help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2004-0229
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/8/3619    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gereben, B.
Right arrow Articles by Fekete, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gereben, B.
Right arrow Articles by Fekete, C.
Endocrinology Vol. 145, No. 8 3619-3625
Copyright © 2004 by The Endocrine Society

Ontogenic Redistribution of Type 2 Deiodinase Messenger Ribonucleic Acid in the Brain of Chicken

Balázs Gereben, Janusz Pachucki, Anna Kollár, Zsolt Liposits and Csaba Fekete

Laboratory of Endocrine Neurobiology, Institute of Experimental Medicine (B.G., Z.L., C.F.), Hungarian Academy of Sciences, Budapest H-1083, Hungary; Department of Endocrinology (J.P.), Medical University of Warsaw, Warsaw 02-097, Poland; and Department of Medical Biochemistry (A.K.), Semmelweis University, Budapest H-1088, Hungary

Address all correspondence and requests for reprints to: Dr. Balázs Gereben, Institute of Experimental Medicine, Szigony utca 43, Budapest H-1083, Hungary. E-mail: gereben{at}koki.hu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thyroid hormone is essential for brain development. T4 has to be converted to T3 for efficient binding to thyroid hormone receptors. Type 2 deiodinase (D2) is the key enzyme that allows T3 generation in the brain. To elucidate the onset and localization of T3 production in the brain, we studied the changes of D2 activity, mRNA content, and the distribution of D2 mRNA in the brain of chicken embryos before and after the onset of thyroid function. D2 activity was detectable in the brain at all stages studied from embryonic day (E)7 to E15 and increased significantly with time. The wild-type chicken D2 transcript was detectable at all those stages by RT-PCR. The amount of D2 mRNA in the brain increased approximately 14-fold from E10 to E17 as assessed by Northern blot. Week D2 hybridization signal could be detected by in situ hybridization at E8 in cell clusters throughout the brain, and its intensity markedly increased to E15. Interestingly, no D2 expression was detected in hypothalamic tanycytes at these embryonic stages. However, D2 hybridization signal was observed in the wall of the third ventricle of adult chicken posterior to the rostral pole of the median eminence in the location typical for tanycytes, whereas D2 signal in other localizations was decreased throughout the brain. Our data suggest that D2 contributes to T3 content of the developing chicken brain even before the onset of thyroid function. Furthermore, redistribution of D2 mRNA expression was observed during the development of the chicken brain.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THYROID HORMONE IS essential for the development of the central nervous system (CNS). A classical study emphasized the importance of normal thyroid function in brain development based on the observation of mental retardation of patients with cretinism (1). It has also been demonstrated that congenital hypothyroidism can cause mental retardation in neonates that can be prevented with early thyroid hormone supplementation (2). Furthermore, recent data suggest that abnormal thyroid hormone supply of the human fetus even during the first trimester of pregnancy can affect the outcome of neurodevelopment in childhood (3, 4).

The primary product of the thyroid gland is T4, a prohormone that has to be converted by 5'-deiodination to T3, the active form of thyroid hormones that can efficiently bind to the thyroid hormone receptors (TRs). It has also been demonstrated that maternal T4 but not T3 was effective in elevating the T3 content of the hypothyroid brain of rat embryos (5), suggesting that local T3 production is important in the maintenance of T3 levels in the brain. In accordance with this finding, it has been shown in the cerebral cortex of adult rats that 5'-deiodination plays an important role in the rapid response of the brain to hypothyroidism (6).

Type 2 deiodinase (D2) is one of the two enzymes that carry 5'-deiodinase activity (7). The importance of D2 in the T3 homeostasis of the brain tissue is emphasized by findings demonstrating that more than 75% of the TR bound T3 is generated locally in the cortex (8). In contrast to the rat brain that expresses higher type 1 deiodinase (D1) activity than D2 in the cerebrum (9, 10), D2 is the only activating deiodinase in the human brain (11). D2 expression in the rat brain is observed mostly in glial cells and highly concentrated in tanycytes of the mediobasal hypothalamus (12, 13, 14, 15).

Despite the accumulating data on T3-dependent gene expression in the CNS (16, 17), only limited information is available on the onset of local T3 generation and the thyroid hormone action in the brain before the start of thyroid function. However, these mechanisms are of great importance because the T3 level has to be tightly controlled at early developmental stages because T3 can initiate cellular differentiation possibly through the regulation of an internal clock mechanism (18).

The chicken embryo provides a useful model to study mechanism underlying the thyroid hormone-mediated developmental changes in the CNS. T4 and T3 are present in the yolk as maternal thyroid hormone supply (19). TR{alpha} is already expressed before the blastula stage in the neural plate and neural tube, whereas TRß appears later during development, and its expression undergoes striking ontogenic changes (20, 21). In addition, the approximately 6.1-kb full-length chicken D2 (cD2) mRNA has been cloned and functionally characterized, and its expression was demonstrated in different brain regions of the adult chicken brain (22).

The aim of this study was to investigate the expression of the T3-generating machinery in the developing chicken brain before the onset of thyroidal secretion. Furthermore, we studied the distribution of D2 mRNA in developing and adult brain of chickens using in situ hybridization to elucidate the site of D2 production at different developmental stages. Here we provide evidence for a profound ontogenically regulated change in D2 mRNA distribution during CNS development.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Eight-week-old specific pathogen-free White Leghorn chickens and chicken embryos on the embryonic day (E)7, E8, E9, E10, E11, E13, E15, and E17 were obtained from the Central Veterinary Institute and Ceva-Phylaxia (Budapest, Hungary). The incubation was started at E0. Animal tissue samples were collected in accordance with the legal requirements of the Animal Care and Use Committee of the Institute of Experimental Medicine (Hungarian Academy of Sciences, Budapest).

Deiodinase assays
Brain samples of chicken embryos (E7, E8, E9, E10, E11, E13, and E15; n = 5) were dissected and rapidly removed. The E13 and E15 brains were separated for telencephalon+diencephalon (A) and brainstem + cerebellum (B) parts. Samples were homogenized in ice-cold PE buffer [100 mM potassium phosphate, 1 mM EDTA (pH 6.9)] with 0.25 M sucrose and 1 mM dithiothreitol (22) and then kept frozen at –80 C until used. The assays contained approximately 150–600 µg homogenate proteins in 300 µl PE buffer [100 mM potassium phosphate, 1 mM EDTA (pH 6.9)] supplemented with various amount of cold T4 (1 or 100 nM) and about 30,000 cpm of Sephadex LH-20 purified, labeled T4 and 20 mM dithiothreitol (23). Measurements using 100 nM T4 were used to confirm the D2 nature of the measured 5'-deiodinase activity (24). Additional incubations were performed with 1 nM T4 + 100 nM T3 + 1 mM propylthiouracil (PTU) added to the reaction buffer to inhibit D1 and D3 activity. Incubation was carried out at 37 C for 2 h.

The amount of protein used for assays was set to keep the percent of deiodination between 5 and 30%. The reactions were stopped by adding 200 µl horse serum (Invitrogen, Carlsbad, CA) and 100 µl of 50% trichloroacetic acid for precipitation (25). A fraction of supernatant (400 of 600 µl) was applied on ion exchange chromatography through self-made Dowex 50WX (Amersham Pharmacia Biosciences, Uppsala, Sweden) columns to further separate iodine from other thyroid hormone metabolites. The fraction of supernatant containing the iodine but not thyroid hormones was eluted with 2 ml of 10% acetic acid and counted in a {gamma}-counter (Wizard-1470, PerkinElmer Life and Analytical Sciences, Inc., Boston, MA). Assays were carried out in duplicates at least twice, and the activity level was expressed in femtomoles released (23) per hour per milligram of protein. Total count and background were calculated from several blank tubes containing no homogenate.

RT-PCR
Brain samples of E7, E8, E9, E10, E11, E13, and E15 chicken embryos were dissected in duplicates, and total RNA was isolated with Trizol (Invitrogen). E13 and E15 brains were separated for telencephalon + diencephalon (A) and brainstem + cerebellum (B) parts. RNA was subjected to first-strand cDNA synthesis using an oligo-dT primer and amplified with D2-specific primers, as described (26). The cD2 oligonucleotides were as follows (5'–3'): sense, CTG AAT TCA TCC GGC AGA AGA GAG; antisense, AGC TTC TCC TCC AAG TTT GA. The nonquantitative D2 amplification was performed using the following program: 94 C for 2 min; 35 cycles of 94 C for 30 sec, 58 C for 30 sec, and 72 C for 1 min; and 72 C for 4 min.

Northern blot
The Northern blot was performed as previously described (22). In short, total RNA was isolated with Trizol from the brains of E7, E8, E9, and E10 and hemispheres of E13, E15, and E17 chicken embryos. A digoxigenin (DIG)-labeled single-stranded cDNA probe complementer to 450 bp of the cD2 coding region was used to detect D2 in 30 µg total RNA. The probe was labeled by linear PCR using the (5'-3') TGCACAATGCACACTCGCTC antisense oligonucleotide and DIG-deoxyuridine 5-triphosphate. As denominator for densitometry, the density of the 28S subunit was used.

In situ hybridization for D2 mRNA on the brain of E8 and E15 chicken embryos and 8-wk-old chickens
The heads of three E8 embryos and the brains of three E15 embryos and three 8-wk-old chickens were quickly frozen on dry ice and stored at –80 C until used. Serial 12-µm-thick coronal sections were cut on cryostat, mounted on gelatin-coated slides, and dried at 42 C overnight. The sections were fixed with 4% paraformaldehyde in PBS (pH 7.4) for 30 min washed in 2-fold concentration of standard sodium citrate (2x SSC); acetylated with 0.25% acetic anhydride in 0.9% triethanolamine for 20 min; and then treated in graded solutions of ethanol (70, 80, 96, 100%), chloroform, and a descending series of ethanol (100, 96%) for 5 min each and hybridized with an approximately 840 bp single-stranded DIG-11-uridine 5-triphosphate (Roche Diagnostics GmbH, Mannheim, Germany)-labeled cRNA probe for the entire coding region of cD2. The hybridizations were performed under plastic coverslips in a buffer containing 50% formamide, 2-fold concentration of standard sodium citrate (2x SSC), 10% dextran sulfate, 0.5% sodium dodecyl sulfate, 250 µg/ml denatured salmon sperm DNA, and the DIG-labeled probe, diluted at 1:100 for 16 h at 56 C. The slides were washed in 1x SSC for 15 min and then treated with RNase (25 µg/ml) for 1 h at 37 C. After additional washes in 0.1x SSC (2 x 30 min) at 65 C, sections were washed in PBS and treated with the mixture of 0.5% Triton X-100 and 0.5% H2O2 for 15 min and then with 2% BSA in PBS for 20 min to reduce the nonspecific antibody binding. The sections were incubated with a mixture of sheep anti-DIG-alkaline phosphatase Fab fragments (1:1000, Roche Diagnostics) overnight at 4 C. The alkaline phosphatase signal was detected using 5-bromo-4-chloro-3-indolyl-phosphate/4-nitroblue tetrazolium chromogen system (Roche Diagnostics) according to the manufacturer’s instructions. The reaction was developed for 6 h, and then the sections were rinsed in Tris buffer (pH. 7.6). The sections were coverslipped using Aquatex mounting medium (Merck, Darmstadt Germany), and the images were taken with an Axiophot microscope (Carl Zeiss Inc., Göttingen, Germany) equipped with real-time spot digital camera (Diagnostic Instruments Inc., Sterling Heights, MI).

For semiquantitative analyses all samples were treated simultaneously. Three 20 x field of the hypothalamus of each E15 and adult brain from three different anterior-posterior levels were analyzed using ImageJ software (public domain from National Institutes of Health). Background density points were removed by thresholding the image. The sum of integrated density values (density x area) was calculated for each animal. The specificity of hybridization was confirmed using a sense cD2 coding region probe, which resulted in the total absence of specific hybridization signal in the brain at all stages studied.

Statistics
Statistical analysis on deiodinase activity data were performed using linear regression and one-way ANOVA followed by Newman-Keuls test. The sums of integrated density values of in situ hybridization reactions were compared by unpaired t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
D2 activity in the developing chicken brain (E7–E15)
Using 1 nM T4 as substrate, D2 activity could be detected from as early as E7 (54 fmol/h/mg) and significantly increased from E13 (P < 0.001 by ANOVA) reaching a maximum of 148 fmol/h/mg at E15 (Fig. 1Go). The increase of D2 activity was highly correlated with time during the whole investigated period (correlation coefficient 0.91, P < 0.001). No significant difference was found between D2 activities of the telencephalon+diencephalon and brainstem + cerebellum samples. Using a T4 saturation assay, we found that the deiodination of [125I]T4 by the brain homogenate at all stages studied was heavily suppressed by the addition of 100 nM cold T4. That implies that only a negligible fraction of the measured 5'-deiodinase activity could be attributed to D1 (Table 1Go). These data indicate that D2 is the predominant activating deiodinase during the investigated period of the ontogeny of chicken brain before and after the onset of thyroid function. The outer ring deiodination of 1 nM T4 was only partially inhibited when 100 nM T3 and 1 mM PTU were added to the assays to inhibit the contribution of D3 and/or D1. The inhibition of 1 nM T4 outer ring deiodination by 100 nM T3 and 1 mM PTU was slightly lower at E13-E15 than at E7-E8 (P < 0.01 by ANOVA, Table 1Go). Nevertheless, using this condition, the specific T4 outer ring deiodination was also highly positively correlated with developing stages (correlation coefficient 0.82, P < 0.001), and the activity was highest at E13 and E15 stages (by ANOVA P < 0.01 when compared with E7 or E8).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 1. D2 activity in the brain of chicken embryos from E7 to E15. Specific low Km D2 activity was present in the developing chicken brain from E7 to E15. Activity is expressed as femtomoles per hour per milligram iodine release. The increase of D2 activity was highly correlated with time during the whole investigated period (correlation coefficient 0.91, P < 0.001). From stage E13 D2 activity was significantly higher, compared with the earliest tested period (ANOVA, P < 0.001). The whole brains of E7, E8, E9, E10, and E11 embryos were used, whereas at E13 and E15, the brains were separated for telencephalon + diencephalon (A) and brainstem + cerebellum (B) parts. *, P < 0.001 vs. E7; **, P < 0.0001 vs. E7 by ANOVA followed by Newman-Keuls (mean ± SEM, n = 5).

 

View this table:
[in this window]
[in a new window]
  		TABLE 1. Fractional deiodination in the chicken embryonic brain

 
D2 mRNA expression in the developing chicken brain by Northern blot and RT-PCR
RT-PCR showed that the wild-type D2 transcript was expressed at all stages studied (E7-E15) and could be found both in the telencephalon+diencephalons and brainstem + cerebellum parts at E13 and E15 (Fig. 2Go). The inactive –77cD2 splice variant (26) could not be detected. The level of the cD2 mRNA was quantified by Northern blot in the developing chicken brain from E7 to E17. A single cD2 transcript of approximately 6 kb was present. The cD2 transcript reached the detection limit at E10 and increased approximately 14-fold until E17 (Fig. 3Go). The D2/28 S density ratios were 0.5, 2.1, 5.2, and 7.3 for E10, E13, E15, and E17, respectively.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 2. RT-PCR analysis of D2 transcripts in the brain of chicken embryos. The D2 mRNA was expressed at all tested stages. Note that only the wild type but not the spliced –77cD2 transcript could be detected. In the negative control (neg. ctr.) cDNA was replaced by water. A, Telencephalon + diencephalon. B, Brainstem + cerebellum.

 


View larger version (73K):
[in this window]
[in a new window]
  		FIG. 3. D2 expression in the developing chicken brain using Northern blot. The D2 mRNA was detected from E10 and increased robustly to stage E17.

 
Distribution of D2 mRNA in the brain of developing chicken
Only very weak D2 hybridization signal was observed in the brain of E8 chicken embryos. This hybridization signal was found in scattered cell clusters (Fig. 4AGo). D2 hybridization signal was also found in cell clusters throughout the brain of E15 embryos, but it was markedly increased, compared with the E8 stage (Fig. 4Go, B–D). In several instances the labeled cells formed long, branching cell populations. The ependymal cells lining the wall of the third ventricle did not contain D2 hybridization signal at this stage of development (Fig. 4BGo).



View larger version (110K):
[in this window]
[in a new window]
  		FIG. 4. In situ hybridization for D2 mRNA in the brain of E8 and E15 chicken embryos. The D2 hybridization signal is very weak in the E8 brain sections (A). Arrows indicate modestly labeled cell clusters. The hybridization signal is markedly increased in the E15 brains (B–D). Low-magnification photomicrograph illustrates the D2 hybridization signal in the E15 hypothalamus (B). Arrowheads indicate the wall of the third ventricle. Note the lack of hybridization signal in the ependymal layer and the strong signal associated with elongated cell clusters (arrows). Strong hybridization signal in elongated cell clusters (arrows) in the E15 neostriatum (C) and hypothalamus (D). No signal was detected using a sense D2 probe (E). Scale bar, 200 µm in A corresponds to A and B; scale bar, 100 µm in C corresponds to C–E.

 
Distribution of D2 mRNA in the brain of adult chicken
In the adult chicken, hybridization signal was absent in the wall of the rostral part of the third ventricle (Fig. 5AGo) and from that of the lateral ventricles. In contrast, D2 hybridization signal appeared in a subset of the ependymal cells lining the wall of the third ventricle between the rostral pole of the median eminence and the mammillary recess. The signal was localized to the floor of the third ventricle at the rostral pole of the median eminence (Fig. 5BGo), whereas more caudally D2-expressing cells covered the ventral one half to two thirds of the ventricular wall (Fig. 5Go, C and D). The distribution of labeled ependymal cells was reminiscent of that of tanycytes. In other parts of the brain, D2 hybridization was found in similar cell clusters as observed in the E15 brains (Fig 5Go, A–D and G), but the intensity of hybridization signal was markedly decreased [E15 vs. adult (integrated density units) 15.90 ± 0.23 vs. 3.34 ± 1.23, P = 0.0043]. In the neostriatum, D2 mRNA was also observed in isolated cells. These cells hybridized strongly for D2 (Fig. 5Go, E, F, and H).



View larger version (109K):
[in this window]
[in a new window]
  		FIG. 5. Distribution of D2 mRNA in the brain of adult chicken. The density of D2 hybridization signal associated with cell clusters is markedly decreased in the brain of adult chicken (A–H). A, No hybridization signal can be detected in the wall of the third ventricle rostral to the median eminence (arrowheads indicate the wall of the third ventricle, whereas arrows indicate modest signal in hypothalamic cell clusters). B, At the rostral pole of the median eminence, the hybridization signal was localized to the floor of the third ventricle (arrows). C, More caudally D2-expressing cells covered the ventral half of the ventricular wall (arrows). D, Higher-magnification micrograph illustrates the localization of D2 mRNA in the ependymal layer of the third ventricle (arrows). Arrows indicate examples for D2 hybridization signal in the adjacent hypothalamic tissue (open arrows). E, Low-magnification micrograph demonstrates the D2 hybridization signal in the cerebellum, hippocampus, and neostriatum caudale. F, Medium-power magnification of the same region is seen; arrows indicate D2 hybridization signal in isolated cells. G, High-power image of an elongated cell cluster in the hypothalamus. H, The D2 hybridization signal is also present in isolated cells (arrows) in the neostriatum. Cb, Cerebellum; Hp, hippocampus; NC, neostriatum caudale; OC, optic chiasm. Scale bar, 400 µm in A corresponds to A–C and E; scale bar, 200 µm in D corresponds to D and F; scale bar 100 µm in G corresponds to G and H.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Thyroid hormone controls piping, hatching, growth, and thermogenesis in birds and may play a role in neurulation of the chicken embryo at early developmental stages (21, 27, 28). In chicken, the onset of thyroid function occurs at E9.5, and the adenohypophysis starts to stimulate secretion of the thyroid gland at E11.5 (29). Chickens, unlike rats, are precocious animals. Humans are more similar to chickens than to rats with respect to the relatively well developed thyroid function of the human fetus at birth and the chicken at hatching (16, 18).

The presented data provide evidence that the developing chicken brain can locally activate the prohormone T4 via D2 catalyzed deiodination, even before the onset of thyroidal secretion. Parallel to D2 activity, the D2 message could be detected during the whole investigated period from E7 to E15 by RT-PCR and by in situ hybridization at E8 and E15.

Different assay conditions were used to ascertain the role of D2 in T4 activation in the brain of chicken embryos. Almost complete blockade of labeled T4 deiodination by the addition of 100 nM cold T4 suggests the predominant contribution of D2 in outer ring deiodination of T4 in the developing chicken brain (Table 1Go) (24, 30, 31). Using PTU alone to inhibit D1 activity at low substrate concentration can give false results (31). Our findings did not imply that there is no detectable D1 activity in the embryonic chicken brain because we did not use reverse T3 that is the most favorite substrate for D1. The presence of D3 (the T4 deactivating enzyme) in the brain samples can interfere with the assay by generating reverse T3 that can then undergo outer ring deiodination preferentially by D1. The addition of 100 nM T3 can greatly inhibit 1 nM T4 deiodination by D3 and has only partial effect on D2 activity (31). Under this condition, the correlation of T4 outer ring deiodination with embryonic stages was similar when only 1 nM T4 was used. Although we did not measure D3 activity directly, the decreased inhibition rate of T4 deiodination by 100 nM T3 at the end of the investigated period suggests that D3 activity could also be higher at E7-E8 than at E13-E15 in the brain of chicken embryos. This observation would be in accordance with earlier studies demonstrating decreasing D3 activity from E14 in the chicken brain (32).

Moreover, the predominant role of D2 in thyroid hormone activation remains unchanged in later stages of chicken brain development because it has already been shown by Van der Geyten et al. (33) that the D2-mediated T4 activation remains the exclusive way for T3 generation in the brain of older embryos (E16 until the first day after hatching), and only the brain and pituitary express D2 during these stages of chicken development.

Data from Pop et al. (3) and Haddow et al. (4) indicate that the human fetal brain is already sensitive to thyroid hormones before the onset of the fetal thyroid. Low maternal free T4 at 12 but not 32 wk gestation was a risk factor for impaired psychomotor development in infancy. Furthermore, high maternal TSH during pregnancy decreased IQ and a number of neuropsychological parameters of 7- to 9-yr-old children who were not hypothyroid as newborns (4). The onset of the fetal thyroid occurs in the early second trimester. However, the developing embryo receives maternal T4 across the placental barrier before the start of its own T4 secretion (34, 35). The access of thyroid hormones to fetal tissues is under tight control. Both D2 and D3 are expressed in the placenta and pregnant rat uterus. In particular, D3 activity is present at exceptionally high levels (36, 37). As an additional regulatory circuit, the fetal human brain is potentially able to fine-tune its intracellular T3 level during development, as shown by the presence of mRNA and activity of D2 and D3 from as early as 7–8 wk in the developing cerebral cortex of human fetuses (38).

However, the factors initiating D2 mRNA expression during brain development are not known. We found that D2 mRNA expression increased between E9 and E10 reaching the detection limit of Northern blot under the used conditions and continuously increased during the studied period until E17. The timing of the increase of D2 mRNA expression at E9-E10 parallels with the onset of thyroidal secretion (E9.5) (29). The increasing T3 content of the developing chicken brain cannot explain the changes in D2 expression because T3 negatively regulates the level of D2 message by nuclear receptor-mediated transcriptional mechanisms (13, 19, 39, 40). The factors that initiate D2 expression during brain development remain to be determined.

The timing of increase of cD2 expression in the developing chicken brain is in parallel with the onset of intense proliferations of glial cell precursors (41). Whereas D2 expression is predominant in glial cells in rat (42), the nuclear T3 receptors are typically expressed in neurons and oligodendrocytes but not in astrocytes in this species (43). Nevertheless, glial D2 activity is very important to provide T3 for cell type-specific neuronal expression of T3-dependent rat genes (44).

The expression of an alternatively spliced cD2 mRNA (–77cD2) has been shown in the brain and liver of the adult chicken (26). This –77cD2 mRNA lacks 77 nucleotides in the coding region and encodes an inactive form of the D2 enzyme. In contrast to the adult, we could not detect the –77cD2 splice variant by RT-PCR during the studied period of chicken embryonic development in the brain, whereas the wild-type message was readily detectable. This finding suggests that the entire amount of the expressed D2 message is functional at these stages.

Our studies demonstrate that the distribution of the D2 mRNA in the CNS is ontogenically regulated in the chicken brain. D2 mRNA is expressed predominantly in elongated cell clusters throughout the brain. The density of hybridization signal for D2 mRNA is increased from E8 to E15, and it decreased again in the adult. Further studies are required to identify the cell type expressing D2 at this stage of development. However, the coincidence of the beginning of glial development and the induction of D2 synthesis may indicate the glial origin of these cells. This finding may suggest that early D2 expression in all regions of the brain contributes to the maintenance of appropriate T3 levels throughout the developing CNS.

Tanycytes are the most abundant source of D2 in the adult mammalian brain (13, 17). It has been suggested that T3 generated locally by tanycytic D2 could influence the function of the hypothalamo-pituitary-thyroid axis by providing T3 for the TRH neurons located in the paraventricular nucleus (45) because TRH neurons are not able to activate T4 (12). Another striking change in D2 mRNA expression was the ontogenetically regulated appearance of D2 in the wall of the third ventricle. This localization of the D2 signal including the anterior-to-posterior D2 expression pattern highly resembled the tanycytic localization of D2 in the rat, as described (13, 14). This highly similar distribution of D2 expression in the hypothalamus of the chicken and rats suggests that D2 is expressed in tanycytes in the wall of the third ventricle in chicken. In contrast to the adult chicken, tanycytes did not express D2 in the developing chicken mediobasal hypothalamus at E8 and E15.

This ontogenic appearance of D2 in tanycytes may form the morphological basis of the capability of D2 to influence the hypothalamo-pituitary-thyroid axis. Based on this assumption, the development of hypothalamo-pituitary-thyroid axis may have at least two major steps.

In the first step, the adenohypophysis starts to promote thyroidal secretion, this occurs in chicken at E11.5 (29). In the second step, the thyroid hormones are getting able to exert the negative feedback on the axis. D2 is very important in this process because it has been shown in rodents that it plays a crucial role in the feedback regulation of TSH secretion (46, 47).

The elevating T3 levels in the developing chicken brain are accompanied with elevating TSHß mRNA expression in the pituitary until E19 when the negative feedback inhibition of TSH production by thyroid hormones is established (19, 48). In parallel, low D3 level is accompanied by a D2 activity peak between E19 and E20 in the chicken brain (32) that could be important for the onset of feedback. The findings that D2 expressed in the chicken brain well before E19 indicate that the presence of D2 expression itself might not be sufficient for the feedback mechanism. It can be assumed that a specific expression pattern (e.g. D2 appearance in tanycytes) is required for the efficient feedback.

Similarly, in the human fetus, the pituitary gland shows a limited negative feedback (35) despite the expression of D2 in the cortex from as early as 7–8 wk of gestation (38). One reason for this might be that the feedback is counterbalanced by increasing TRH stimulation (35). Another explanation might be that not only D2 expression in the adenohypophysis but also a specific D2 expression pattern in tanycytes is also required for the effective feedback mechanism.

D2-mediated T3 generation in the hypothalamus has another important biological function. It has been recently shown in Japanese quail that the light-induced D2 expression in the mediobasal hypothalamus may be involved in the photoperiodic response of gonads (49).

In summary, our present study has demonstrated that the chicken brain can already activate T4 before the onset of thyroid function. The presented data proved the ontogenic regulation of local T3 generation during chicken brain development via redistribution of D2 mRNA. Our data suggest that D2 catalyzed T3 generation in all regions of the brain is an important factor in generating T3 for the developing brain at early developmental stages. The developmental control of D2 expression in tanycytes could form the T3-generating center in the mediobasal hypothalamus that can influence the hypothalamo-pituitary-thyroid axis.


   Acknowledgments
 
The help of Drs. A. Zolnai (Ceva-Phylaxia, Budapest, Hungary) and J. Skáre (Central Veterinary Institute, Budapest, Hungary) is gratefully acknowledged.


   Footnotes
 
This work was supported by grants from the Hungarian Education Ministry (FKFP 0036/2001) and the Medical Research Council (ETT 781/2003) and a Magyary Zoltán fellowship.

This work was presented in part at the 75th Annual Meeting of the American Thyroid Association, Palm Beach, Florida, 2003.

Abbreviations: cD2, Chicken D2; CNS, central nervous system; D1, type 1 deiodinase; D2, type 2 deiodinase; DIG, digoxigenin; E, embryonic day; PTU, propylthiouracil; SSC, standard sodium citrate; TR, thyroid hormone receptor.

Received February 23, 2004.

Accepted for publication April 6, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ord WM 1888 Report of the committee of the Clinical Society of London nominated December 14, 1883, to investigate the subject of myxoedema. Trans Clin Soc Lond 21(Suppl):1–215
  2. Fisher DA, Dussault JH, Foley Jr TP, Klein AH, LaFranchi S, Larsen PR, Mitchell ML, Murphey WH, Walfish PG 1979 Screening for congenital hypothyroidism: results of screening one million North American infants. J Pediatr 94:700–705[CrossRef][Medline]
  3. Pop VJ, Kuijpens JL, van Baar AL, Verkerk G, van Son MM, de Vijlder JJ, Vulsma T, Wiersinga WM, Drexhage HA, Vader HL 1999 Low maternal free thyroxine concentrations during early pregnancy are associated with impaired psychomotor development in infancy. Clin Endocrinol (Oxf) 50:149–155[CrossRef][Medline]
  4. Haddow JE, Palomaki GE, Allan WC, Williams JR, Knight GJ, Gagnon J, O’Heir CE, Mitchell ML, Hermos RJ, Waisbren SE, Faix JD, Klein RZ 1999 Maternal thyroid deficiency during pregnancy and subsequent neuropsychological development of the child. N Engl J Med 341:549–555[Abstract/Free Full Text]
  5. Calvo R, Obregon MJ, Ruiz de Ona C, Escobar del Rey F, Morreale de Escobar G 1990 Congenital hypothyroidism, as studied in rats. Crucial role of maternal thyroxine but not of 3,5,3'-triiodothyronine in the protection of the fetal brain. J Clin Invest 86:889–899
  6. Leonard JL, Kaplan MM, Visser TJ, Silva JE, Larsen PR 1981 Cerebral cortex responds rapidly to thyroid hormones. Science 214:571–573[Abstract/Free Full Text]
  7. Bianco AC, Slavatore D, Gereben B, Berry MJ, Larsen PR 2002 Biochemistry, cellular and molecular biology and physiological roles of the iodothyronine selenodeiodinases. Endocr Rev 23:38–89[Abstract/Free Full Text]
  8. Crantz FR, Silva JE, Larsen PR 1982 Analysis of the sources and quantity of 3,5,3'-triiodothyronine specifically bound to nuclear receptors in rat cerebral cortex and cerebellum. Endocrinology 110:367–375[Medline]
  9. Visser TJ, Leonard JL, Kaplan MM, Larsen PR 1982 Kinetic evidence suggesting two mechanisms for iodothyronine 5'-deiodination in rat cerebral cortex. Proc Natl Acad Sci USA 79:5080–5084[Abstract/Free Full Text]
  10. Bates JM, St. Germain DL, Galton VA 1999 Expression profiles of the three iodothyronine deiodinases, D1, D2, and D3, in the developing rat. Endocrinology 140:844–851[Abstract/Free Full Text]
  11. Campos-Barros A, Hoell T, Musa A, Sampaolo S, Stoltenburg G, Pinna G, Eravci M, Meinhold H, Baumgartner A 1996 Phenolic and tyrosyl ring iodothyronine deiodination and thyroid hormone concentrations in the human central nervous system. J Clin Endocrinol Metab 81:2179–2185[Abstract]
  12. Riskind PN, Kolodny JM, Larsen PR 1987 The regional hypothalamic distribution of type II 5'-monodeiodinase in euthyroid and hypothyroid rats. Brain Res 420:194–198[CrossRef][Medline]
  13. Tu HM, Kim SW, Salvatore D, Bartha T, Legradi G, Larsen PR, Lechan RM 1997 Regional distribution of type 2 thyroxine deiodinase messenger ribonucleic acid in rat hypothalamus and pituitary and its regulation by thyroid hormone. Endocrinology 138:3359–3368[Abstract/Free Full Text]
  14. Guadano-Ferraz A, Obregon MJ, St. Germain DL, Bernal J 1997 The type 2 iodothyronine deiodinase is expressed primarily in glial cells in the neonatal rat brain. Proc Natl Acad Sci USA 94:10391–10396[Abstract/Free Full Text]
  15. Diano S, Naftolin F, Goglia F, Horvath TL 1998 Fasting-induced increase in type II iodothyronine deiodinase activity and messenger ribonucleic acid levels is not reversed by thyroxine in the rat hypothalamus. Endocrinology 139:2879–2884[Abstract/Free Full Text]
  16. Oppenheimer JH, Schwartz HL 1997 Molecular basis of thyroid hormone-dependent brain development. Endocr Rev 18:462–475[Abstract/Free Full Text]
  17. Bernal J, Guadano-Ferraz A, Morte B 2003 Perspectives in the study of thyroid hormone action on brain development and function. Thyroid 13:1005–1012[CrossRef][Medline]
  18. Darras VM, Hume R, Visser TJ 1999 Regulation of thyroid hormone metabolism during fetal development. Mol Cell Endocrinol 151:37–47[CrossRef][Medline]
  19. Prati M, Calvo R, Morreale G, Morreale de Escobar G 1992 L-Thyroxine and 3,5,3'-triiodothyronine concentrations in the chicken egg and in the embryo before and after the onset of thyroid function. Endocrinology 130:2651–2659[Abstract]
  20. Forrest D, Sjoberg M, Vennstrom B 1990 Contrasting developmental and tissue-specific expression of {alpha} and ß thyroid hormone receptor genes. EMBO J 9:1519–1528[Medline]
  21. Flamant F, Samarut J 1998 Involvement of thyroid hormone and its {alpha} receptor in avian neurulation. Dev Biol 197:1–11[CrossRef][Medline]
  22. Gereben B, Bartha T, Tu HM, Harney JW, Rudas P, Larsen PR 1999 Cloning and expression of the chicken type 2 iodothyronine 5'-deiodinase. J Biol Chem 274:13768–13776[Abstract/Free Full Text]
  23. Larsen PR, Dick TE, Markovitz BP, Kaplan MM, Gard TG 1979 Inhibition of intrapituitary thyroxine to 3.5.3'-triiodothyronine conversion prevents the acute suppression of thyrotropin release by thyroxine in hypothyroid rats. J Clin Invest 64:117–128
  24. Salvatore D, Tu H, Harney JW, Larsen PR 1996 Type 2 iodothyronine deiodinase is highly expressed in human thyroid. J Clin Invest 98:962–968[Medline]
  25. Berry MJ, Kates AL, Larsen PR 1990 Thyroid hormone regulates type I deiodinase messenger RNA in rat liver. Mol Endocrinol 4:743–748[Abstract]
  26. Gereben B, Kollar A, Harney JW, Larsen PR 2002 The mRNA structure has potent regulatory effects on type 2 iodothyronine deiodinase expression. Mol Endocrinol 16:1667–1679[Abstract/Free Full Text]
  27. Decuypere E, Dewil E, Kühn ER 1990 The hatching process and the role of hormones. In: Tullett SC, ed. Avian incubation. London: Butterworths; 239–256
  28. Beckett GJ, Arthur JR 1994 The iodothyronine deiodinases and 5' deiodination. Baillieres Clin Endocrinol Metab 8:285–304[CrossRef][Medline]
  29. Thommes RC, Vieth RL, Levasseur S 1977 The effects of hypophysectomy by means of surgical decapitation on thyroid function in the developing chick embryo. I. Plasma thyroxine. Gen Comp Endocrinol 31:29–36[CrossRef][Medline]
  30. Visser TJ, Kaplan MM, Leonard JL, Larsen PR 1983 Evidence for two pathways of iodothyronine 5'-deiodination in rat pituitary that differ in kinetics, propylthiouracil sensitivity, and response to hypothyroidism. J Clin Invest 71:992–1002
  31. Pachucki J, Ambroziak M, Tanski Z, Luczak J, Nauman J, Nauman A Atypical high KM and PTU-insensitive deiodinase activity isolated from the human granulomatosus kidney tissue. Program of the 82nd Annual Meeting of The Endocrine Society, Toronto, Canada, 2000, p 387 (Abstract 1617)
  32. Reyns GE, Venken K, Morreale de Escobar G, Kuhn ER, Darras VM 2003 Dynamics and regulation of intracellular thyroid hormone concentrations in embryonic chicken liver, kidney, brain, and blood. Gen Comp Endocrinol 134:80–87[CrossRef][Medline]
  33. Van der Geyten S, Van den Eynde I, Segers IB, Kuhn ER, Darras VM 2002 Differential expression of iodothyronine deiodinases in chicken tissues during the last week of embryonic development. Gen Comp Endocrinol 128:65–73[CrossRef][Medline]
  34. Contempre B, Jauniaux E, Calvo R, Jurkovic D, Campbell S, de Escobar GM 1993 Detection of thyroid hormones in human embryonic cavities during the first trimester of pregnancy. J Clin Endocrinol Metab 77:1719–1722[Abstract]
  35. Thorpe-Beeston JG, Nicolaides KH, Felton CV, Butler J, McGregor AM 1991 Maturation of the secretion of thyroid hormone and thyroid-stimulating hormone in the fetus. N Engl J Med 324:532–536[Abstract]
  36. Galton VA, Martinez E, Hernandez A, St. Germain EA, Bates JM, St. Germain DL 1999 Pregnant rat uterus expresses high levels of the type 3 iodothyronine deiodinase. J Clin Invest 103:979–987[Medline]
  37. Roti E, Braverman LE, Fang SL, Alex S, Emerson CH 1982 Ontogenesis of placental inner ring thyroxine deiodinase and amniotic fluid 3,3',5'-triiodothyronine concentration in the rat. Endocrinology 111:959–963[Abstract]
  38. Chan S, Kachilele S, McCabe CJ, Tannahill LA, Boelaert K, Gittoes NJ, Visser TJ, Franklyn JA, Kilby MD 2002 Early expression of thyroid hormone deiodinases and receptors in human fetal cerebral cortex. Brain Res Dev Brain Res 138:109–116[CrossRef][Medline]
  39. Croteau W, Davey JC, Galton VA, St. Germain DL 1996 Cloning of the mammalian type II iodothyronine deiodinase. A selenoprotein differentially expressed and regulated in human and rat brain and other tissues. J Clin Invest 98:405–417[Medline]
  40. Burmeister LA, Pachucki J, St. Germain DL 1997 Thyroid hormones inhibit type 2 iodothyronine deiodinase in the rat cerebral cortex by both pre- and posttranslational mechanisms. Endocrinology 138:5231–5237[Abstract/Free Full Text]
  41. Rogers LJ 1995 The development of brain and behaviour in the chicken. Walingford, UK: CAB International
  42. Guadano-Ferraz A, Escamez MJ, Rausell E, Bernal J 1999 Expression of type 2 iodothyronine deiodinase in hypothyroid rat brain indicates an important role of thyroid hormone in the development of specific primary sensory systems. J Neurosci 19:3430–3439[Abstract/Free Full Text]
  43. Munoz A, Bernal J 1997 Biological activities of thyroid hormone receptors. Eur J Endocrinol 137:433–445[CrossRef][Medline]
  44. Asteria C 1998 Crucial role for type II iodothyronine deiodinase in the metabolic coupling between glial cells and neurons during brain development. Eur J Endocrinol 138:370–371[CrossRef][Medline]
  45. Fekete C, Gereben B, Doleschall M, Harney JW, Dora JM, Bianco AC, Sarkar S, Liposits Z, Rand W, Emerson C, Kacskovics I, Larsen PR, Lechan RM 2004 Lipopolysaccharide induces type 2 iodothyronine deiodinase in the mediobasal hypothalamus: implications for the nonthyroidal illness syndrome. Endocrinology 145:1649–1655[Abstract/Free Full Text]
  46. Schneider MJ, Fiering SN, Pallud SE, Parlow AF, St. Germain DL, Galton VA 2001 Targeted disruption of the type 2 selenodeiodinase gene (DIO2) results in a phenotype of pituitary resistance to T4. Mol Endocrinol 15:2137–2148[Abstract/Free Full Text]
  47. Silva JE, Larsen PR 1977 Pituitary nuclear 3,5,3'-triiodothyronine and thyrotropin secretion: an explanation for the effect of thyroxine. Science 198:617–620[Abstract/Free Full Text]
  48. Gregory CC, Dean CE, Porter TE 1998 Expression of chicken thyroid-stimulating hormone ß-subunit messenger ribonucleic acid during embryonic and neonatal development. Endocrinology 139:474–478[Abstract/Free Full Text]
  49. Yoshimura T, Yasuo S, Watanabe M, Iigo M, Yamamura T, Hirunagi K, Ebihara S 2003 Light-induced hormone conversion of T4 to T3 regulates photoperiodic response of gonads in birds. Nature 426:178–181[CrossRef][Medline]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
A. Zeold, M. Doleschall, M. C. Haffner, L. P. Capelo, J. Menyhert, Z. Liposits, W. S. da Silva, A. C. Bianco, I. Kacskovics, C. Fekete, et al.
Characterization of the Nuclear Factor-{kappa}B Responsiveness of the Human dio2 Gene
Endocrinology, September 1, 2006; 147(9): 4419 - 4429.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
C H J Verhoelst, V M Darras, S A Roelens, G M Artykbaeva, and S Van der Geyten
Type II iodothyronine deiodinase protein in chicken choroid plexus: additional perspectives on T3 supply in the avian brain
J. Endocrinol., October 1, 2004; 183(1): 235 - 241.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/8/3619    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gereben, B.
Right arrow Articles by Fekete, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gereben, B.
Right arrow Articles by Fekete, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals