EC proliferation and both of them attenuated ERK1/2 phosphorylation, suggesting that these mutations inhibited the signal transduction pathway of apoptosis induced by Pyk2. Activation of ERK1/2 occurs downstream of Src recruitment (32). It is possible that Src recruitment did not occur in ECs overexpressing the two Pyk2 mutants Pyk2Y402F and Pyk2K457A. Cell migration was stimulated not only by wild-type Pyk2 but also by Pyk2Y402F and not by Pyk2K457A, indicating that signaling through Pyk2 is involved in both cell proliferation and cell migration and that these two cellular functions are regulated through Pyk2 in different mechanisms.


    Footnotes
 
We thank Professor Izumu Saito for AxCA-LacZ and Ad5dlx, and Professor Yoh Takuwa for AxCA.

Abbreviations: CAKß, Cell adhesion kinase ß; CXCR4, CXC chemokine receptor 4; EC, endothelial cell; FAK, focal adhesion kinase; hMVECs-d, human dermal microvascular endothelial cells; hUVECs, human umbilical vascular endothelial cells; MOI, multiplicity of infection; pAb, polyclonal antibody; Pyk2, proline-rich tyrosine kinase 2; RT, room temperature; SDF-1{alpha}, stromal-derived factor-1{alpha}; TBS, Tris-buffered saline; TBS-T, Tris-buffered saline with Tween 20; VEGF, vascular endothelial growth factor.

Received October 23, 2003.

Accepted for publication April 2, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rollins BJ 1997 Chemokines. Blood 90:909–928[Free Full Text]
  2. Gupta SK, Lysko PG, Pillarisetti K, Ohlstein E, Stadel JM 1998 Chemokine receptors in human endothelial cells. Functional expression of CXCR4 and its transcriptional regulation by inflammatory cytokines. J Biol Chem 273:4282–4287[Abstract/Free Full Text]
  3. Salcedo R, Wasserman K, Young HA, Grimm MC, Howard OM, Anver MR, Kleinman HK, Murphy WJ, Oppenheim JJ 1999 Vascular endothelial growth factor and basic fibroblast growth factor induce expression of CXCR4 on human endothelial cells: in vivo neovascularization induced by stromalderived factor-1{alpha}. Am J Pathol 154:1125–1135[Abstract/Free Full Text]
  4. Ganju RK, Dutt P, Wu L, Newman W, Avraham H, Avraham S, Groopman JE 1998 ß-chemokine receptor CCR5 signals via the novel tyrosine kinase RAFTK. Blood 91:791–797[Abstract/Free Full Text]
  5. Cary LA, Chang JF, Guan JL 1996 Stimulation of cell migration by overexpression of focal adhesion kinase and its association with Src and Fyn. J Cell Sci 109:1787–1794[Abstract]
  6. Cary LA, Han DC, Polte TR, Hanks SK, Guan JL 1998 Identification of p130Cas as a mediator of focal adhesion kinase-promoted cell migration. J Cell Biol 140:211–221[Abstract/Free Full Text]
  7. Schaller MD, Hildebrand JD, Parsons JT 1999 Complex formation with focal adhesion kinase: a mechanism to regulate activity and subcellular localization of Src kinases. Mol Biol Cell 10:3489–3505[Abstract/Free Full Text]
  8. Panetti TS 2002 Tyrosine phosphorylation of paxillin, FAK, and p130CAS: effects on cell spreading and migration. Front Biosci 7:d143–d150
  9. Sasaki H, Nagura K, Ishino M, Tobioka H, Kotani K, Sasaki T 1995 Cloning and characterization of cell adhesion kinase ß, a novel protein-tyrosine kinase of the focal adhesion kinase subfamily. J Biol Chem 270:21206–21219[Abstract/Free Full Text]
  10. Schaller MD, Sasaki T 1997 Differential signaling by the focal adhesion kinase and cell adhesion kinase ß. J Biol Chem 272:25319–25325[Abstract/Free Full Text]
  11. Nakamura K, Yano H, Schaefer E, Sabe H 2001 Different modes and qualities of tyrosine phosphorylation of Fak and Pyk2 during epithelial-mesenchymal transdifferentiation and cell migration: analysis of specific phosphorylation events using site- directed antibodies. Oncogene 20:2626–2635[CrossRef][Medline]
  12. Derkinderen P, Siciliano J, Toutant M, Girault JA 1998 Differential regulation of FAK+ and PYK2/Cakß, two related tyrosine kinases, in rat hippocampal slices: effects of LPA, carbachol, depolarization and hyperosmolarity. Eur J Neurosci 10:1667–1675[CrossRef][Medline]
  13. Lev S, Moreno H, Martinez R, Canoll P, Peles E, Musacchio JM, Plowman GD, Rudy B, Schlessinger J 1995 Protein tyrosine kinase PYK2 involved in Ca(2+)-induced regulation of ion channel and MAP kinase functions. Nature 376:737–745[CrossRef][Medline]
  14. Berg NN, Ostergaard HL 1997 T cell receptor engagement induces tyrosine phosphorylation of FAK and Pyk2 and their association with Lck. J Immunol 159:1753–1757[Abstract]
  15. Du QS, Ren XR, Xie Y, Wang Q, Mei L, Xiong WC 2001 Inhibition of PYK2-induced actin cytoskeleton reorganization, PYK2 autophosphorylation and focal adhesion targeting by FAK. J Cell Sci 114:2977–2987
  16. Avraham H, Park SY, Schinkmann K, Avraham S 2000 RAFTK/Pyk2-mediated cellular signalling. Cell Signal 12:123–133[CrossRef][Medline]
  17. Sieg DJ, Ilic D, Jones KC, Damsky CH, Hunter T, Schlaepfer DD 1998 Pyk2 and Src-family protein-tyrosine kinases compensate for the loss of FAK in fibronectin-stimulated signaling events but Pyk2 does not fully function to enhance FAK-cell migration. Embo J 17:5933–5947[CrossRef][Medline]
  18. Nakaoka T, Kojima N, Ogita T, Tsuji S 1995 Characterization of the phosphatidylserine-binding region of rat MARCKS (myristoylated, alanine-rich protein kinase C substrate). Its regulation through phosphorylation of serine 152. J Biol Chem 270:12147–12151[Abstract/Free Full Text]
  19. Nakaoka T, Gonda K, Ogita T, Otawara-Hamamoto Y, Okabe F, Kira Y, Harii K, Miyazono K, Takuwa Y, Fujita T 1997 Inhibition of rat vascular smooth muscle proliferation in vitro and in vivo by bone morphogenetic protein-2. J Clin Invest 100:2824–2832[Medline]
  20. Saito I, Oya Y, Yamamoto K, Yuasa T, Shimojo H 1985 Construction of nondefective adenovirus type 5 bearing a 2.8-kilobase hepatitis B virus DNA near the right end of its genome. J Virol 54:711–719[Abstract/Free Full Text]
  21. Deguchi J, Namba T, Hamada H, Nakaoka T, Abe J, Sato O, Miyata T, Makuuchi M, Kurokawa K, Takuwa Y 1999 Targeting endogenous platelet-derived growth factor B-chain by adenovirus-mediated gene transfer potently inhibits in vivo smooth muscle proliferation after arterial injury. Gene Ther 6:956–965[CrossRef][Medline]
  22. Bleul CC, Fuhlbrigge RC, Casasnovas JM, Aiuti A, Springer TA 1996 A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). J Exp Med 184:1101–1109[Abstract/Free Full Text]
  23. Murdoch C, Monk PN, Finn A 1999 Cxc chemokine receptor expression on human endothelial cells. Cytokine 11:704–712[CrossRef][Medline]
  24. Ruhrberg C 2003 Growing and shaping the vascular tree: multiple roles for VEGF. Bioessays 25:1052–1060[CrossRef][Medline]
  25. Mirshahi F, Pourtau J, Li H, Muraine M, Trochon V, Legrand E, Vannier J, Soria J, Vasse M, Soria C 2000 SDF-1 activity on microvascular endothelial cells: consequences on angiogenesis in in vitro and in vivo models. Thromb Res 99:587–594[CrossRef][Medline]
  26. Schlaepfer DD, Hauck CR, Sieg DJ 1999 Signaling through focal adhesion kinase. Prog Biophys Mol Biol 71:435–478[CrossRef][Medline]
  27. Lipinski CA, Tran NL, Bay C, Kloss J, McDonough WS, Beaudry C, Berens ME, Loftus JC 2003 Differential role of proline-rich tyrosine kinase 2 and focal adhesion kinase in determining glioblastoma migration and proliferation. Mol Cancer Res 1:323–332[Abstract/Free Full Text]
  28. Xiong W, Parsons JT 1997 Induction of apoptosis after expression of PYK2, a tyrosine kinase structurally related to focal adhesion kinase. J Cell Biol 139:529–539[Abstract/Free Full Text]
  29. Tang H, Hao Q, Fitzgerald T, Sasaki T, Landon EJ, Inagami T 2002 Pyk2/CAKß tyrosine kinase activity-mediated angiogenesis of pulmonary vascular endothelial cells. J Biol Chem 277:5441–5447[Abstract/Free Full Text]
  30. Tokiwa G, Dikic I, Lev S, Schlessinger J 1996 Activation of Pyk2 by stress signals and coupling with JNK signaling pathway. Science 273:792–794[Abstract]
  31. Rocic P, Govindarajan G, Sabri A, Lucchesi PA 2001 A role for PYK2 in regulation of ERK1/2 MAP kinases and PI 3-kinase by ANG II in vascular smooth muscle. Am J Physiol Cell Physiol 280:C90–C99
  32. Dikic I, Tokiwa G, Lev S, Courtneidge SA, Schlessinger J 1996 A role for Pyk2 and Src in linking G-protein-coupled receptors with MAP kinase activation. Nature 383:547–550[CrossRef][Medline]
  33. Riggins RB, Quilliam LA, Bouton AH 2003 Synergistic promotion of c-Src activation and cell migration by Cas and AND-34/BCAR3. J Biol Chem 278:28264–28273[Abstract/Free Full Text]
  34. Liu B, Itoh H, Louie O, Kubota K, Kent KC 2002 The signaling protein Rho is necessary for vascular smooth muscle migration and survival but not for proliferation. Surgery 132:317–325[CrossRef][Medline]
  35. Klemke RL, Leng J, Molander R, Brooks PC, Vuori K, Cheresh DA 1998 CAS/Crk coupling serves as a "molecular switch" for induction of cell migration. J Cell Biol 140:961–972[Abstract/Free Full Text]
  36. Astier A, Manie SN, Avraham H, Hirai H, Law SF, Zhang Y, Golemis EA, Fu Y, Druker BJ, Haghayeghi N, Freedman AS, Avraham S 1997 The related adhesion focal tyrosine kinase differentially phosphorylates p130Cas and the Cas-like protein, p105HEF1. J Biol Chem 272:19719–19724[Abstract/Free Full Text]
  37. Sakai R, Nakamoto T, Ozawa K, Aizawa S, Hirai H 1997 Characterization of the kinase activity essential for tyrosine phosphorylation of p130Cas in fibroblasts. Oncogene 14:1419–1426[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. R. Anand, M. Cucchiarini, E. F. Terwilliger, and R. K. Ganju
The Tyrosine Kinase Pyk2 Mediates Lipopolysaccharide-Induced IL-8 Expression in Human Endothelial Cells
J. Immunol., April 15, 2008; 180(8): 5636 - 5644.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. R. Basile, T. Afkhami, and J. S. Gutkind
Semaphorin 4D/Plexin-B1 Induces Endothelial Cell Migration through the Activation of PYK2, Src, and the Phosphatidylinositol 3-Kinase-Akt Pathway
Mol. Cell. Biol., August 15, 2005; 25(16): 6889 - 6898.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuwabara, K.
Right arrow Articles by Yamashita, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuwabara, K.
Right arrow Articles by Yamashita, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals