| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Endocrinology and Research Service, G.V. (Sonny) Montgomery Veterans Affairs Medical Center and University of Mississippi Medical Center, Jackson, Mississippi 39216
Address all correspondence and requests for reprints to: Elise P. Gomez-Sanchez, D.V.M., Ph.D., Division of Endocrinology, University of Mississippi Medical Center, 2500 North State Street, Jackson, Mississippi 39216. E-mail: elise.gomezsanchez{at}med.va.gov.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The apparent similarity in the regulation of aldosterone secretion between the adrenal zona glomerulosa cells and endothelial cells raised the possibility that these cells could be very useful for the study of signal transduction pathways leading to aldosterone secretion. Because there were many unanswered questions, primarily of steroid quantification, in the several reports of aldosterone biosynthesis in human endothelial cells and in the unusually high efficiency of the transformation of DOC to aldosterone, we studied human umbilical vein endothelial cells (HUVECs) and human pulmonary artery endothelial cells (HPAECs) using a protocol and cells similar to that reported (17). Much to our chagrin, our results failed to demonstrate aldosterone biosynthesis in human endothelial cells.
| Materials and Methods |
|---|
|
|
|---|
Production of aldosterone by endothelial cells incubated with Ang II, ACTH, potassium, and deoxycorticosterone
After the cells had reached confluence, they were incubated in triplicate with Ang II (106108 M), ACTH (1081010 M), and K+ (79 mM) in the respective incubation media without FBS (endothelial cell basal media without hydrocortisone in the case of cells from Clonetics) for 24 h. The media were then collected and replaced with incubation media containing 1 µM deoxycorticosterone in addition to new Ang II, ACTH, or K+ as above. After incubating for another 24 h, the incubation media were collected. The wells were then trypsinized and cells counted for use in the calculations.
HUVECs from Clonetics were also cultured in 175-cm2 flasks, and the supernatant was extracted as described below.
Aldosterone measurements
The media were extracted using Bond Elut Extraction Cartridge (Varian, Harbor City, CA) that had been washed with dichloromethane and methanol followed by equilibration with purified water. After passing the media through the cartridge, it was washed with distilled water, and then the steroid was eluted with dichloromethane and collected into silanized tubes (chlorotrimethylsilane; Sigma-Aldrich, St. Louis, MO). The dichloromethane extract was washed with distilled water, evaporated under dry air and reconstituted in 200 µl of ELISA buffer (PBS + 0.5% BSA). The assay was done with 50 µl of the reconstituted extract. The recovery of the steroids by this procedure using tritiated aldosterone was found to be approximately 92%. The ELISA for aldosterone was done using a very specific and sensitive monoclonal antibody and a biotin-avidin peroxidase system as described by us (18, 19). The blank of the system was indistinguishable from zero, the sensitivity of the ELISA was 1 pg/well (2.76 fmol/well), and the interassay variability was approximately 10%. All samples from an experiment were measured in the same assay.
RT-PCR of CYP11B2 RNA from HUVECs and HPAECs
HUVECs were grown in two 175-cm2 tissue culture flasks (Greiner, Longwood, FL) until confluent. The media in the first flask was replaced with serum-free media, and this served as the control. The cells in the second flask were incubated with serum-free media containing Ang II 107 mmol/liter. After 24 h of incubation, the media were removed and cells were lysed for total RNA using Ultraspec-II RNA Isolation System (Biotecx Laboratories, Inc., Houston, TX). HPAECs were grown and incubated similarly, but mRNA was Isolated using MicroPoly (A) Pure mRNA Purification Kit (Ambion, Austin, TX).
First-strand cDNA was synthesized using Superscript II RNase H reverse transcriptase from Invitrogen Life Technologies. The cDNA was used in PCR. The sequence of primers for CYP11B2 was B2-S: TACAGGTTTTCCTCTACTCG, B2-AS: AGATGCAAGACTAGTTAATC, ß- actin-S: GGGAAATCGTGCGTGACATTAAG, ß-actin-AS: TGTGTTGGCGTACAGGTCTTTG. The samples were then subjected to 30 and 50 cycles; only 25 cycles were used for ß-actin. Positive controls included mRNA from tissues with a low abundance of message for the aldosterone synthase, the human corpus callosum and thalamus, and from whole adrenal glands. The negative controls were RT-PCRs done in the absence of RT.
| Results |
|---|
|
|
|---|
RT-PCR using specific primers with total RNA or mRNA also failed to demonstrate bands corresponding to the aldosterone synthase even after 50 cycles of PCR (Figs. 1
and 2
). As controls, human corpus callosum and thalamus mRNA was used. Although no bands were seen at 30 cycles, strong appropriate bands were obtained at 50 cycles. Whole adrenal mRNA gave strong bands as expected at 30 cycles.
|
|
| Discussion |
|---|
|
|
|---|
To understand the possible reasons for the difference between our findings and those of Takedas group, we have analyzed their results using the information provided in the Materials and Methods section of their paper (17). They report using a commercial RIA for aldosterone with a sensitivity of 5 fmol/tube (1.38 pg aldosterone/tube), HPLC recovery of 7080%, number of cells incubated 2.5 x 105 x 24 h, with results reported as fmol/106 cells x 24 h. Minimal optimal detectable steroid, based on reported data from above, assuming measurements done in duplicate with a recovery as implied (80%) is approximately 50 fmol/well. Using these details provided in Materials and Methods, it is difficult to understand how a time course was performed because the results indicated that aldosterone levels increased to 8 ± 0.3 fmol at 6 h, 18 ± 0.9 fmol at 12 h, and 30 ± 4 fmol at 24 h, well below the level of detection according to the methods section (17). Our ELISA method is more sensitive than the RIA described by Takeda et al. (17). Its sensitivity is 2.76 fmol/ELISA well, with a recovery of 92%, because the method involves only an extraction. About twice the number of cells, approximately 4 x 105 cells/well, were used in our studies. With the cells done in triplicate and each well aliquot representing 25% of the total extract, our sensitivity is approximately 25 fmol/106 cells. We were unable to detect any aldosterone production. Sensitivity was increased by using 175 cm2 flasks containing approximately 2 x 107 cells to approximately 0.5 fmol/106 cells, yet we still were unable to detect any aldosterone.
The conversion rate of [14C] DOC to aldosterone in HUVEC was reported to be extremely high (17), 29 ± 5.8% in cells incubated with 107 M Ang II. Moreover, the sum of the conversion of DOC to labeled aldosterone, corticosterone, and 18-hydroxycorticosterone in this experiment was reported to be 157% of the [14C] DOC substrate, which is unrealistic. By comparison, adrenal glands, which express 1000 times the amount of aldosterone synthase than vascular tissue exhibit conversion rates of 46% (21). For the study of the conversion of [14C]-DOC to aldosterone, they used 0.5 µmol/liter of [14C]-DOC and found a conversion rate of 29% in cells incubated with Ang II (107 M). At this rate, aldosterone production would have been approximately 1160 fmol/106 cells·24 h. We incubated our cells with 1 µmol/liter DOC but failed to demonstrate any conversion.
RT-PCR for the CYP11B2 enzyme mRNA was not detectable after 50 cycles, whereas it was easily detectable using the same primers and RNA from human corpus callosum and thalamus, both low abundance tissues (20).
In conclusion, we have been unable to detect mRNA for the aldosterone synthase gene or aldosterone production by cultured endothelial cells derived from several sources. The explanation for the discrepancy between our results and those of Takeda is not apparent, even after careful analysis of their results using the methods described in the same report.
Furthermore, the undetectable levels of aldosterone in adrenalectomized animals cannot be reconciled with recent reports that the vascular endothelial and smooth muscle cells and heart tissue are sites of abundant aldosterone production because their cumulative mass is certainly several thousand more times than that of the adrenal zona glomerulosa.
Given the experimental and clinical data demonstrating a pathophysiological role for excessive activation of mineralocorticoid receptor in end-stage heart and renal disease and the increasing therapeutic use of mineralocorticoid receptor antagonists in the these conditions (22, 23, 24), continued investigation of the extraepithelial actions, as well as the extraadrenal synthesis of aldosterone and its regulation is very important. There remain enough doubts about the evidence presented so far to question the significance of aldosterone synthesis by endothelial cells. Existing studies need to be reevaluated and new ones performed until the phenomenon is clear.
| Footnotes |
|---|
Abbreviations: Ang II, Angiotensin II; DOC, deoxycorticosterone; FBS, fetal bovine serum; HPAECs, human pulmonary artery endothelial cells; HUVECs, human umbilical vein endothelial cells.
Received January 23, 2004.
Accepted for publication April 20, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Karagiannis, K. Tziomalos, A. I Kakafika, V. G Athyros, F. Harsoulis, and D. P Mikhailidis Medical treatment as an alternative to adrenalectomy in patients with aldosterone-producing adenomas Endocr. Relat. Cancer, September 1, 2008; 15(3): 693 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Siragy and C. Xue Local renal aldosterone production induces inflammation and matrix formation in kidneys of diabetic rats Exp Physiol, July 1, 2008; 93(7): 817 - 824. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Otani, F. Otsuka, K. Inagaki, J. Suzuki, T. Miyoshi, Y. Kano, J. Goto, T. Ogura, and H. Makino Aldosterone Breakthrough Caused by Chronic Blockage of Angiotensin II Type 1 Receptors in Human Adrenocortical Cells: Possible Involvement of Bone Morphogenetic Protein-6 Actions Endocrinology, June 1, 2008; 149(6): 2816 - 2825. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. C. Connell, S. M. MacKenzie, E. M. Freel, R. Fraser, and E. Davies A Lifetime of Aldosterone Excess: Long-Term Consequences of Altered Regulation of Aldosterone Production for Cardiovascular Function Endocr. Rev., April 1, 2008; 29(2): 133 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-C. Lam, S.-M. Kuo, M.-J. Chuang, H.-M. Keng, P.-R. Lin, G.-S. Liu, C.-M. Hsu, S.-L. Howng, and M.-H. Tai Blockade of endothelin-1 release contributes to the anti-angiogenic effect by pro-opiomelanocortin overexpression in endothelial cells. Experimental Biology and Medicine, June 1, 2006; 231(6): 782 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Schiffrin Effects of Aldosterone on the Vasculature Hypertension, March 1, 2006; 47(3): 312 - 318. [Full Text] [PDF] |
||||
![]() |
T. Sugiyama, T. Yoshimoto, K. Tsuchiya, N. Gochou, Y. Hirono, T. Tateno, N. Fukai, M. Shichiri, and Y. Hirata Aldosterone Induces Angiotensin Converting Enzyme Gene Expression via a JAK2-Dependent Pathway in Rat Endothelial Cells Endocrinology, September 1, 2005; 146(9): 3900 - 3906. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Z. Jaffe and M. E. Mendelsohn Angiotensin II and Aldosterone Regulate Gene Transcription Via Functional Mineralocortocoid Receptors in Human Coronary Artery Smooth Muscle Cells Circ. Res., April 1, 2005; 96(6): 643 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Gomez-Sanchez, N. Ahmad, D. G. Romero, and C. E. Gomez-Sanchez Is aldosterone synthesized within the rat brain? Am J Physiol Endocrinol Metab, February 1, 2005; 288(2): E342 - E346. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |