help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-1727
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sindelar, D. K.
Right arrow Articles by Schwartz, M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sindelar, D. K.
Right arrow Articles by Schwartz, M. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*2-DEOXY-D-GLUCOSE
*GLUCAGON
Medline Plus Health Information
*Hypoglycemia
Endocrinology Vol. 145, No. 7 3363-3368
Copyright © 2004 by The Endocrine Society

Neuropeptide Y Is Required for Hyperphagic Feeding in Response to Neuroglucopenia

Dana K. Sindelar, Linda Ste. Marie, Grant I. Miura, Richard D. Palmiter, Julie E. McMinn, Gregory J. Morton and Michael W. Schwartz

Departments of Medicine (D.K.S., J.E.M., G.J.M., M.W.S.), Harborview Medical Center, Howard Hughes Medical Institute and Department of Biochemistry (L.S.M., G.I.M., R.D.P.), University of Washington, Seattle, Washington 98195

Address all correspondence and requests for reprints to: Michael W. Schwartz, M.D., Harborview Medical Center, Division of Endocrinology, 325 9th Avenue, Box 359757, Seattle, Washington 98104. E-mail: mschwart{at}u.washington.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To investigate the role played by the orexigenic peptide, neuropeptide Y (NPY), in adaptive responses to insulin-induced hypoglycemia, we measured hypothalamic, feeding, and hormonal responses to this stimulus in both wild-type (Npy+/+) and NPY-deficient (Npy–/–) mice. After administration of insulin at a dose (60 mU ip) sufficient to cause moderate hypoglycemia (plasma glucose levels, 40 ± 3 and 37 ± 2 mg/dl for Npy+/+ and Npy–/– mice, respectively; P = not significant), 4-h food intake was increased 2.5-fold in Npy+/+ mice relative to saline-injected controls. By comparison, the increase of intake in Npy–/– mice was far smaller (45%) and did not achieve statistical significance (P = 0.08). Hyperphagic feeding in response to insulin-induced hypoglycemia was therefore markedly attenuated in mice lacking NPY, and a similar feeding deficit was detected in these animals after neuroglucopenia induced by 2-deoxyglucose (500 mg/kg ip). A role for NPY in glucoprivic feeding is further supported by our finding that Npy mRNA content (measured by real-time PCR) increased 2.4-fold in the hypothalamus of Npy+/+ mice by 7 h after insulin injection. Unlike the feeding deficits observed in mice lacking NPY, the effect of hypoglycemia to increase plasma glucagon and corticosterone levels was fully intact in these animals, as were both the nadir glucose value and time to recovery of euglycemia after insulin injection (P = not significant). We conclude that NPY signaling is required for hyperphagic feeding, but not neuroendocrine responses to moderate hypoglycemia.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TO DEFEND AGAINST the threat of hypoglycemia, a highly integrated set of adaptive responses is activated when brain glucose delivery falls below a critical threshold. These include increases of both food intake (1, 2, 3) and the secretion of counterregulatory hormones (e.g. glucagon, corticosteroids, GH, and catecholamines) that, together, serve to restore normal plasma glucose concentrations and brain glucose delivery (4, 5, 6, 7). Although the behavioral and neuroendocrine responses to hypoglycemia are well described in both humans and rodent models, the neuronal pathways and signaling molecules that mediate these responses are only beginning to be understood.

Recent findings from Ritter et al. (8) suggest that, in response to a glucopenic stimulus, catecholaminergic cell groups within the hindbrain are activated and, via projections to key regulatory areas within the forebrain and spinal cord, initiate adaptive responses to this stress. Among several areas innervated by these hindbrain catecholaminergic neurons is the arcuate nucleus (ARC) (9), a key hypothalamic area for food intake regulation (10). Neuropeptide Y (NPY) is a potent orexigenic peptide (11) that is synthesized primarily by a subset of ARC neurons (12, 13) that coexpress agouti-related peptide (AgRP, an endogenous antagonist of neuronal melanocortin receptors) (14) and are activated within 30 min of a hypoglycemic stimulus (15). Using immunotoxic lesioning, Fraley et al. (16) recently reported that the ability of glucopenia to activate NPY/AgRP neurons in the ARC depends on input from hindbrain catecholamine neurons. If, as these findings suggest, NPY-containing neurons in the ARC are downstream targets of a central autonomic circuit activated by hypoglycemia, such neurons are logical candidates to mediate the hyperphagic response to this stress. This hypothesis is supported by evidence that glucopenic feeding is attenuated by pharmacological blockade of NPY signaling (17, 18).

The current studies were undertaken to critically test the contribution made by NPY to glucoprivic feeding in mice. We first sought to determine whether the induction of hypothalamic Npy gene expression reported in rats after insulin-induced hypoglycemia (15, 16) occurs in mice as well. To determine whether NPY signaling is necessary for hyperphagia or other responses to this stimulus, we measured food intake and plasma levels of corticosterone and glucagon after insulin-induced hypoglycemia in wild-type and NPY-deficient mice. Our findings demonstrate that hypothalamic Npy gene expression increases in response to moderate hypoglycemia in normal mice, and that glucoprivic feeding is markedly attenuated in mice lacking NPY. In contrast, neither the increase of plasma glucagon and corticosterone levels induced by hypoglycemia nor the time to recovery of euglycemia were altered by NPY deficiency. Together, these findings suggest that NPY is a key mediator of hyperphagic, but not neuroendocrine, responses to hypoglycemia.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Adult male and female mice (pure 129 /SvEv background) with targeted knockout of the Npy gene (Npy–/–) or wild-type (Npy+/+) littermates were housed in individual cages in standard vivarium conditions (12-h light, 12-h dark cycle) with standard rodent chow (Harlan Teklad Rodent Diet, Purina, Madison, WI) provided ad libitum unless otherwise noted. Drinking water was available ad libitum at all times. All study protocols were approved by the University of Washington Institutional Animal Care and Use Committee.

Effect of hypoglycemia on hypothalamic neuropeptide mRNA content
Seven hours after ip injection of either saline or insulin at a dose (60 mU; Humulin R, Lilly, Indianapolis, IN) designed to induce moderate hypoglycemia, male Npy–/– and Npy+/+ mice (n = 8–10/group) were decapitated after brief exposure to CO2 and brains removed and frozen under powdered dry ice. Food was freely available to mice both before and after injection. The hypothalamus (defined caudally by the mammillary bodies, rostrally by the optic chiasm, laterally by the optic tract, and superiorly by the apex of the hypothalamic third ventricle) was removed, RNA was extracted using RNAzol B (Tel-Test Inc., Friendswood, TX), and 1 µg RNA was reverse-transcribed using AMV reverse transcriptase (10 U) (Promega, Madison, WI). Primers were optimized for mRNA encoding Npy, Agrp, Pomc, Mch, Hcrt, and Gapdh and are listed below: Npy: forward, 5' accaggcagagatatggcaaga 3'; reverse, 5' ggacattttctgtgctttctctcatta 3'; Agrp: forward, 5' agggcatcagaaggcctgaccagg 3'; reverse, 5'cattgaagaagcggcagtagcacgt 3'; Pomc: forward, 5'cgctcctactctatggagcactt 3'; reverse, 5' tcacctaccagctccctcttg 3'; Mch: forward, 5' ccagctgagaatggagttcaga 3'; reverse, 5' gtcggtagactcttcccagcat 3'; Hcrt: forward, 5' gccgtctctacgaactgttgc 3'; reverse, 5' cgctttcccagagtcaggata 3'; Gapdh: forward, 5' aacgaccccttcattgac 3'; reverse, 5' tccacgacatactcagcac 3'. PCR was performed on a LightCycler (Roche Molecular Biochemicals, Indianapolis, IN) using a 50-ng sample of hypothalamic cDNA added to the commercially available LightCycler PCR master mix (FastStart DNA Master SYBR Green I, Roche Molecular Biochemicals). Neuropeptide mRNA expression levels were normalized to Gapdh mRNA content and expressed as a percent of the mean value of saline-treated controls for each genotype. Nontemplate controls were incorporated into each experiment.

Feeding and neuroendocrine responses to neuroglucopenia
Four hours after onset of the light cycle (a time when spontaneous food intake is low), male Npy–/– and Npy+/+ mice received an injection of either saline or the same dose of insulin (60 mU ip) used in the previous study, and food intake over the subsequent 4-h period was measured. Food was freely available to all mice both before and after injection. Because of the small amount of food consumed by mice over a 4-h interval, and because of variability inherent in this feeding response, nine replicates of this experiment were performed in three different groups of mice (n = 8–10 per group for each replicate). Food intake data were pooled for comparison of mean values across all studies.

Blood sampling
All blood samples were obtained from unanesthetized mice of both genotypes. Blood samples for glucose determinations (10–50 µl) were taken from either the retro-orbital sinus or saphenous vein (n = 9–14 animals/group) at various time points (30–120 min) after saline or insulin injection. Samples for measurement of glucagon (50–100 µl plasma) or corticosterone (30 µl plasma) were obtained from the saphenous vein of different subsets of mice of each genotype. To avoid potentially confounding effects, blood was sampled from groups of animals separate from those in which food intake was measured. In all studies, food was freely available to mice from which blood samples were obtained.

2-Deoxyglucose (2-DG)-induced feeding
Two hours after light cycle onset, female Npy–/– and Npy+/+ mice received ip injections of either saline or saline containing 500 mg/kg 2-DG at 10 µl/g body weight. Food was freely available at all times, and intake was recorded hourly thereafter for 4 h.

Plasma assays
Heparinized plasma was separated by centrifugation and stored at –70 C until assay. Plasma glucose was determined by the glucose oxidase method (Beckman Instruments, Brea, CA). Plasma glucagon levels were determined by RIA (Linco, Indianapolis, IN). Plasma corticosterone levels were determined using the OTECIA assay kit (Alpco Diagnostics, Windham, NH). To determine the time course of recovery to euglycemia, blood glucose concentrations were determined using a hand-held glucose meter (Hemocue Blood Glucose Analyzer, Lake Forest, CA).

Statistics
All values are reported as group mean ± SEM. The level of significance was P ≤ 0.05. Two-group comparisons were made by two-tailed Student’s’ t test. Comparisons of mean values from studies involving more than two groups were performed using one-way ANOVA or by two-way ANOVA to compare responses between genotypes.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effect of hypoglycemia on hypothalamic neuropeptide mRNA content
As depicted in Fig. 1AGo, plasma glucose levels measured 45 min after insulin injection (60 mU) were reduced similarly in Npy+/+ and Npy–/– mice [Npy+/+, 40 ± 3 mg/dl; Npy–/–, 37 ± 2 mg/dl; P = NS (not significant)] relative to saline-injected controls (Npy+/+, 113 ± 9 mg/dl; Npy–/–, 137 ± 8 mg/dl; P = NS). In wild-type mice, insulin-induced hypoglycemia was associated with a 2.4-fold increase in hypothalamic Npy mRNA content (P < 0.05 vs. saline-treated controls; Fig. 1BGo), as determined by real-time PCR on samples obtained 7 h after injection. By comparison, hypothalamic levels of mRNA encoding Pomc, Mch, Hcrt, and Agrp were not significantly altered by this intervention at this time point. As expected, Npy mRNA was not detected in the hypothalamus of Npy–/– mice and, as in wild-type mice, insulin-induced hypoglycemia did not significantly alter mRNA content of the other neuropeptides tested (Fig. 1CGo).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 1. Effect of insulin-induced hypoglycemia on hypothalamic neuropeptide gene expression in Npy+/+ and Npy–/– mice. A, Plasma glucose values measured 45 min after insulin (60 mU ip) or saline injections in male Npy+/+ and Npy–/– mice (n = 8–10/group); B and C, hypothalamic levels of mRNA encoding five feeding-related neuropeptides (expressed relative to Gapdh) as measured by real-time PCR in (B) Npy+/+ and (C) Npy–/– mice. Data are means ± SEM. *, P ≤ 0.05 vs. saline. veh, Vehicle; ins, insulin.

 
Feeding responses to neuroglucopenic stimuli
Despite comparable hypoglycemia (Fig. 1AGo), food intake measured 4 h after insulin injection was sharply attenuated in NPY-deficient, relative to wild-type, mice (Fig. 2Go). In Npy+/+ animals, food intake during the 4 h after insulin injection increased by 2.5-fold relative to saline-injected controls (0.49 ± 0.03 g vs. 0.20 ± 0.03 g; P ≤ 0.001). By comparison, insulin-injected Npy–/– mice increased their intake by only 45% beyond that consumed by saline controls (0.25 ± 0.03 g vs. 0.17 ± 0.03 g) during this 4-h period, an effect that did not reach statistical significance (P = 0.08). Thus, the effect of hypoglycemia to increase food intake was strongly attenuated in mice lacking NPY [F (3, 125) = 23.473; P < 0.001].



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 2. Feeding response of Npy+/+ and Npy–/– mice to glucopenic stimuli. A, Four-hour food intake in male Npy+/+ and Npy–/– mice after ip injection of either insulin (60 mU) or saline. The data are the means of three separate experiments, with 8–10 mice of each genotype in each experiment; *, P ≤ 0.05 vs. saline; {dagger}, P ≤ 0.05 vs. Npy –/– insulin. B, Two- and 4-h food intake after administration of either saline or 2-DG to female Npy+/+ and Npy–/– mice. Data are means ± SEM of two independent 2-DG and two independent saline experiments, with n = 7–9 animals/genotype in each experiment. *, P ≤ 0.05 vs. Npy +/+ PBS; {dagger}, P ≤ 0.05 vs. Npy –/– 2-DG.

 
2-DG-induced feeding
During the first 2 h after systemic administration of 2-DG (500 mg/kg, ip) to Npy+/+ mice, food intake increased by more than 2-fold compared with the amount consumed by vehicle-injected controls, whereas no significant change in intake was detected in Npy–/– mice (Fig. 2BGo). At 4 h post injection, food intake remained elevated above vehicle control values in Npy+/+ mice and was greater than the amount consumed by Npy–/– animals, although this difference was no longer statistically significant (P = 0.08).

Glucagon and corticosterone responses to hypoglycemia and recovery of normal blood glucose levels
Unlike their attenuated feeding response, the increase of plasma glucagon levels, 1 h after injection of the same insulin dose (60 mU ip), was fully intact in NPY-deficient mice compared with wild-type controls (335 ± 35 pg/ml vs. 320 ± 20 pg/ml, Npy+/+ vs. Npy–/–; P = NS) (Fig. 3AGo). Compared with saline injection, glucagon levels increased significantly (by 1.5- to 2-fold) during hypoglycemia in both groups of mice, and there was no genotype difference in the magnitude of this response. Similarly, the potent effect of insulin-induced hypoglycemia to raise plasma corticosterone levels was fully intact in both NPY-deficient and wild-type mice (corticosterone, 421 ± 35 ng/ml vs. 364 ± 30 ng/ml, Npy+/+ vs. Npy–/–; P = NS) and resulted in plasma values 3- to 4-fold higher than were detected after saline injection (140 ± 26 ng/ml vs. 100 ± 22 ng/ml, Npy+/+ vs. Npy–/–; P = NS) (Fig. 3BGo). To determine whether NPY deficiency influences either the magnitude of hypoglycemia or the time course over which euglycemia is restored after the same dose of insulin (60 mU ip), blood glucose levels were determined at baseline and at 30-min intervals after insulin injection in both Npy+/+ and Npy–/– mice provided unrestricted access to chow. As shown in Fig. 3CGo, there was no significant difference between genotypes in either the nadir glucose value or the time to recovery of baseline glucose. Although blood glucose levels tended to increase more rapidly in wild-type mice during the final 60 min of the study, this effect did not achieve statistical significance.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 3. Counterregulatory hormone levels and time to recovery of euglycemia after insulin-induced hypoglycemia. A, Plasma glucagon levels in male Npy+/+ and Npy–/– mice obtained 1 h after injection of either insulin (60 mU ip) or saline. There was no significant effect of genotype on the glucagon response. *, P ≤ 0.05. B, Plasma corticosterone levels in male Npy+/+ and Npy–/– mice obtained both before and 1 h after injection of either insulin (60 mU ip) or saline. There was no significant effect of genotype on the corticosterone response. *, P ≤ 0.05 vs. 0 min; {dagger}, P ≤ 0.05 vs. vehicle 60 min. C, Time course of changes in blood glucose concentrations after injection of insulin (60 mU, ip) in male Npy+/+ and Npy–/– mice provided with free access to food. Blood glucose concentrations were not significantly different between genotypes at any time point.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To gain a better understanding of mechanisms used in the defense against hypoglycemia, we investigated the role played by NPY in both feeding and neuroendocrine responses to this stimulus. In accordance with previous work in rats (19), we found that hypothalamic expression of the gene encoding Npy was increased 2.4-fold by modest, insulin-induced hypoglycemia in normal mice, suggesting that hypothalamic NPY signaling increases in response to this stimulus. Moreover, we demonstrated a marked attenuation of hyperphagia induced by either insulin-induced hypoglycemia or 2-DG in mice lacking NPY, findings that implicate NPY as an essential mediator of glucopenic feeding. In contrast, neither the increase in plasma levels of glucagon and corticosterone, key hormonal mediators of the recovery of normal blood glucose levels, nor the time to recovery of euglycemia after insulin-induced hypoglycemia were affected by NPY deficiency. Collectively, these findings suggest that NPY signaling plays an essential role in the hyperphagic feeding, but not neuroendocrine responses, induced by hypoglycemia.

The mechanism whereby hypothalamic NPY neurons are activated by hypoglycemia is an area of active study. The hypothesis that these neurons sense and respond directly to changes of ambient glucose levels is supported by in vitro evidence that NPY-containing neurons in the ARC are activated by rapid, marked reductions in ambient glucose concentrations (20), and that these neurons coexpress glucokinase, a hexokinase found exclusively in glucose-responsive cells (21). Combined with studies in rats showing activation of NPY neurons in response to 2-DG administration in vivo (15, 19), ARC NPY neurons could potentially sense and respond directly to glucopenic stimuli. Activation by glucopenia of hypothalamic NPY neurons can also involve indirect mechanisms, however, and growing evidence suggests that ARC NPY neurons are downstream components of a neuronal circuit that originates in the hindbrain and is activated by glucopenia. For example, selective lesioning of hindbrain catecholaminergic neurons that innervate the ARC (by microinjection into the ARC of an immunotoxin that is specific for catecholaminergic cells) was recently shown to impair glucopenia-induced increases of both food intake and hypothalamic Npy gene expression in rats (16). This observation supports evidence (8) that activation of catecholamine cell groups projecting to forebrain areas (such as the ARC or paraventricular nucleus) involved in the control of food intake, endocrine function, and autonomic outflow serve as critical mediators of the response to reduced glucose availability.

Although studies using an immunotoxin-based strategy clearly implicate hindbrain catecholamine cell groups in the response of ARC neurons to glucopenia, these findings do not address the importance of NPY in comparison with other potential mediators of glucopenic feeding. To address this issue, we determined the impact of targeted deletion of the Npy gene on this feeding response. Our finding that glucopenic feeding is strongly attenuated in NPY-deficient mice provides clear evidence that the effect of hypoglycemia to increase food intake is, to a large extent, NPY-dependent. Although glucoprivic feeding likely involves NPY-independent mechanisms as well (e.g. inhibition of synaptic release of melanocortins) (22), our findings suggest that the integrity of this response is highly dependent on the actions of NPY.

Our finding that insulin-induced hypoglycemia increases hypothalamic expression of Npy mRNA in normal mice supports a model in which increased hypothalamic NPY signaling plays a central role in glucopenic feeding. This finding is also in agreement with a study in rats showing that 2-DG administration rapidly increases hypothalamic Npy mRNA content (19). Unlike our findings, however, hypothalamic levels of Mch and Agrp mRNA were also increased in that study (19). Similarly, Fraley et al. (16) reported that expression of both Npy and Agrp mRNA increase rapidly in rat hypothalamus after administration of 2-DG. Among several factors that might explain disparities between the relatively specific increase of Npy mRNA in our study and the findings of others are differences in animal model (mouse vs. rat), timing of tissue collection (7 h vs. 2 h), method of glucopenia induction (insulin vs. 2-DG), and magnitude of the glucopenic stimulus. Whether one or more of these disparities underlies differences between our findings and those of others requires additional study. With the exception of undetectable levels of Npy mRNA, the pattern of hypothalamic neuropeptide gene expression observed in Npy–/– mice subjected to hypoglycemia was similar to that of wild-type controls. The attenuation of glucopenic feeding in mice lacking NPY is therefore unlikely to involve recruitment of hypothalamic responses distinct from those activated in normal mice.

Although NPY/AgRP neurons in the ARC are clearly implicated in the control of food intake, NPY-containing neurons in other brain areas also warrant consideration in the interpretation of our findings. Specifically, many hindbrain catecholaminergic neurons that are activated by glucopenia express NPY as well as catecholamines (23), and these neurons innervate not only the ARC (24) but also the paraventricular nucleus (9, 12, 25), a brain area that is exquisitely sensitive to NPY-induced feeding (11). Moreover, the finding that decerebrate rats increase their intake of a liquid meal (provided intraorally) in response to glucopenia even though all connections between forebrain and hindbrain are severed (26) suggests that structures within the hindbrain are sufficient to generate glucopenic feeding responses. These considerations, combined with our current data, raise the possibility that a subset of hindbrain neurons containing both catecholamines and NPY mediate NPY-dependent feeding in response to glucopenia, and that attenuated hyperphagia in Npy–/– mice is due, in part, to the absence of NPY from these hindbrain neurons. This hypothesis is strengthened by evidence that, although hindbrain catecholaminergic neurons appear to be essential for the hyperphagia after hypoglycemia (8, 16), norepinephrine and epinephrine are not (27). Other transmitters produced by these neurons, such as NPY (25), are therefore implicated in the hyperphagic response. Whether NPY neurons in the ARC, the hindbrain, or both are critical mediators of the hyperphagic response to neuroglucopenia warrants additional study.

The first line of defense against hypoglycemia involves the secretion of counterregulatory hormones, such as glucagon and corticosterone, that increase hepatic glucose production, impair insulin-stimulated glucose uptake, and ultimately restore low blood glucose concentrations to their normal value. Although a large literature implicates NPY in the physiological control of food intake, less information is available to suggest an important role for this neuropeptide in counterregulatory hormonal responses to hypoglycemia. For this reason, we anticipated that the neuroendocrine response to hypoglycemia would not be affected by NPY deficiency. Our finding that plasma glucagon and corticosterone responses to hypoglycemia are intact in Npy–/– mice fits with this prediction and supports the conclusion that NPY is not required for glucopenia-induced secretion of these hormones. Because food was freely available to mice employed for these studies, differences in food consumption could conceivably have masked an effect of NPY deficiency on counterregulatory responses, and additional studies are warranted to address this possibility. Together with our finding that NPY deficiency does not substantially alter the recovery of euglycemia after insulin administration, we conclude that neuronal pathways controlling neuroendocrine responses to hypoglycemia must be distinct from those driving food intake, because the latter, but not the former, are NPY-dependent.


    Acknowledgments
 
The authors appreciate the excellent technical help received from Ruth Hollingworth and Jira Wade and input on the manuscript provided by Drs. Gerald J. Taborsky and Dianne Lattemann.


    Footnotes
 
This work was supported by National Institutes of Health (NIH) Grants DK 52989, NS 32273, and DK12829 (to M.W.S.), and DK 17844 (to S.C.W.). D.K.S. is supported by National Research Service Award (NRSA) fellowship DK 09932–02, and L.S.M. by NRSA T 32 GM 07270, from the NIH. G.J.M. is supported by a mentor-based fellowship from the American Diabetes Association awarded to M.W.S.

Current address for D.K.S.: Endocrine Division, Eli Lilly & Co., Corporate Center, Drop 0545, Indianapolis, Indiana 46285.

Current address for J.E.M.: Columbia University College of Physicians and Surgeons,1150 St. Nicholas Avenue, 6th Floor, New York, New York 10032.

Abbreviations: AgRP, Agouti-related peptide; ARC, arcuate nucleus; 2-DG, 2-deoxyglucose; NPY, neuropeptide Y; NS, not significant.

Received December 22, 2003.

Accepted for publication March 23, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ritter RC, Slusser P 1980 5-Thio-D-glucose causes increased feeding and hyperglycemia in the rat. Am J Physiol 238:E141–E144
  2. Ritter S 1986 Food intake: neural and humoral controls. In: Ritter RC, Ritter S, Barnes CD, eds. Glucoprivic and the glucoprivic control of food intake. Orlando, FL: Academic; 268–299
  3. Smith GP, Epstein AN 1969 Increased feeding in response to decreased glucose utilization in the rat and monkey. Am J Physiol 217:1083–1087[Free Full Text]
  4. Garber AJ, Cryer PE, Santiago JV, Haymond MW, Pagliara AS, Kipnis DM 1976 The role of adrenergic mechanisms in the substrate and hormonal response to insulin-induced hypoglycemia in man. J Clin Invest 58:7–15
  5. Gerich J, Davis J, Lorenzi M, Rizza R, Bohannon N, Karam J, Lewis S, Kaplan R, Schultz T, Cryer P 1979 Hormonal mechanisms of recovery from insulin-induced hypoglycemia in man. Am J Physiol 236:E380–E385
  6. Rizza RA, Cryer PE, Gerich JE 1979 Role of glucagon, catecholamines, and growth hormone in human glucose counterregulation. Effects of somatostatin and combined {alpha}- and ß-adrenergic blockade on plasma glucose recovery and glucose flux rates after insulin-induced hypoglycemia. J Clin Invest 64:62–71
  7. Santiago JV, Clarke WL, Shah SD, Cryer PE 1980 Epinephrine, norepinephrine, glucagon, and growth hormone release in association with physiological decrements in the plasma glucose concentration in normal and diabetic man. J Clin Endocrinol Metab 51:877–883[Abstract/Free Full Text]
  8. Ritter S, Bugarith K, Dinh TT 2001 Immunotoxic destruction of distinct catecholamine subgroups produces selective impairment of glucoregulatory responses and neuronal activation. J Comp Neurol 432:197–216[CrossRef][Medline]
  9. Sawchenko PE, Swanson LW 1982 The organization of noradrenergic pathways from the brainstem to the paraventricular and supraoptic nuclei in the rat. Brain Res 257:275–325[Medline]
  10. Saper CB, Chou TC, Elmquist JK 2002 The need to feed: homeostatic and hedonic control of eating. Neuron 36:199–211[CrossRef][Medline]
  11. Stanley BG, Kyrkouli SE, Lampert S, Leibowitz SF 1986 Neuropeptide Y chronically injected into the hypothalamus: a powerful neurochemical inducer of hyperphagia and obesity. Peptides 7:1189–1192[CrossRef][Medline]
  12. Chronwall BM, DiMaggio DA, Massari VJ, Pickel VM, Ruggiero DA, O’Donohue TL 1985 The anatomy of neuropeptide-Y-containing neurons in rat brain. Neuroscience 15:1159–1181[CrossRef][Medline]
  13. Morris BJ 1989 Neuronal localization of neuropeptide Y gene expression in rat brain. J Comp Neurol 290:358–368[CrossRef][Medline]
  14. Hahn TM, Breininger JF, Baskin DG, Schwartz MW 1998 Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nat Neurosci 1:271–272[CrossRef][Medline]
  15. Minami S, Kamegai J, Sugihara H, Suzuki N, Higuchi H, Wakabayashi I 1995 Central glucoprivation evoked by administration of 2-deoxy-D-glucose induces expression of the c-fos gene in a subpopulation of neuropeptide Y neurons in the rat hypothalamus. Brain Res Mol Brain Res 33:305–310[Medline]
  16. Fraley GS, Ritter S 2003 Immunolesion of norepinephrine and epinephrine afferents to medial hypothalamus alters basal and 2-deoxy-D-glucose-induced neuropeptide Y and agouti gene-related protein messenger ribonucleic acid expression in the arcuate nucleus. Endocrinology 144:75–83[Abstract/Free Full Text]
  17. He B, White BD, Edwards GL, Martin RJ 1998 Neuropeptide Y antibody attenuates 2-deoxy-D-glucose induced feeding in rats. Brain Res 781:348–350[CrossRef][Medline]
  18. Criscione L, Rigollier P, Batzl-Hartmann C, Rueger H, Stricker-Krongrad A, Wyss P, Brunner L, Whitebread S, Yamaguchi Y, Gerald C, Heurich RO, Walker MW, Chiesi M, Schilling W, Hofbauer KG, Levens N 1998 Food intake in free-feeding and energy-deprived lean rats is mediated by the neuropeptide Y5 receptor. J Clin Invest 102:2136–2145[Medline]
  19. Sergeyev V, Broberger C, Gorbatyuk O, Hokfelt T 2000 Effect of 2-mercaptoacetate and 2-deoxy-D-glucose administration on the expression of NPY, AGRP, POMC, MCH and hypocretin/orexin in the rat hypothalamus. Neuroreport 11:117–121[Medline]
  20. Muroya S, Yada T, Shioda S, Takigawa M 1999 Glucose-sensitive neurons in the rat arcuate nucleus contain neuropeptide Y. Neurosci Lett 264:113–116[CrossRef][Medline]
  21. Lynch RM, Tompkins LS, Brooks HL, Dunn-Meynell AA, Levin BE 2000 Localization of glucokinase gene expression in the rat brain. Diabetes 49:693–700[Abstract]
  22. Ibrahim N, Bosch MA, Smart JL, Qiu J, Rubinstein M, Ronnekleiv OK, Low MJ, Kelly MJ 2003 Hypothalamic proopiomelanocortin neurons are glucose responsive and express K(ATP) channels. Endocrinology 144:1331–1340[Abstract/Free Full Text]
  23. Tseng CJ, Lin HC, Wang SD, Tung CS 1993 Immunohistochemical study of catecholamine enzymes and neuropeptide Y (NPY) in the rostral ventrolateral medulla and bulbospinal projection. J Comp Neurol 334:294–303[CrossRef][Medline]
  24. Guy J, Pelletier G 1988 Neuronal interactions between neuropeptide Y (NPY) and catecholaminergic systems in the rat arcuate nucleus as shown by dual immunocytochemistry. Peptides 9:567–570[CrossRef][Medline]
  25. Sawchenko PE, Swanson LW, Grzanna R, Howe PR, Bloom SR, Polak JM 1985 Colocalization of neuropeptide Y immunoreactivity in brainstem catecholaminergic neurons that project to the paraventricular nucleus of the hypothalamus. J Comp Neurol 241:138–153[CrossRef][Medline]
  26. Flynn FW, Grill HJ 1983 Insulin elicits ingestion in decerebrate rats. Science 221:188–190[Abstract/Free Full Text]
  27. Ste Marie L, Palmiter RD 2003 Norepinephrine and epinephrine-deficient mice are hyperinsulinemic and have lower blood glucose. Endocrinology 144:4427–4432[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Neurosci.Home page
A. A. Dunn-Meynell, N. M. Sanders, D. Compton, T. C. Becker, J.-i. Eiki, B. B. Zhang, and B. E. Levin
Relationship among Brain and Blood Glucose Levels and Spontaneous and Glucoprivic Feeding
J. Neurosci., May 27, 2009; 29(21): 7015 - 7022.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Sajapitak, K. Iwata, M. Shahab, Y. Uenoyama, S. Yamada, M. Kinoshita, F. Y. Bari, H. I'Anson, H. Tsukamura, and K.-i. Maeda
Central Lipoprivation-Induced Suppression of Luteinizing Hormone Pulses Is Mediated by Paraventricular Catecholaminergic Inputs in Female Rats
Endocrinology, June 1, 2008; 149(6): 3016 - 3024.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Fuzesi, G. Wittmann, Z. Liposits, R. M. Lechan, and C. Fekete
Contribution of Noradrenergic and Adrenergic Cell Groups of the Brainstem and Agouti-Related Protein-Synthesizing Neurons of the Arcuate Nucleus to Neuropeptide-Y Innervation of Corticotropin-Releasing Hormone Neurons in Hypothalamic Paraventricular Nucleus of the Rat
Endocrinology, November 1, 2007; 148(11): 5442 - 5450.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. M. Kamiji and A. Inui
Neuropeptide Y Receptor Selective Ligands in the Treatment of Obesity
Endocr. Rev., October 1, 2007; 28(6): 664 - 684.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Acosta-Martinez and J. E. Levine
Regulation of KATP channel subunit gene expression by hyperglycemia in the mediobasal hypothalamus of female rats
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1801 - E1807.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Arumugam, D. Fleenor, and M. Freemark
Lactogenic and Somatogenic Hormones Regulate the Expression of Neuropeptide Y and Cocaine- and Amphetamine-Regulated Transcript in Rat Insulinoma (INS-1) Cells: Interactions with Glucose and Glucocorticoids
Endocrinology, January 1, 2007; 148(1): 258 - 267.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
H. R. Patel, Y. Qi, E. J. Hawkins, S. M. Hileman, J. K. Elmquist, Y. Imai, and R. S. Ahima
Neuropeptide Y Deficiency Attenuates Responses to Fasting and High-Fat Diet in Obesity-Prone Mice
Diabetes, November 1, 2006; 55(11): 3091 - 3098.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
B Beck
Neuropeptide Y in normal eating and in genetic and dietary-induced obesity
Phil Trans R Soc B, July 29, 2006; 361(1471): 1159 - 1185.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A.-J. Li, Q. Wang, and S. Ritter
Differential Responsiveness of Dopamine-{beta}-Hydroxylase Gene Expression to Glucoprivation in Different Catecholamine Cell Groups
Endocrinology, July 1, 2006; 147(7): 3428 - 3434.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Ste. Marie, S. Luquet, T. B. Cole, and R. D. Palmiter
Modulation of neuropeptide Y expression in adult mice does not affect feeding
PNAS, December 20, 2005; 102(51): 18632 - 18637.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Bugarith, T. T. Dinh, A.-J. Li, R. C. Speth, and S. Ritter
Basomedial Hypothalamic Injections of Neuropeptide Y Conjugated to Saporin Selectively Disrupt Hypothalamic Controls of Food Intake
Endocrinology, March 1, 2005; 146(3): 1179 - 1191.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
G. N. Wade and J. E. Jones
Neuroendocrinology of nutritional infertility
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2004; 287(6): R1277 - R1296.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. W. Gelling, J. Overduin, C. D. Morrison, G. J. Morton, R. S. Frayo, D. E. Cummings, and M. W. Schwartz
Effect of Uncontrolled Diabetes on Plasma Ghrelin Concentrations and Ghrelin-Induced Feeding
Endocrinology, October 1, 2004; 145(10): 4575 - 4582.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sindelar, D. K.
Right arrow Articles by Schwartz, M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sindelar, D. K.
Right arrow Articles by Schwartz, M. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*2-DEOXY-D-GLUCOSE
*GLUCAGON
Medline Plus Health Information
*Hypoglycemia


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals