| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Departments of Medicine (D.K.S., J.E.M., G.J.M., M.W.S.), Harborview Medical Center, Howard Hughes Medical Institute and Department of Biochemistry (L.S.M., G.I.M., R.D.P.), University of Washington, Seattle, Washington 98195
Address all correspondence and requests for reprints to: Michael W. Schwartz, M.D., Harborview Medical Center, Division of Endocrinology, 325 9th Avenue, Box 359757, Seattle, Washington 98104. E-mail: mschwart{at}u.washington.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recent findings from Ritter et al. (8) suggest that, in response to a glucopenic stimulus, catecholaminergic cell groups within the hindbrain are activated and, via projections to key regulatory areas within the forebrain and spinal cord, initiate adaptive responses to this stress. Among several areas innervated by these hindbrain catecholaminergic neurons is the arcuate nucleus (ARC) (9), a key hypothalamic area for food intake regulation (10). Neuropeptide Y (NPY) is a potent orexigenic peptide (11) that is synthesized primarily by a subset of ARC neurons (12, 13) that coexpress agouti-related peptide (AgRP, an endogenous antagonist of neuronal melanocortin receptors) (14) and are activated within 30 min of a hypoglycemic stimulus (15). Using immunotoxic lesioning, Fraley et al. (16) recently reported that the ability of glucopenia to activate NPY/AgRP neurons in the ARC depends on input from hindbrain catecholamine neurons. If, as these findings suggest, NPY-containing neurons in the ARC are downstream targets of a central autonomic circuit activated by hypoglycemia, such neurons are logical candidates to mediate the hyperphagic response to this stress. This hypothesis is supported by evidence that glucopenic feeding is attenuated by pharmacological blockade of NPY signaling (17, 18).
The current studies were undertaken to critically test the contribution made by NPY to glucoprivic feeding in mice. We first sought to determine whether the induction of hypothalamic Npy gene expression reported in rats after insulin-induced hypoglycemia (15, 16) occurs in mice as well. To determine whether NPY signaling is necessary for hyperphagia or other responses to this stimulus, we measured food intake and plasma levels of corticosterone and glucagon after insulin-induced hypoglycemia in wild-type and NPY-deficient mice. Our findings demonstrate that hypothalamic Npy gene expression increases in response to moderate hypoglycemia in normal mice, and that glucoprivic feeding is markedly attenuated in mice lacking NPY. In contrast, neither the increase of plasma glucagon and corticosterone levels induced by hypoglycemia nor the time to recovery of euglycemia were altered by NPY deficiency. Together, these findings suggest that NPY is a key mediator of hyperphagic, but not neuroendocrine, responses to hypoglycemia.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Effect of hypoglycemia on hypothalamic neuropeptide mRNA content
Seven hours after ip injection of either saline or insulin at a dose (60 mU; Humulin R, Lilly, Indianapolis, IN) designed to induce moderate hypoglycemia, male Npy–/– and Npy+/+ mice (n = 8–10/group) were decapitated after brief exposure to CO2 and brains removed and frozen under powdered dry ice. Food was freely available to mice both before and after injection. The hypothalamus (defined caudally by the mammillary bodies, rostrally by the optic chiasm, laterally by the optic tract, and superiorly by the apex of the hypothalamic third ventricle) was removed, RNA was extracted using RNAzol B (Tel-Test Inc., Friendswood, TX), and 1 µg RNA was reverse-transcribed using AMV reverse transcriptase (10 U) (Promega, Madison, WI). Primers were optimized for mRNA encoding Npy, Agrp, Pomc, Mch, Hcrt, and Gapdh and are listed below: Npy: forward, 5' accaggcagagatatggcaaga 3'; reverse, 5' ggacattttctgtgctttctctcatta 3'; Agrp: forward, 5' agggcatcagaaggcctgaccagg 3'; reverse, 5'cattgaagaagcggcagtagcacgt 3'; Pomc: forward, 5'cgctcctactctatggagcactt 3'; reverse, 5' tcacctaccagctccctcttg 3'; Mch: forward, 5' ccagctgagaatggagttcaga 3'; reverse, 5' gtcggtagactcttcccagcat 3'; Hcrt: forward, 5' gccgtctctacgaactgttgc 3'; reverse, 5' cgctttcccagagtcaggata 3'; Gapdh: forward, 5' aacgaccccttcattgac 3'; reverse, 5' tccacgacatactcagcac 3'. PCR was performed on a LightCycler (Roche Molecular Biochemicals, Indianapolis, IN) using a 50-ng sample of hypothalamic cDNA added to the commercially available LightCycler PCR master mix (FastStart DNA Master SYBR Green I, Roche Molecular Biochemicals). Neuropeptide mRNA expression levels were normalized to Gapdh mRNA content and expressed as a percent of the mean value of saline-treated controls for each genotype. Nontemplate controls were incorporated into each experiment.
