help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2004-0053
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chanoine, J.-P.
Right arrow Articles by Wong, A. C. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chanoine, J.-P.
Right arrow Articles by Wong, A. C. K.
Endocrinology Vol. 145, No. 8 3813-3820
Copyright © 2004 by The Endocrine Society

Ghrelin Gene Expression Is Markedly Higher in Fetal Pancreas Compared with Fetal Stomach: Effect of Maternal Fasting

Jean-Pierre Chanoine and Alfred C. K. Wong

Endocrinology and Diabetes Unit, British Columbia’s Children’s Hospital, University of British Columbia, Vancouver, British Columbia, Canada V6H 3V4

Address all correspondence and requests for reprints to: Jean-Pierre Chanoine, M.D. Ph.D., Endocrinology and Diabetes Unit, Room K4-212, British Columbia’s Children’s Hospital, 4480 Oak Street, Vancouver, British Columbia, Canada V6H 3V4. E-mail: jchanoine{at}cw.bc.ca.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ghrelin is an orexigenic peptide secreted mainly by the stomach in adult rats. Ghrelin concentrations increase with fasting and decrease after food intake. Ghrelin is also present in the placenta and in the fetal stomach, but the role of fetal ghrelin remains unclear. In this study, we compared changes in plasma ghrelin, insulin, and glucose concentrations and in ghrelin gene expression in stomach, pancreas, and placenta in response to fasting and feeding in adult nonpregnant rats and in 20-d pregnant dams and their fetuses. Plasma total ghrelin concentrations were three times higher in the fetus than in the dam but did not increase in response to fasting. In contrast to total ghrelin, plasma active ghrelin concentrations wee 50% lower in the fetus compared with the adult pregnant rat. Ghrelin mRNA and total ghrelin were markedly elevated in the fetal pancreas and six to seven times greater than in the fetal stomach but were not affected by fasting. In contrast, fetal pancreas and stomach active ghrelin concentrations increased two to three times after maternal fasting. Ghrelin receptor mRNA was present in all fetal pancreas samples. Placenta ghrelin gene expression was detectable but low. These data raise the possibility that in the fetus, in contrast to the adult, the pancreas and not the stomach is a major source of circulating immunoreactive ghrelin. Furthermore, the presence of a strong ghrelin gene expression and of ghrelin receptor mRNA in the fetal pancreas is intriguing and suggests that ghrelin may play an important role in ß-cell development.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
GHRELIN IS A 28-AMINO-ACID peptide secreted mainly by the gastrointestinal tract (stomach, duodenum, and jejunum) (1, 2, 3). It is also present in the placenta (4), the hypothalamus (3), and the pancreas (5, 6). Ghrelin potently stimulates appetite and GH secretion in both humans (7, 8, 9) and rodents (10, 11, 12). The orexigenic effect of ghrelin is independent of GH secretion (12).

Cummings et al. (13) found that ghrelin concentrations increase with fasting before the three main meals of the day, decrease quickly after food intake, and reach a nadir 90 min after the meal (13, 14), raising the possibility that ghrelin may play a role in meal initiation. A similar effect has been observed in rodents with fasting and refeeding (15).

The relationship between ghrelin, insulin, and glucose remains unclear. There is a reciprocal change in plasma ghrelin and insulin concentrations in normal subjects after a meal (13, 16). Most human and animal studies have shown that hyperglycemia (17, 18) and insulin (without hypoglycemia) (18, 19, 20, 21) decrease plasma ghrelin, although debate continues (22). Animal studies have also shown that hyperglycemia (23) and insulin-induced hypoglycemia (15) markedly decrease and increase, respectively, ghrelin concentrations in rodents (reviewed in Ref.24).

In human neonates, we demonstrated the presence of large amounts of ghrelin in umbilical cord plasma samples (25, 26). In rodents, ghrelin mRNA is present in the stomach by embryonic d 17 of gestation and increases markedly during the first postnatal weeks (27, 28, 29). The increase in plasma ghrelin concentrations in response to fasting is present in rats by the end of the first postnatal week (27, 28). Interestingly, in humans, ghrelin is abundant in the fetal pancreas (but not the adult pancreas) where ghrelin-secreting cells represent up to 10% of the endocrine cells (5).

The role of ghrelin in the fetus remains unclear. In contrast to the adult in whom feeding and fasting periods alternate, the fetus receives nutrients on a continuous basis through the placenta, and changes in fetal insulin and glucose concentrations depend on variations in maternal food intake (30). We were intrigued by the abundance of ghrelin in the fetal compared with the adult human pancreas and by the fact that, at least in the adult rat, ghrelin appears to affect insulin secretion by the pancreas. Both stimulatory (31, 32, 33) and inhibitory (34, 35) effects of ghrelin on insulin secretion have been reported. We hypothesized that ghrelin tissue distribution may differ in the adult rat and in the fetus and that maternal fasting and feeding may alter fetal circulating and tissue ghrelin. To this end, we compared changes in plasma ghrelin, insulin, and glucose concentrations and in ghrelin gene expression in stomach, pancreas, and placenta in response to fasting and feeding in nonpregnant rats and in pregnant dams and their fetuses. Our results show that in contrast to the adult rat, fetal total ghrelin concentrations do not increase in response to maternal fasting despite significant decreases in plasma glucose and insulin concentrations. In addition, we observed that tissue ghrelin gene expression was much higher in the fetal pancreas compared with the fetal stomach, a situation opposite to the one observed in pregnant and nonpregnant adult rats where ghrelin was barely detectable in the pancreas.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Experiments
Sprague Dawley rats (9 wk old at the time of the experiment), obtained from Charles River Laboratories (St. Constant, Quebec, Canada) were used in all experiments. The animals were housed two to three per cage for 1 wk before the experiments. Water was provided ad libitum. Animals were killed by decapitation after isoflurane (5%) anesthesia. The experiments were approved by the University of British Columbia animal ethics committee.

Effect of feeding, fasting, and refeeding on plasma ghrelin and insulin concentrations
Twenty-one nonpregnant female and 21 time-pregnant (20 d of gestation) animals were used. Animals were fed ad libitum, fasted for 36 h, or refed for 6 h after a 36-h fast (n = 7 per group). One plasma EDTA aliquot was collected from each adult rat. Fetal EDTA plasma was pooled from two to three dams (n = 3 samples per group of seven dams). Total ghrelin and insulin immunoreactivity was determined on all plasma samples.

Effect of feeding and fasting on plasma ghrelin, insulin, and glucose concentrations and on tissue ghrelin and ghrelin receptor gene expression
Thirteen nonpregnant female and 13 time-pregnant (20 d of gestation) animals were used. Animals were fed ad libitum or fasted for 36 h (n = 6–7 per group). One microliter of fetal or adult truncal blood was used at the time of the experiment to determine plasma glucose concentrations. Plasma EDTA was collected from each adult rat and from all fetuses in one litter and pooled as one sample. Plasma concentrations of total ghrelin and insulin were determined in all samples (plasma EDTA without additives). In addition, plasma concentrations of active ghrelin were determined in all maternal and fetal samples [plasma EDTA with addition of 50 µl of phenylmethylsulfonyl fluoride (10 mg/ml solution) and 50 µl 1 N HCl per ml]. All samples were kept on ice until centrifugation and stored thereafter at –80 C until the assay was performed. Stomach (gastric fundus in adult rats and entire stomach in fetuses) and the entire pancreas were collected. The placentas from four fetuses (two from each uterine horn) in the same litter were pooled as one sample. All tissue samples were immediately frozen at –80 C for later determination of total and active ghrelin concentrations and of ghrelin and ghrelin receptor mRNA, as appropriate.

Hormone determinations
Ghrelin circulates in two forms: a biologically active (octanoylated) and inactive (des-octanoylated) form. In these experiments, plasma total (active + inactive) ghrelin (RK-031-30 from Phoenix Pharmaceuticals, Belmont, CA, in the first experiment and GHRT-89HK from Linco Research, St. Charles, MO, in the second experiment), active ghrelin (GHRA-88HK, Linco), and insulin (RI-13K, Linco) immunoreactivities were determined by RIA. All determinations in one experiment were performed in duplicate in the same assay. Glucose was determined by the glucose oxidase method using OneTouch Ultra (LifeScan Canada, Burnaby, Canada).

Ghrelin and ghrelin receptor RT-PCR
Ghrelin and ghrelin receptor mRNAs were estimated by RT-PCR as described by Gualillo et al. (4) with slight modifications and the results normalized for ß-actin. Total RNA was extracted using TRIzol reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s protocol. Two micrograms of total RNA were used for RT. cDNAs were synthesized using 200 U of Moloney murine leukemia reverse transcriptase (Life Technologies) and 6 µl of dNTPs mix (10 mM of each dNTP), 6 µl of first-strand buffer [250 mM Tris-HCl (pH 8.3), 375 mM KCl, 15 mM MgCl2 (Life Technologies), 2.75 µl random hexamers solution (200 ng/µl; Invitrogen Life Technologies, Burlington, Ontario, Canada), and 0.25 µl RNase Out (recombinant ribonuclease inhibitor, 40 U/µl; Invitrogen) in a total volume of 30 µl. Reaction mixtures were incubated at 37 C for 50 min and at 42 C for 15 min. The reaction was stopped by heating at 95 C for 5 min and subsequently quick chilled on ice. Three microliters of RT reaction were used for PCR amplification. The amplification conditions were as follows: 5 µl of PCR buffer [200 mM Tris-HCl (pH 8.4) and 500 mM KCl (Life Technologies)], 1.5 µl of 50 mM MgCl2, 4 µl of dNTPs mix (10 mM of each dNTP), 10 µl of 20% polyethylene glycol (ghrelin receptor only), 2 µl of 10 µM solutions of upstream and downstream primers, and 2.0 U of Taq DNA polymerase (Life Technologies) in a 50-µl reaction volume. We used the following primers: rat ghrelin, upstream primer 5'-TTGAGCCCAGAGCACCAGAAA-3' and downstream primer 5'-AGTTGCAGAGGAGGCAGAAGCT-3' (from GenBank AB029433) (4); rat ghrelin receptor, upstream primer 5'-AGGCAACCTGCTCACTATGCTG-3' and downstream primer 5'-GACAAGGATGACCAGCTTCACG-3' (from GenBank NM 032075) (36, 37).

The amplification profile for ghrelin was denaturation at 94 C for 30 sec, annealing at 58 C (ghrelin) or 65 C (ghrelin receptor) for 30 sec, and extension at 72 C for 1 min. Amplification was completed with an additional step at 72 C for 10 min. The amplification was performed in an automatic thermal cycler (Techne Inc., Burlington, NJ). To normalize results for differences in RNA sampling, the second half of the RT reaction was used to amplify a 603 bp of the rat ß-actin (upstream primer, 5' TACAACTCCTTGCAGCTCC; downstream primer, 5' ATCTTCATGAGGTAGTCAGTC) (from GenBank AC121985).

To ensure that PCR was performed in the linear amplification range, samples of each tissue were taken every two to three cycles over a wide range, showing that the reaction was linear between 27 and 33 cycles for ghrelin and between 34 and 42 cycles for ghrelin receptor (data shown for pancreas; Fig. 1Go, A and B). PCRs were run at 31 (ghrelin) or 40 (ghrelin receptor) cycles. The number of cycles for ß-actin was 28 or 30 when run with ghrelin or ghrelin receptor, respectively. All reactions presented in a given figure were performed in the same assay.



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 1. RT-PCR analysis of ghrelin and ghrelin receptor mRNA in fetal rat pancreas. A and B, Kinetic analysis of the amplification of ghrelin and ghrelin receptor cDNAs by PCR. The band was linearly amplified between 27 and 33 cycles (ghrelin) and between 34 and 42 cycles (ghrelin receptor). Kinetic analysis was repeated for each tissue where RT-PCR was performed (shown for fetal pancreas). C and D, The identity of the amplimers was confirmed by restriction enzyme cleavage with ApaI (ghrelin) and MsP1 (ghrelin receptor). Two fragments of expected size were obtained. Lane 1, Fragments obtained after digestion of the product (138 bp and 209 bp for ghrelin, 142 bp and 180 bp for ghrelin receptor); lane 2, amplimer (347 bp for ghrelin and 322 bp for ghrelin receptor); lane 3, 100-bp ladder.

 
To confirm the specificity of the PCR product, the following steps were performed. Digestion of the ghrelin PCR product using Apal and of the ghrelin receptor PCR product using MsP1 liberated two DNA fragments with the expected size, suggesting that the amplified products were indeed ghrelin (a 347-bp product that spans through the first and fourth exons) and ghrelin receptor (a 322-bp product located in the first exon of the gene), respectively (Fig. 1Go, C and D). In addition, multiple negative controls were made by omitting the reverse transcriptase from the reactions, suggesting that the PCR product obtained was not amplified genomic DNA. Finally, both ghrelin and ghrelin receptor PCR products were sequenced and compared with the expected sequences.

PCR products were separated on 1.8% agarose gel, stained with ethidium bromide, examined with UV light, and visualized with a Gel Doc 1000 documentation system (Bio-Rad Laboratories, Inc., Hercules, CA).

Quantification of tissue ghrelin
Tissue ghrelin was extracted as described by Toshinai et al. (15) with slight modifications. Aliquots of stomach, pancreas, or placenta were minced and boiled at 98 C for 10 min in 1 ml of water to inactivate intrinsic proteases. After the samples were cooled to 4 C for 2–3 min, acetic acid (CH3COOH) and hydrochloric acid (HCl) were added to the respective final concentrations of 1 M and 20 mM. The tissues were then homogenized in a polytron for 2 min, after which the homogenate was centrifuged at 13,000 x g for 15 min at 4 C. The supernatant was collected and lyophilized. After reconstitution in 10 mM phosphate buffer with 10 mM EDTA, 0.1% gelatin, 0.08% sodium azide (pH 6.85), total or active ghrelin was measured by the appropriate RIA.

Statistical analysis
Data are presented as mean (95% confidence interval) or median (range) as appropriate. Statistical analysis was performed by two-way ANOVA, with factors as follows: grouping (nonpregnant, pregnant, and fetus), feeding status (fed, fasting, and refed), or tissue (pancreas, stomach, and placenta) as appropriate. A P value < 0.05 was regarded as significant. Means and 95% confidence intervals were used to perform comparisons and to define significance between individual subgroups.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effect of feeding, fasting, and refeeding on plasma ghrelin and insulin concentrations
Body weight was significantly affected by grouping and by feeding status (P < 0.001). In nonpregnant adult rats, mean (95% confidence interval) body weight was 210 (195–225) g in fed animals, decreased to 183 (168–197) g in fasting animals and increased back to 201 (186–216) g after refeeding for 6 h. In the pregnant group, weight was 338 (324–353) g, 271 (256–286) g, and 299 (284–314) g in the fed, fasting, and refed groups, respectively. Median (range) number of fetuses per dam was 10 (3–13) and was not affected by maternal feeding state.

Plasma total ghrelin concentrations (Phoenix Pharmaceuticals) were significantly affected by grouping and by feeding state (P < 0.001) (Fig. 2AGo). In adult rats, fasting caused a significant 91% increase in plasma ghrelin concentrations in nonpregnant female rats [from 748 (634–862) to 1424 (1310–1539) pg/ml] and a significant 34% increase in 21-d pregnant dams [from 863 (749–977) to 1159 (1044–1273) pg/ml]. After free access to food for 6 h, plasma ghrelin concentrations decreased toward fed values in both nonpregnant rats [834 (720–849) pg/ml] and pregnant dams [877 (763–991) pg/ml]. Ghrelin concentrations were two to three times higher in fetuses compared with pregnant and nonpregnant female rats. In addition, in contrast to what was observed in adult rats, plasma ghrelin concentrations decreased significantly from 2557 (2382–2731) pg/ml in the fetuses from fed dams to 2246 (2071–2421) pg/ml in fetuses from fasting dams and further to 2145 (1970–2320) pg/ml after refeeding. Plasma insulin concentrations were significantly affected by grouping and feeding state (P < 0.001). Fasting caused a decrease in plasma insulin concentrations and refeeding an increase toward fed values in all three groups (Fig. 2BGo).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 2. Plasma ghrelin (Phoenix Pharmaceuticals) (A) and insulin (B) concentrations in nonpregnant (NP; n = 7 per group), 20-d pregnant (P; n = 7 per group) Sprague Dawley female rats and their fetuses (n = 3 per group) (mean + SD). Plasma ghrelin and insulin concentrations were significantly affected by grouping and feeding state (P < 0.001). (For insulin, ng/ml x 7.18 = pmol/liter.)

 
Effect of feeding and fasting on plasma ghrelin, insulin, and glucose concentrations and on placenta, stomach, and pancreas ghrelin gene expression
In the first experiment, in contrast to what was observed in adult animals, fetal plasma concentrations of total immunoreactive ghrelin did not increase in response to maternal fasting. To understand the basis for the differential ghrelin regulation between the adult and fetal rat, we repeated the experiment in a new group of animals and determined plasma as well as tissue ghrelin concentrations. In addition, to determine both active and total circulating and tissue ghrelin concentrations, we used kits from Linco Research, a company that offers RIAs for the determination of both forms of ghrelin.