Feeding and neuroendocrine responses to neuroglucopenia
Four hours after onset of the light cycle (a time when spontaneous food intake is low), male Npy–/– and Npy+/+ mice received an injection of either saline or the same dose of insulin (60 mU ip) used in the previous study, and food intake over the subsequent 4-h period was measured. Food was freely available to all mice both before and after injection. Because of the small amount of food consumed by mice over a 4-h interval, and because of variability inherent in this feeding response, nine replicates of this experiment were performed in three different groups of mice (n = 8–10 per group for each replicate). Food intake data were pooled for comparison of mean values across all studies.
Blood sampling
All blood samples were obtained from unanesthetized mice of both genotypes. Blood samples for glucose determinations (10–50 µl) were taken from either the retro-orbital sinus or saphenous vein (n = 9–14 animals/group) at various time points (30–120 min) after saline or insulin injection. Samples for measurement of glucagon (50–100 µl plasma) or corticosterone (30 µl plasma) were obtained from the saphenous vein of different subsets of mice of each genotype. To avoid potentially confounding effects, blood was sampled from groups of animals separate from those in which food intake was measured. In all studies, food was freely available to mice from which blood samples were obtained.
2-Deoxyglucose (2-DG)-induced feeding
Two hours after light cycle onset, female Npy–/– and Npy+/+ mice received ip injections of either saline or saline containing 500 mg/kg 2-DG at 10 µl/g body weight. Food was freely available at all times, and intake was recorded hourly thereafter for 4 h.
Plasma assays
Heparinized plasma was separated by centrifugation and stored at –70 C until assay. Plasma glucose was determined by the glucose oxidase method (Beckman Instruments, Brea, CA). Plasma glucagon levels were determined by RIA (Linco, Indianapolis, IN). Plasma corticosterone levels were determined using the OTECIA assay kit (Alpco Diagnostics, Windham, NH). To determine the time course of recovery to euglycemia, blood glucose concentrations were determined using a hand-held glucose meter (Hemocue Blood Glucose Analyzer, Lake Forest, CA).
Statistics
All values are reported as group mean ± SEM. The level of significance was P 
0.05. Two-group comparisons were made by two-tailed Student’s’ t test. Comparisons of mean values from studies involving more than two groups were performed using one-way ANOVA or by two-way ANOVA to compare responses between genotypes.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, plasma glucose levels measured 45 min after insulin injection (60 mU) were reduced similarly in Npy+/+ and Npy–/– mice [Npy+/+, 40 ± 3 mg/dl; Npy–/–, 37 ± 2 mg/dl; P = NS (not significant)] relative to saline-injected controls (Npy+/+, 113 ± 9 mg/dl; Npy–/–, 137 ± 8 mg/dl; P = NS). In wild-type mice, insulin-induced hypoglycemia was associated with a 2.4-fold increase in hypothalamic Npy mRNA content (P < 0.05 vs. saline-treated controls; Fig. 1B), as determined by real-time PCR on samples obtained 7 h after injection. By comparison, hypothalamic levels of mRNA encoding Pomc, Mch, Hcrt, and Agrp were not significantly altered by this intervention at this time point. As expected, Npy mRNA was not detected in the hypothalamus of Npy–/– mice and, as in wild-type mice, insulin-induced hypoglycemia did not significantly alter mRNA content of the other neuropeptides tested (Fig. 1C).
|
), food intake measured 4 h after insulin injection was sharply attenuated in NPY-deficient, relative to wild-type, mice (Fig. 2). In Npy+/+ animals, food intake during the 4 h after insulin injection increased by 2.5-fold relative to saline-injected controls (0.49 ± 0.03 g vs. 0.20 ± 0.03 g; P 0.001). By comparison, insulin-injected Npy–/– mice increased their intake by only 45% beyond that consumed by saline controls (0.25 ± 0.03 g vs. 0.17 ± 0.03 g) during this 4-h period, an effect that did not reach statistical significance (P = 0.08). Thus, the effect of hypoglycemia to increase food intake was strongly attenuated in mice lacking NPY [F (3, 125) = 23.473; P < 0.001].
|
). At 4 h post injection, food intake remained elevated above vehicle control values in Npy+/+ mice and was greater than the amount consumed by Npy–/– animals, although this difference was no longer statistically significant (P = 0.08).
Glucagon and corticosterone responses to hypoglycemia and recovery of normal blood glucose levels
Unlike their attenuated feeding response, the increase of plasma glucagon levels, 1 h after injection of the same insulin dose (60 mU ip), was fully intact in NPY-deficient mice compared with wild-type controls (335 ± 35 pg/ml vs. 320 ± 20 pg/ml, Npy+/+ vs. Npy–/–; P = NS) (Fig. 3A). Compared with saline injection, glucagon levels increased significantly (by 1.5- to 2-fold) during hypoglycemia in both groups of mice, and there was no genotype difference in the magnitude of this response. Similarly, the potent effect of insulin-induced hypoglycemia to raise plasma corticosterone levels was fully intact in both NPY-deficient and wild-type mice (corticosterone, 421 ± 35 ng/ml vs. 364 ± 30 ng/ml, Npy+/+ vs. Npy–/–; P = NS) and resulted in plasma values 3- to 4-fold higher than were detected after saline injection (140 ± 26 ng/ml vs. 100 ± 22 ng/ml, Npy+/+ vs. Npy–/–; P = NS) (Fig. 3B). To determine whether NPY deficiency influences either the magnitude of hypoglycemia or the time course over which euglycemia is restored after the same dose of insulin (60 mU ip), blood glucose levels were determined at baseline and at 30-min intervals after insulin injection in both Npy+/+ and Npy–/– mice provided unrestricted access to chow. As shown in Fig. 3C, there was no significant difference between genotypes in either the nadir glucose value or the time to recovery of baseline glucose. Although blood glucose levels tended to increase more rapidly in wild-type mice during the final 60 min of the study, this effect did not achieve statistical significance.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The mechanism whereby hypothalamic NPY neurons are activated by hypoglycemia is an area of active study. The hypothesis that these neurons sense and respond directly to changes of ambient glucose levels is supported by in vitro evidence that NPY-containing neurons in the ARC are activated by rapid, marked reductions in ambient glucose concentrations (20), and that these neurons coexpress glucokinase, a hexokinase found exclusively in glucose-responsive cells (21). Combined with studies in rats showing activation of NPY neurons in response to 2-DG administration in vivo (15, 19), ARC NPY neurons could potentially sense and respond directly to glucopenic stimuli. Activation by glucopenia of hypothalamic NPY neurons can also involve indirect mechanisms, however, and growing evidence suggests that ARC NPY neurons are downstream components of a neuronal circuit that originates in the hindbrain and is activated by glucopenia. For example, selective lesioning of hindbrain catecholaminergic neurons that innervate the ARC (by microinjection into the ARC of an immunotoxin that is specific for catecholaminergic cells) was recently shown to impair glucopenia-induced increases of both food intake and hypothalamic Npy gene expression in rats (16). This observation supports evidence (8) that activation of catecholamine cell groups projecting to forebrain areas (such as the ARC or paraventricular nucleus) involved in the control of food intake, endocrine function, and autonomic outflow serve as critical mediators of the response to reduced glucose availability.
Although studies using an immunotoxin-based strategy clearly implicate hindbrain catecholamine cell groups in the response of ARC neurons to glucopenia, these findings do not address the importance of NPY in comparison with other potential mediators of glucopenic feeding. To address this issue, we determined the impact of targeted deletion of the Npy gene on this feeding response. Our finding that glucopenic feeding is strongly attenuated in NPY-deficient mice provides clear evidence that the effect of hypoglycemia to increase food intake is, to a large extent, NPY-dependent. Although glucoprivic feeding likely involves NPY-independent mechanisms as well (e.g. inhibition of synaptic release of melanocortins) (22), our findings suggest that the integrity of this response is highly dependent on the actions of NPY.
Our finding that insulin-induced hypoglycemia increases hypothalamic expression of Npy mRNA in normal mice supports a model in which increased hypothalamic NPY signaling plays a central role in glucopenic feeding. This finding is also in agreement with a study in rats showing that 2-DG administration rapidly increases hypothalamic Npy mRNA content (19). Unlike our findings, however, hypothalamic levels of Mch and Agrp mRNA were also increased in that study (19). Similarly, Fraley et al. (16) reported that expression of both Npy and Agrp mRNA increase rapidly in rat hypothalamus after administration of 2-DG. Among several factors that might explain disparities between the relatively specific increase of Npy mRNA in our study and the findings of others are differences in animal model (mouse vs. rat), timing of tissue collection (7 h vs. 2 h), method of glucopenia induction (insulin vs. 2-DG), and magnitude of the glucopenic stimulus. Whether one or more of these disparities underlies differences between our findings and those of others requires additional study. With the exception of undetectable levels of Npy mRNA, the pattern of hypothalamic neuropeptide gene expression observed in Npy–/– mice subjected to hypoglycemia was similar to that of wild-type controls. The attenuation of glucopenic feeding in mice lacking NPY is therefore unlikely to involve recruitment of hypothalamic responses distinct from those activated in normal mice.
Although NPY/AgRP neurons in the ARC are clearly implicated in the control of food intake, NPY-containing neurons in other brain areas also warrant consideration in the interpretation of our findings. Specifically, many hindbrain catecholaminergic neurons that are activated by glucopenia express NPY as well as catecholamines (23), and these neurons innervate not only the ARC (24) but also the paraventricular nucleus (9, 12, 25), a brain area that is exquisitely sensitive to NPY-induced feeding (11). Moreover, the finding that decerebrate rats increase their intake of a liquid meal (provided intraorally) in response to glucopenia even though all connections between forebrain and hindbrain are severed (26) suggests that structures within the hindbrain are sufficient to generate glucopenic feeding responses. These considerations, combined with our current data, raise the possibility that a subset of hindbrain neurons containing both catecholamines and NPY mediate NPY-dependent feeding in response to glucopenia, and that attenuated hyperphagia in Npy–/– mice is due, in part, to the absence of NPY from these hindbrain neurons. This hypothesis is strengthened by evidence that, although hindbrain catecholaminergic neurons appear to be essential for the hyperphagia after hypoglycemia (8, 16), norepinephrine and epinephrine are not (27). Other transmitters produced by these neurons, such as NPY (25), are therefore implicated in the hyperphagic response. Whether NPY neurons in the ARC, the hindbrain, or both are critical mediators of the hyperphagic response to neuroglucopenia warrants additional study.
The first line of defense against hypoglycemia involves the secretion of counterregulatory hormones, such as glucagon and corticosterone, that increase hepatic glucose production, impair insulin-stimulated glucose uptake, and ultimately restore low blood glucose concentrations to their normal value. Although a large literature implicates NPY in the physiological control of food intake, less information is available to suggest an important role for this neuropeptide in counterregulatory hormonal responses to hypoglycemia. For this reason, we anticipated that the neuroendocrine response to hypoglycemia would not be affected by NPY deficiency. Our finding that plasma glucagon and corticosterone responses to hypoglycemia are intact in Npy–/– mice fits with this prediction and supports the conclusion that NPY is not required for glucopenia-induced secretion of these hormones. Because food was freely available to mice employed for these studies, differences in food consumption could conceivably have masked an effect of NPY deficiency on counterregulatory responses, and additional studies are warranted to address this possibility. Together with our finding that NPY deficiency does not substantially alter the recovery of euglycemia after insulin administration, we conclude that neuronal pathways controlling neuroendocrine responses to hypoglycemia must be distinct from those driving food intake, because the latter, but not the former, are NPY-dependent.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Current address for D.K.S.: Endocrine Division, Eli Lilly & Co., Corporate Center, Drop 0545, Indianapolis, Indiana 46285.
Current address for J.E.M.: Columbia University College of Physicians and Surgeons,1150 St. Nicholas Avenue, 6th Floor, New York, New York 10032.
Abbreviations: AgRP, Agouti-related peptide; ARC, arcuate nucleus; 2-DG, 2-deoxyglucose; NPY, neuropeptide Y; NS, not significant.
Received December 22, 2003.
Accepted for publication March 23, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
- and ß-adrenergic blockade on plasma glucose recovery and glucose flux rates after insulin-induced hypoglycemia. J Clin Invest 64:62–71
This article has been cited by other articles:
 |
|
 |
|
  A. A. Dunn-Meynell, N. M. Sanders, D. Compton, T. C. Becker, J.-i. Eiki, B. B. Zhang, and B. E. Levin Relationship among Brain and Blood Glucose Levels and Spontaneous and Glucoprivic Feeding J. Neurosci., May 27, 2009; 29(21): 7015 - 7022. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sajapitak, K. Iwata, M. Shahab, Y. Uenoyama, S. Yamada, M. Kinoshita, F. Y. Bari, H. I'Anson, H. Tsukamura, and K.-i. Maeda Central Lipoprivation-Induced Suppression of Luteinizing Hormone Pulses Is Mediated by Paraventricular Catecholaminergic Inputs in Female Rats Endocrinology, June 1, 2008; 149(6): 3016 - 3024. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Fuzesi, G. Wittmann, Z. Liposits, R. M. Lechan, and C. Fekete Contribution of Noradrenergic and Adrenergic Cell Groups of the Brainstem and Agouti-Related Protein-Synthesizing Neurons of the Arcuate Nucleus to Neuropeptide-Y Innervation of Corticotropin-Releasing Hormone Neurons in Hypothalamic Paraventricular Nucleus of the Rat Endocrinology, November 1, 2007; 148(11): 5442 - 5450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Kamiji and A. Inui Neuropeptide Y Receptor Selective Ligands in the Treatment of Obesity Endocr. Rev., October 1, 2007; 28(6): 664 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Acosta-Martinez and J. E. Levine Regulation of KATP channel subunit gene expression by hyperglycemia in the mediobasal hypothalamus of female rats Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1801 - E1807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Arumugam, D. Fleenor, and M. Freemark Lactogenic and Somatogenic Hormones Regulate the Expression of Neuropeptide Y and Cocaine- and Amphetamine-Regulated Transcript in Rat Insulinoma (INS-1) Cells: Interactions with Glucose and Glucocorticoids Endocrinology, January 1, 2007; 148(1): 258 - 267. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. R. Patel, Y. Qi, E. J. Hawkins, S. M. Hileman, J. K. Elmquist, Y. Imai, and R. S. Ahima Neuropeptide Y Deficiency Attenuates Responses to Fasting and High-Fat Diet in Obesity-Prone Mice Diabetes, November 1, 2006; 55(11): 3091 - 3098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B Beck Neuropeptide Y in normal eating and in genetic and dietary-induced obesity Phil Trans R Soc B, July 29, 2006; 361(1471): 1159 - 1185. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-J. Li, Q. Wang, and S. Ritter Differential Responsiveness of Dopamine-{beta}-Hydroxylase Gene Expression to Glucoprivation in Different Catecholamine Cell Groups Endocrinology, July 1, 2006; 147(7): 3428 - 3434. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Ste. Marie, S. Luquet, T. B. Cole, and R. D. Palmiter Modulation of neuropeptide Y expression in adult mice does not affect feeding PNAS, December 20, 2005; 102(51): 18632 - 18637. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Bugarith, T. T. Dinh, A.-J. Li, R. C. Speth, and S. Ritter Basomedial Hypothalamic Injections of Neuropeptide Y Conjugated to Saporin Selectively Disrupt Hypothalamic Controls of Food Intake Endocrinology, March 1, 2005; 146(3): 1179 - 1191. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. N. Wade and J. E. Jones Neuroendocrinology of nutritional infertility Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2004; 287(6): R1277 - R1296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. W. Gelling, J. Overduin, C. D. Morrison, G. J. Morton, R. S. Frayo, D. E. Cummings, and M. W. Schwartz Effect of Uncontrolled Diabetes on Plasma Ghrelin Concentrations and Ghrelin-Induced Feeding Endocrinology, October 1, 2004; 145(10): 4575 - 4582. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
, P 