In nonpregnant rats, mean (95% confidence interval) body weight was 212 (197–226) g and 176 (162–190) g and in pregnant rats 316 (301–330) g and 278 (265–292) g in fed and fasting animals, respectively (P < 0.001 for both pregnancy and feeding state). Median (range) number of fetuses per dam was 8 (3–11).

Similar to what we observed with the Phoenix assay in the first experiment, we confirm with the Linco assay that plasma total ghrelin concentrations were significantly affected by grouping (P < 0.001) and by feeding state (P = 0.004) (Fig. 3AGo). Fasting caused a significant 40–45% increase in plasma ghrelin concentrations both in nonpregnant rats [from 2565 (2115–3015) to 3690 (3274–4106) pg/ml] and in 20-d pregnant dams [from 2171 (1722–2621) to 3090 (2673–3506) pg/ml]. Plasma total ghrelin concentrations were markedly higher in fetuses compared with pregnant and nonpregnant female rats and were not affected by maternal state of nutrition [7096 (6774–7419) pg/ml]. In contrast, plasma active ghrelin was significantly higher in dams [45 (36–53) pg/ml] compared with their fetuses [24 (16–33) pg/ml] (P = 0.003) but were not affected by maternal nutrition (Fig. 3BGo).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 3. Plasma total (A) and active (B) ghrelin (Linco Research), glucose (C), and insulin (D) concentrations in nonpregnant (NP; n = 6–7 per group), pregnant (P; n = 6–7 per group) female Sprague Dawley rats and their fetuses (n = 6–7 per group) (mean + SD). Plasma total ghrelin, insulin, and glucose concentrations were significantly affected by feeding state (P < 0.005) and by grouping (P < 0.001). In contrast, plasma active ghrelin was significantly affected by grouping (P = 0.003) but not by feeding state. (For insulin, ng/ml x 7.18 = pmol/liter; for glucose, mg/dl·18 = mmol/liter.)

 
Plasma insulin and glucose concentrations were also significantly affected by feeding state and by grouping (P < 0.001 for both factors). Fasting caused a significant decrease in plasma insulin and glucose concentrations in adult nonpregnant rats as well as in the dams and their fetuses (Fig. 3Go, C and D). Plasma insulin and glucose concentrations were significantly higher and lower, respectively, in fetuses compared with adult rats in both fed and fasting animals.

To determine whether the higher plasma ghrelin concentrations observed in the fetus compared with the adult rat could be explained by differences in tissue gene expression, we determined ghrelin mRNA and protein in both the stomach and the pancreas of adult rats and rat fetuses (Fig. 4Go). Ghrelin mRNA and concentrations of total ghrelin were significantly affected by grouping (P < 0.001) and the type of tissue (P < 0.001) but not by feeding state. In adult rats, as expected, both ghrelin mRNA (estimated by RT-PCR, Fig. 4AGo) and total ghrelin tissue content (Fig. 4BGo) were markedly higher in the stomach compared with the pancreas, where ghrelin gene expression was barely detectable. Interestingly, stomach ghrelin/ß-actin ratio (expressed as percentage of stomach in the fed, nonpregnant group) was much lower [121% (51–193%)] in nonpregnant than in pregnant animals [468% (398–540%)]. Accordingly, stomach total ghrelin content was two to three times lower in nonpregnant [1791 (1080–2403) ng/g tissue] compared with pregnant rats [4676 (4064–5287) ng/g]. In rat fetuses, the opposite situation was observed. Ghrelin gene expression was markedly increased in the fetal pancreas compared with the fetal stomach. Ghrelin/ß-actin ratio was 568% (452–694%) in the pancreas compared with 84% (36–207%) percent in the stomach (expressed as percentage of the stomach in fetuses from fed dams) (Fig. 4CGo). Accordingly, pancreas total ghrelin content was 666 (601–731) ng/g tissue compared with 96 (31–161) ng/g in the fetal stomach (Fig. 4DGo). Thus, the stomach appears to be a tissue rich in total ghrelin in the adult but not in the fetus. In contrast, in the pancreas, ghrelin content is low in the adult rat but high in the fetus, raising the possibility that ghrelin may play a role in pancreas development. To test this hypothesis further, we investigated whether active ghrelin was detectable in fetal tissues and whether ghrelin receptor mRNA was expressed in fetal pancreas. The results show that active ghrelin represents 0.8% (0.5–1.0%) and 9% (4–13%) of total ghrelin in fetal pancreas and stomach, respectively. Active ghrelin concentrations were significantly affected by tissue (P = 0.009) and by feeding state (P = 0.001). In contrast to what was observed for tissue total ghrelin concentrations, maternal fasting caused an increase in fetal pancreas [2.5 (0.1–4.8) and 6.6 (4.6–8.6) ng/mg tissue in fed and fasting animals, respectively] and in fetal stomach [5.4 (3.2–7.6) and 9.6 (7.6–11.6) ng/mg tissue] (Fig. 4EGo). Ghrelin receptor mRNA was detected in all fetal pancreas samples and was not affected by maternal fasting.



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 4. Stomach and pancreas ghrelin gene expression in nonpregnant (NP) and pregnant (P) adult rats (A and B) and in rat fetuses (C–E). Ghrelin mRNA was estimated by RT-PCR. Ghrelin/ß-actin ratios are expressed as percentage of stomach ratio in the fed, nonpregnant group (A) or in fetuses from fed dams (C). Tissue total (B, adult NP and P rats; D, fetuses) and active (E, fetuses) ghrelin content was determined in stomach and pancreas by RIA after extraction and was expressed as nanograms per gram of tissue. Ghrelin mRNA and total ghrelin concentrations were significantly affected by grouping (P < 0.001) and the type of tissue (P < 0.001) but not by feeding state. Active ghrelin in the fetuses were significantly affected by tissue (P = 0.009) and by feeding state (P = 0.001).

 
Placental ghrelin mRNA was present in all samples as well as low tissue ghrelin concentrations [44 (38–51) ng/g tissue]. Placental ghrelin gene expression was not affected by maternal nutrition.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The results of our study demonstrate that total immunoreactive ghrelin is abundant in fetal plasma near term and 2- to 3-fold higher than in the pregnant and nonpregnant adult rat. However, fetal plasma ghrelin concentrations do not increase in response to fasting as they do in adult rats, despite similar changes in glucose and insulin concentrations, suggesting that fetal and postnatal ghrelin may be regulated in a different manner. To better understand this difference, we compared tissue ghrelin content in nonpregnant adult rats and in pregnant rats and their fetuses. We found that ghrelin gene expression was very high in the pancreas, but not in the stomach, of the rat fetus near term, suggesting that in contrast to the adult rat, the source of circulating fetal ghrelin may be the pancreas, and not the stomach.

Consistent with our data, ghrelin gene expression has been shown in fetal rodent stomach as early as on embryonic d 17 by RT-PCR and in situ hybridization (27, 28, 29) but not by the less sensitive technique Northern blot (38). Ghrelin mRNA and total ghrelin content was, however, low in the fetal stomach, a tissue traditionally considered as a major source of circulating ghrelin in the adult rat. This finding suggests that, in the fetus, the stomach may not be a major source of circulating ghrelin. In contrast, we observed much higher levels of ghrelin in fetal pancreas by RT-PCR, and fetal pancreas total ghrelin concentrations were six to seven times higher than in the fetal stomach. It seems likely therefore that ghrelin produced in the pancreas contributes to the fetal pool of circulating ghrelin. Ghrelin gene expression was also detected in the placenta. Although placental concentrations of total ghrelin were low, the large amount of placental tissue could potentially contribute to the fetal pool of ghrelin.

A key unanswered question is the potential role of pancreatic ghrelin in the fetus. Ghrelin immunoreactive cells had been previously observed in fetal mouse pancreatic islets (29). Two different groups recently demonstrated that ghrelin was present in a new cell type in fetal pancreas islets (39, 40). In addition, Prado et al. (40) proposed that insulin-producing ß-cells and ghrelin-producing cells (named {epsilon}-cells by the authors) may originate from a common precursor. These recent findings further raise the possibility that ghrelin may contribute to ß-cell development and function in the fetus, as is thought to be the case for glucagon (41). In support of this hypothesis, we confirmed the recent demonstration of ghrelin receptor mRNA in the fetal pancreas (39). We also show for the first time that the active form of ghrelin is present in fetal pancreas, where it represents 0.5–1% of total ghrelin, a proportion slightly lower than reported by Hosoda et al. (42) in adult rat pancreas using a different methodology. Based on these data, we speculate that ghrelin may have a role in islet development, a hypothesis that requires additional investigation through gene knockout studies.

Another interesting aspect of our study is the potential effect of maternal nutrition on fetal ghrelin. Maternal fasting did not affect fetal plasma total and active ghrelin or tissue total ghrelin but caused a 2- to 3-fold increase in both pancreas and stomach active ghrelin concentrations. Postnatally, plasma total ghrelin concentrations have been shown to be detectable in the rat from d 3, without clear age-related changes (27), whereas gastric ghrelin gene expression increases markedly during the first postnatal weeks (27, 28). The physiological fasting-associated rise in plasma total ghrelin is present as early as by the end of the first postnatal week (28). In adult rats, plasma ghrelin concentrations increase in fasting animals and decrease after meal ingestion, and these changes are associated with parallel changes in stomach ghrelin mRNA (15). Taken together, these data raise the possibility that postnatal activation of ghrelin gene expression may be associated with the onset of oral food intake. Additional studies will be needed to determine whether the changes in fetal pancreas and stomach active ghrelin concentrations observed in this study during maternal fasting can affect fetal development. So far, ghrelin knockout models have failed to show major phenotypic characteristics. However, to our knowledge, the function of the endocrine pancreas has not been studied in detail (43, 44).

In adult female rats, we observed the expected marked increase and decrease in circulating ghrelin in response to fasting and refeeding, respectively. Interestingly, there were no associated changes in ghrelin mRNA and protein content in the stomach. This finding suggests that during this short fast and refeed, changes in circulating ghrelin are likely caused by changes in secretion rather than synthesis of ghrelin. This contrasts with results in male Wistar (15) and Sprague Dawley (29) rats where a decrease in protein content and/or an increase in mRNA were found after 48 and 72 h of fast, respectively. Sexual dimorphism in ghrelin regulation has also been reported (27, 45). In addition, Liu et al. (46) recently reported discordant changes in gastric mRNA in two different strains of rats despite similar ghrelin responses to fasting. Taken together, these results suggest the existence of differential regulation of ghrelin gene expression according to gender and/or species.

In the pregnant rat, stomach ghrelin mRNA levels and plasma ghrelin concentrations remain stable throughout pregnancy (47). However, we observed a marked increase in both ghrelin mRNA and protein content in the fundus of the stomach from 20-d pregnant compared with nonpregnant dams. The reason for this finding is unclear. We hypothesize that although plasma total ghrelin concentrations are similar in nonpregnant female rats and pregnant dams, tissue ghrelin regulation may be affected by pregnancy. One hypothesis could be that the placenta contributes to the pool of circulating maternal ghrelin and that as a consequence, a significant proportion of the ghrelin preformed in the stomach is stored instead of being released in the circulation. Placental ghrelin could serve as a signal from the fetoplacental unit that contributes to the regulation of maternal food intake and energy homeostasis.

Plasma ghrelin concentrations were measured by different commercial assays in the two different experiments. Both RIAs (Phoenix in the first experiment, Linco in the second experiment) measure total ghrelin, both active (octanoylated) and inactive (des-octanoylated). Both assays provided similar information, but plasma ghrelin concentrations were markedly higher with the Linco compared with the Phoenix assay despite a similar experimental setting. We have previously encountered this discrepancy in two different studies performed in human neonates where umbilical cord plasma ghrelin concentrations were found to be three to four times higher when measured with the Linco assay (25) compared with the Phoenix assay (48). In these human studies, and in agreement with Groschl et al. (49), we have evidence that at least part of the difference could be accounted for by differences in the potency of the standards used to prepare the RIA standard curve in each assay (unpublished data). Although this situation is suboptimal, it is reassuring to see that both assays provide qualitatively similar results; plasma ghrelin concentrations were significantly higher in the fetus compared with the pregnant and nonpregnant adult rat, and fasting caused a significant increase in ghrelin concentrations in adult rats but not in fetuses.

In summary, we have demonstrated the existence of a marked elevation of ghrelin mRNA and protein content in the fetal pancreas compared with the adult pancreas. This raises the possibility that in the fetus, in contrast to the adult, the pancreas and not the stomach is a major source of circulating immunoreactive ghrelin. Furthermore, the presence of ghrelin mRNA and total and active ghrelin protein, as well as of ghrelin receptor mRNA in the fetal pancreas, is intriguing and suggests that ghrelin may play an important role in pancreas development.


   Acknowledgments
 
Our thanks go to Dr. M. L. Heiman (Eli Lilly and Co., Indianapolis, IN) and to Dr. Bruce Verchere for their highly appreciated intellectual contribution. OneTouch meters were a gift from LifeScan Canada.


   Footnotes
 
This work was supported in part by Canadian Institutes for Health Research Grant OHP 65392.

Received January 19, 2004.

Accepted for publication May 5, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ariyasu H, Takaya K, Tagami T, Ogawa Y, Hosoda K, Akamizu T, Suda M, Koh T, Natsui K, Toyooka S, Shirakami G, Usui T, Shimatsu A, Doi K, Hosoda H, Kojima M, Kangawa K, Nakao K 2001 Stomach is a major source of circulating ghrelin, and feeding state determines plasma ghrelin-like immunoreactivity levels in humans. J Clin Endocrinol Metab 86:4753–4758[Abstract/Free Full Text]
  2. Date Y, Kojima M, Hosoda H, Sawaguchi A, Mondal MS, Suganuma T, Matsukura S, Kangawa K, Nakazato M 2000 Ghrelin, a novel growth hormone-releasing acylated peptide, is synthesized in a distinct endocrine cell type in the gastrointestinal tracts of rats and humans. Endocrinology 141:4255–4261[Abstract/Free Full Text]
  3. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K 1999 Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402:656–660[CrossRef][Medline]
  4. Gualillo O, Caminos J, Blanco M, Garcia-Caballero T, Kojima M, Kangawa K, Dieguez C, Casanueva F 2001 Ghrelin, a novel placental-derived hormone. Endocrinology 142:788–794[Abstract/Free Full Text]
  5. Wierup N, Svensson H, Mulder H, Sundler F 2002 The ghrelin cell: a novel developmentally regulated islet cell in the human pancreas. Regul Pept 107:63–69[CrossRef][Medline]
  6. Rindi G, Necchi V, Savio A, Torsello A, Zoli M, Locatelli V, Raimondo F, Cocchi D, Solcia E 2002 Characterisation of gastric ghrelin cells in man and other mammals: studies in adult and fetal tissues. Histochem Cell Biol 117:511–519[CrossRef][Medline]
  7. Arvat E, Di Vito L, Broglio F, Papotti M, Muccioli G, Dieguez C, Casanueva FF, Deghenghi R, Camanni F, Ghigo E 2000 Preliminary evidence that ghrelin, the natural GH secretagogue (GHS)-receptor ligand, strongly stimulates GH secretion in humans. J Endocrinol Invest 23:493–495[Medline]
  8. Arvat E, Maccario M, Di Vito L, Broglio F, Benso A, Gottero C, Papotti M, Muccioli G, Dieguez C, Casanueva FF, Deghenghi R, Camanni F, Ghigo E 2001 Endocrine activities of ghrelin, a natural growth hormone secretagogue (GHS), in humans: comparison and interactions with hexarelin, a nonnatural peptidyl GHS, and GH-releasing hormone. J Clin Endocrinol Metab 86:1169–1174[Abstract/Free Full Text]
  9. Broglio F, Arvat E, Benso A, Gottero C, Muccioli G, Papotti M, van der Lely AJ, Deghenghi R, Ghigo E 2001 Ghrelin, a natural GH secretagogue produced by the stomach, induces hyperglycemia and reduces insulin secretion in humans. J Clin Endocrinol Metab 86:5083–5086[Abstract/Free Full Text]
  10. Asakawa A, Inui A, Kaga T, Yuzuriha H, Nagata T, Ueno N, Makino S, Fujimiya M, Niijima A, Fujino MA, Kasuga M 2001 Ghrelin is an appetite-stimulatory signal from stomach with structural resemblance to motilin. Gastroenterology 120:337–345[CrossRef][Medline]
  11. Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kangawa K, Matsukura S 2001 A role for ghrelin in the central regulation of feeding. Nature 409:194–198[CrossRef][Medline]
  12. Wren AM, Small CJ, Abbott CR, Dhillo WS, Seal LJ, Cohen MA, Batterham RL, Taheri S, Stanley SA, Ghatei MA, Bloom SR 2001 Ghrelin causes hyperphagia and obesity in rats. Diabetes 50:2540–2547[Abstract/Free Full Text]
  13. Cummings DE, Purnell JQ, Frayo RS, Schmidova K, Wisse BE, Weigle DS 2001 A preprandial rise in plasma ghrelin levels suggests a role in meal initiation in humans. Diabetes 50:1714–1719[Abstract/Free Full Text]
  14. Cummings DE, Weigle DS, Frayo RS, Breen PA, Ma MK, Dellinger EP, Purnell JQ 2002 Plasma ghrelin levels after diet-induced weight loss or gastric bypass surgery. N Engl J Med 346:1623–1630[Abstract/Free Full Text]
  15. Toshinai K, Mondal MS, Nakazato M, Date Y, Murakami N, Kojima M, Kangawa K, Matsukura S 2001 Upregulation of ghrelin expression in the stomach upon fasting, insulin-induced hypoglycemia, and leptin administration. Biochem Biophys Res Commun 281:1220–1225[CrossRef][Medline]
  16. Stock SL, Pinzon JL, Wong ACK, Leichner P, Chanoine JP 2003 Ghrelin and hunger decrease following a meal in anorexic, control and obese female adolescents. Obes Res 11(Suppl):A19 (Abstract OR-80)
  17. Nakagawa E, Nagaya N, Okumura H, Enomoto M, Oya H, Ono F, Hosoda H, Kojima M, Kangawa K 2002 Hyperglycaemia suppresses the secretion of ghrelin, a novel growth-hormone-releasing peptide: responses to the intravenous and oral administration of glucose. Clin Sci (Lond) 103:325–328[Medline]
  18. McCowen KC, Maykel JA, Bistrian BR, Ling PR 2002 Circulating ghrelin concentrations are lowered by intravenous glucose or hyperinsulinemic euglycemic conditions in rodents. J Endocrinol 175:R7–R11
  19. Saad MF, Bernaba B, Hwu CM, Jinagouda S, Fahmi S, Kogosov E, Boyadjian R 2002 Insulin regulates plasma ghrelin concentration. J Clin Endocrinol Metab 87:3997–4000[Abstract/Free Full Text]
  20. Flanagan DE, Evans ML, Monsod TP, Rife F, Heptulla RA, Tamborlane WV, Sherwin RS 2003 The influence of insulin on circulating ghrelin. Am J Physiol Endocrinol Metab 284:E313–E316
  21. Murdolo G, Lucidi P, Di Loreto C, Parlanti N, De Cicco A, Fatone C, Fanelli CG, Bolli GB, Santeusanio F, De Feo P 2003 Insulin is required for prandial ghrelin suppression in humans. Diabetes 52:2923–2927[Abstract/Free Full Text]
  22. Schaller G, Schmidt A, Pleiner J, Woloszczuk W, Wolzt M, Luger A 2003 Plasma ghrelin concentrations are not regulated by glucose or insulin: a double-blind, placebo-controlled crossover clamp study. Diabetes 52:16–20[Abstract/Free Full Text]
  23. Tschop M, Smiley DL, Heiman ML 2000 Ghrelin induces adiposity in rodents. Nature 407:908–913[CrossRef][Medline]
  24. Muccioli G, Tschop M, Papotti M, Deghenghi R, Heiman M, Ghigo E 2002 Neuroendocrine and peripheral activities of ghrelin: implications in metabolism and obesity. Eur J Pharmacol 440:235–254[CrossRef][Medline]
  25. Farquhar J, Heiman M, Wong AC, Wach R, Chessex P, Chanoine JP 2003 Elevated umbilical cord ghrelin concentrations in small for gestational age neonates. J Clin Endocrinol Metab 88:4324–4327[Abstract/Free Full Text]
  26. Chanoine JP, Yeung LP, Wong AC 2003 Umbilical cord ghrelin concentrations in Asian and Caucasian neonates. Horm Res 60:116–120[CrossRef][Medline]
  27. Liu YL, Yakar S, Otero-Corchon V, Low MJ, Liu JL 2002 Ghrelin gene expression is age-dependent and influenced by gender and the level of circulating IGF-I. Mol Cell Endocrinol 189:97–103[CrossRef][Medline]
  28. Hayashida T, Nakahara K, Mondal MS, Date Y, Nakazato M, Kojima M, Kangawa K, Murakami N 2002 Ghrelin in neonatal rats: distribution in stomach and its possible role. J Endocrinol 173:239–245[Abstract]
  29. Torsello A, Scibona B, Leo G, Bresciani E, Avallone R, Bulgarelli I, Luoni M, Zoli M, Rindi G, Cocchi D, Locatelli V 2003 Ontogeny and tissue-specific regulation of ghrelin mRNA expression suggest that ghrelin is primarily involved in the control of extraendocrine functions in the rat. Neuroendocrinology 77:91–99[CrossRef][Medline]
  30. Girard JR, Ferre P, Gilbert M, Kervran A, Assan R, Marliss EB 1977 Fetal metabolic response to maternal fasting in the rat. Am J Physiol 232:E456–E463
  31. Date Y, Nakazato M, Hashiguchi S, Dezaki K, Mondal MS, Hosoda H, Kojima M, Kangawa K, Arima T, Matsuo H, Yada T, Matsukura S 2002 Ghrelin is present in pancreatic {alpha}-cells of humans and rats and stimulates insulin secretion. Diabetes 51:124–129[Abstract/Free Full Text]
  32. Adeghate E, Ponery AS 2002 Ghrelin stimulates insulin secretion from the pancreas of normal and diabetic rats. J Neuroendocrinol 14:555–560[CrossRef][Medline]
  33. Colombo M, Gregersen S, Xiao J, Hermansen K 2003 Effects of ghrelin and other neuropeptides (CART, MCH, Orexin A and B, and GLP-1) on the release of insulin from isolated rat islets. Pancreas 27:161–166[CrossRef][Medline]
  34. Reimer MK, Pacini G, Ahren B 2003 Dose-dependent inhibition by ghrelin of insulin secretion in the mouse. Endocrinology 144:916–921[Abstract/Free Full Text]
  35. Egido EM, Rodriguez-Gallardo J, Silvestre RA, Marco J 2002 Inhibitory effect of ghrelin on insulin and pancreatic somatostatin secretion. Eur J Endocrinol 146:241–244[Abstract]
  36. McKee KK, Palyha OC, Feighner SD, Hreniuk DL, Tan CP, Phillips MS, Smith RG, Van der Ploeg LH, Howard AD 1997 Molecular analysis of rat pituitary and hypothalamic growth hormone secretagogue receptors. Mol Endocrinol 11:415–423[Abstract/Free Full Text]
  37. Kamegai J, Wakabayashi I, Miyamoto K, Unterman TG, Kineman RD, Frohman LA 1998 Growth hormone-dependent regulation of pituitary GH secretagogue receptor (GHS-R) mRNA levels in the spontaneous dwarf rat. Neuroendocrinology 68:312–318[CrossRef][Medline]
  38. Lee HM, Wang G, Englander EW, Kojima M, Greeley Jr GH 2002 Ghrelin, a new gastrointestinal endocrine peptide that stimulates insulin secretion: enteric distribution, ontogeny, influence of endocrine, and dietary manipulations. Endocrinology 143:185–190[Abstract/Free Full Text]
  39. Wierup N, Yang S, McEvilly RJ, Mulder H, Sundler F 2004 Ghrelin is expressed in a novel endocrine cell type in developing rat islets and inhibits insulin secretion from INS-1 (832/13) cells. J Histochem Cytochem 52:301–310[Abstract/Free Full Text]
  40. Prado CL, Pugh-Bernard AE, Elghazi L, Sosa-Pineda B, Sussel L 2004 Ghrelin cells replace insulin-producing ß cells in two mouse models of pancreas development. Proc Natl Acad Sci USA 101:2924–2929[Abstract/Free Full Text]
  41. Prasadan K, Daume E, Preuett B, Spilde T, Bhatia A, Kobayashi H, Hembree M, Manna P, Gittes GK 2002 Glucagon is required for early insulin-positive differentiation in the developing mouse pancreas. Diabetes 51:3229–3236[Abstract/Free Full Text]
  42. Hosoda H, Kojima M, Matsuo H, Kangawa K 2000 Ghrelin and des-acyl ghrelin: two major forms of rat ghrelin peptide in gastrointestinal tissue. Biochem Biophys Res Commun 279:909–913[CrossRef][Medline]
  43. Wortley KE, Anderson K, Garcia K, Murray J, Malinova L, Liu R, Moncrieffe M, Thabet K, Cox H, Yancopoulos GD, Wiegand SJ, Sleeman MW 2004 Deletion of ghrelin reveals no effect on food intake, but a primary role in energy balance. Obes Res 12:170
  44. Sun Y, Ahmed S, Smith RG 2003 Deletion of ghrelin impairs neither growth nor appetite. Mol Cell Biol 23:7973–7981[Abstract/Free Full Text]
  45. Gualillo O, Caminos JE, Kojima M, Kangawa K, Arvat E, Ghigo E, Casanueva FF, Dieguez C 2001 Gender and gonadal influences on ghrelin mRNA levels in rat stomach. Eur J Endocrinol 144:687–690[Abstract]
  46. Liu X, York D, Bray G 2003 Differential regulation of ghrelin gene expression and response to a ghrelin analogue between Osborne-Mendel and S5B/P1 rats. Obes Res 11(Suppl):A21 (Abstract OR-88)
  47. Gualillo O, Caminos JE, Nogueiras R, Seoane LM, Arvat E, Ghigo E, Casanueva FF, Dieguez C 2002 Effect of food restriction on ghrelin in normal-cycling female rats and in pregnancy. Obes Res 10:682–687[Medline]
  48. Chanoine JP, Yeung LP, Wong AC, Birmingham CL 2002 Immunoreactive ghrelin in human cord blood: relation to anthropometry, leptin, and growth hormone. J Pediatr Gastroenterol Nutr 35:282–286[CrossRef][Medline]
  49. Groschl M, Uhr M, Kraus T 2004 Evaluation of the comparability of commercial ghrelin assays. Clin Chem 50:457–458[Free Full Text]



This article has been cited by other articles:


Home page
 J EndocrinolHome page
X. Wang, L. Liang, and L. Du
The effects of intrauterine undernutrition on pancreas ghrelin and insulin expression in neonate rats
J. Endocrinol., July 1, 2007; 194(1): 121 - 129.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
R. Granata, F. Settanni, L. Biancone, L. Trovato, R. Nano, F. Bertuzzi, S. Destefanis, M. Annunziata, M. Martinetti, F. Catapano, et al.
Acylated and Unacylated Ghrelin Promote Proliferation and Inhibit Apoptosis of Pancreatic {beta}-Cells and Human Islets: Involvement of 3',5'-Cyclic Adenosine Monophosphate/Protein Kinase A, Extracellular Signal-Regulated Kinase 1/2, and Phosphatidyl Inositol 3-Kinase/Akt Signaling
Endocrinology, February 1, 2007; 148(2): 512 - 529.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
I. Sakata, T. Tanaka, M. Yamazaki, T. Tanizaki, Z. Zheng, and T. Sakai
Gastric estrogen directly induces ghrelin expression and production in the rat stomach.
J. Endocrinol., September 1, 2006; 190(3): 749 - 757.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
K. Nakahara, M. Nakagawa, Y. Baba, M. Sato, K. Toshinai, Y. Date, M. Nakazato, M. Kojima, M. Miyazato, H. Kaiya, et al.
Maternal Ghrelin Plays an Important Role in Rat Fetal Development during Pregnancy
Endocrinology, March 1, 2006; 147(3): 1333 - 1342.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
M. Kojima and K. Kangawa
Ghrelin: Structure and Function
Physiol Rev, April 1, 2005; 85(2): 495 - 522.
[Abstract] [Full Text] [PDF]

Home page
 Exp. Biol. Med.Home page
G. Rindi, A. Torsello, V. Locatelli, and E. Solcia
Ghrelin Expression and Actions: A Novel Peptide for an Old Cell Type of the Diffuse Endocrine System
Experimental Biology and Medicine, November 1, 2004; 229(10): 1007 - 1016.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chanoine, J.-P.
Right arrow Articles by Wong, A. C. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chanoine, J.-P.
Right arrow Articles by Wong, A. C. K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals