Endocrinology, doi:10.1210/en.2003-0402
Endocrinology Vol. 145, No. 9 4244-4250
Copyright © 2004 by The Endocrine Society
Regulation of Adrenomedullin Gene Transcription and Degradation by the c-myc Gene
Naoko Ozawa,
Masayoshi Shichiri,
Nozomi Fukai,
Takanobu Yoshimoto and
Yukio Hirata
Department of Clinical and Molecular Endocrinology, Tokyo Medical and Dental University Graduate School, Tokyo 113-8519, Japan
Address all correspondence and requests for reprints to: Masayoshi Shichiri, M.D., Ph.D., Tokyo Medical and Dental University Medical Hospital, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8519, Japan. E-mail: mshichiri.cme{at}tmd.ac.jp.
 |
Abstract
|
|---|
Adrenomedullin, a vasodilatory peptide originally isolated from pheochromocytoma, is known to regulate cell growth, apoptosis, and migration. Overexpression of the c-myc oncogene has been shown to suppress the mouse adrenomedullin gene via the initiator element. We investigated whether c-myc regulates rat and human adrenomedullin genes because there appears to be no initiator elements in their promoter regions. Transactivation of the human adrenomedullin gene by c-myc was demonstrated using a luciferase reporter construct containing an upstream sequence. Using a panel of isogenic rat fibroblast cell lines with differential c-myc expression obtained by targeted homologous recombination, we found markedly elevated adrenomedullin transcript levels in cells stably overexpressing c-myc but a minimal decrease in two independent cell lines containing a homozygous null deletion of c-myc. Degradation of adrenomedullin mRNA was enhanced by a c-myc transgene, resulting in a relatively reserved increase in cellular secretion of adrenomedullin-like immunoreactivity. These results indicate that c-myc transactivates rat and human adrenomedullin genes and accelerates the degradation rate of adrenomedullin mRNA. However, c-myc is not essential for basal expression of the adrenomedullin gene.
 |
Introduction
|
|---|
ADRENOMEDULLIN IS A MULTIFUNCTIONAL regulatory peptide originally isolated from human pheochromocytoma as a potent vasorelaxant/hypotensive peptide (1, 2). Adrenomedullin is widely expressed in a variety of tissues, including fibroblasts (3) and endothelial cells (4). A range of cytokines, growth factors, and hormones are reported to increase adrenomedullin gene expression, including TNF-
and -ß, IL-1
and -1ß, dexamethasone, cortisol, aldosterone, retinoic acid, and thyroid hormone (2, 5). However, the molecular mechanisms involved in adrenomedullin gene expression largely remain to be elucidated.
An immediate early response gene, c-myc, encodes a nuclear protein containing a basic helix-loop-helix leucine zipper DNA-binding domain. c-Myc protein, by dimerization with Max, recognizes an E-box recognition site (CACGTG) and several related noncanonical sequences (6, 7, 8, 9). c-Myc is known to induce more than a score of genes, including plasminogen activator inhibitor-1 (10),
-prothymosin (11), ECA 39 (12), p53 (13), ornithine decarboxylase (14), cad (15), dihydrofolate reductase (16), and cdc25A (17). However, a recent study has revealed that the expressions of most of the proposed c-myc target genes are unchanged in c-myc-null cell lines (18). Although c-Myc regulates proliferation, mitogenesis, differentiation, and programed cell death (19), it is not essential for cell proliferation (20). However, c-Myc can also repress transcription through the initiator element (21) and, in this manner, may participate in the biphasic regulation of genes, such as the adenovirus-2 major late promoter (22) and, possibly, the preproendothelin-1 gene (23). Recently, c-Myc was reported to suppress mouse adrenomedullin expression via an initiator element (24). However, there is no known initiator element in rat or human adrenomedullin promoter sites, and thus, the influence of c-Myc on adrenomedullin expression in these species remains unknown.
In this study, we used a panel of isogenic fibroblast cell lines with differential c-myc expression levels obtained by targeted homologous recombination. c-myc-null cells have prolonged G1 and G2 phases with a markedly extended cell cycle, but they still continue to grow (20). The present study was designed to elucidate the regulation of rat and human adrenomedullin expression by physiological and deregulated c-Myc levels.
 |
Materials and Methods
|
|---|
Plasmids
A human adrenomedullin promoter construct, designated phADM-Luc, was generated. A fragment of the human adrenomedullin gene (1866 to +8) was amplified using a 5' sense primer (GCCCCCTCGAGAGAAGTAAGAAAGAGAAGAAGCTGTGAT), a 3' antisense primer (CTTGTCAAGCTTCATCCCGGCTGCGAAGCGCA), and human leukocyte genome DNA as the template. The underlined nucleotides in the oligonucleotide sequences represent the XhoI and HindIII sites, respectively, which are not present in the adrenomedullin gene. Direct sequencing of amplified double-stranded PCR products was carried out in both directions by standard semiautomated methods using an ABI Prism 377 DNA Sequencer (PerkinElmer, Foster City, CA). PCR-amplified DNA fragments consisting of the human adrenomedullin gene and additional modified nucleotides were digested with XhoI and HindIII, and the resulting 1874-bp fragment spanning 1866 to +8 with sticky ends was subcloned into the XhoI/HindIII site of the pGL3-Basic Vector (Promega, Madison, WI). c-myc-, and max-expressing cDNAs (pSP-myc and pSP-max) were generously provided by Dr. R. N. Eisenman (Fred Hutchinson Cancer Research Center, Seattle, WA). The mouse adrenomedullin promoter construct, pGL2BmgAM5'-3 (24), containing a 3.0-kb sequence 5' to the mouse adrenomedullin ATG codon (generously provided by Dr. Elizabeth J. Taparowsky, Purdue University, West Lafayette, IN), was digested with KpnI/NdeI, blunt-ended, and religated to generate pmADM-Luc, which contains a 1439-bp upstream sequence. The pRL-TK vector expressing Renilla luciferase was purchased from Promega.
Cell culture
The rat fibroblast cell lines, TGR-1, HET15, HO15, HO16, and LACO3, which have been previously described, were gifts from Dr. John M. Sedivy (Brown University, Providence, RI) (20, 23, 25, 26, 27). Briefly, TGR-1 is a nontransformed diploid rat fibroblast cell line (25), and HET15 is an independent derivative of TGR-1 with one endogenous c-myc exon 2 knocked out by gene targeting using a neomycin-resistant sequence. LACO3 is a derivative of HET15, in which the c-myc transgene was stably introduced nonhomologously (26). HO15 and HO16 are derivatives of heterozygotes, selected after a second round of gene targeting using a hygromycin-resistant sequence to achieve c-myc-null phenotypes (20). Rat aortic endothelial cells were prepared from 15-wk-old male Wistar rats by collagenase and elastase digestion, as described previously (28, 29). The endothelial origin of the cultures was confirmed by the presence of factor VIII using an immunohistochemical method. A normal human skin diploid fibroblast cell line, Hs68, a human hepatic cancer cell line, PLC/PRF/5, and a human uterus tumor cell line, HeLa, were obtained from the Japanese Collection of Research Bioresources. Cells were cultured in DMEM in a 5% CO2 atmosphere at 37 C supplemented with 10% fetal bovine serum, but HeLa cells were cultured in MEM and 10% calf serum was used for the panel of rat fibroblast cell lines.
Real-time quantitative RT-PCR
RNA was extracted from a single dish using RNAzol (GIBCO/BRL, Carlsbad, CA). First-strand cDNA from each mRNA was generated by reverse transcription using a First-Strand cDNA Synthesis Kit (Amersham Pharmacia Biotech, Piscataway, NJ). Rat adrenomedullin and c-myc mRNAs were amplified using synthetic oligomers (adrenomedullin: forward: GTGGAATAAGTGGGCGCTAA, and complement: GCTGAGTGTGTCTGCTCCTG; c-myc exon 2: forward: TGCGACGAGGAAGAGAATTT, and complement: GCTTCTCGGAGACCAGTTTG; c-myc exon 3: forward: GTCCTCAAGAGGTGCCATGT, and complement: CTCGCCGTTTCCTCAGTAAG), detected, and quantified in real time using Light Cycler (Roche Diagnostics, Basel, Switzerland) as previously described (30, 31, 32). The amplification mixture contained 50 nM template cDNA and 500 µM primer DNA from a DNA amplification kit (DNA Master SYBR Green-I; Roche Diagnostics). For the measurement of adrenomedullin mRNA, denaturation was performed at 95 C, annealing at 62 C for 10 sec, and extension was performed at 72 C for 20 sec. The reaction produced a 411-bp PCR product that was confirmed by agarose gel electrophoresis. For the measurement of c-myc exon 2 and exon 3 mRNAs, denaturation was performed at 95 C, annealing at 57 C and 53 C for 5 sec, respectively, and extension was performed at 72 C for 20 sec. Quantification of the transcript number was expressed relative to serially diluted control samples.
Transient transfection
Transient transfections of phADM-Luc, pmADM-Luc, pSP-myc, and pSP-max were performed with a modified transferrin receptor-operated transfer with high efficiency as previously described (32, 33).
Transcription assay
phADM-Luc or pmADM-Luc (1 µg) was transiently cotransfected into subconfluent cells (96-well plates) with 1 µg of pSP-myc, pSP-max, or salmon testes DNA (Sigma-Aldrich Co., St. Louis, MO) and pRL-TK vector. Cells were then incubated in culture media containing 10% serum for 48 h, and luciferase activities were measured using the Dual Luciferase Reporter Assay System (Promega) in a single-tube assay format using MicroLumatPlus (EG&G Berthold, Wildbad, Germany). The firefly luciferase activity of each sample was normalized to an internal reference standard of Renilla luciferase activity. All transfections were repeated two to four times in octets, with at least three different plasmid preparations; data from representative experiments are shown.
RIA
Cells grown in 10-cm dishes were incubated with serum-deprived media for 8 h, and 2 ml of supernatant was subjected to RIA. Adrenomedullin-like immunoreactivity was determined by an Adrenomedullin RIA kit (Phoenix Pharmaceuticals, Belmont, CA), according to the manufacturers instructions. The coefficients of variation of inter- and intraassays were less than 10%.
Statistical analysis
All results are expressed as means ± SEM. Statistical analysis was performed by using ANOVA for repeated measures. P < 0.05 was considered statistically significant.
 |
Results
|
|---|
The plasmid, phADM-Luc, consists of the luciferase reporter gene behind the 1866-bp sequence spanning the 5'-flanking region of the human adrenomedullin gene (Fig. 1
). The construct contains two noncanonical myc-binding sites upstream (CACGAG) and in intron 1 (CTCGTG). phADM-Luc was transiently cotransfected with c-myc cDNA and/or max cDNA into rat endothelial cells. c-myc cDNA caused significant stimulation of luciferase activity, whereas max cDNA had no appreciable effect (Fig. 2A
). The reporter activity was significantly increased after cotransfection with c-myc and max (Fig. 2A
), demonstrating the transactivation of phADM-Luc by c-myc. In contrast, the activity of pmADM-Luc containing an approximately similar length of mouse 5'-flanking sequence was suppressed by cotransfection with c-myc cDNA (Fig. 2B
).

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1. Adrenomedullin reporter construct, phADM. The region between coordinates 1866 bp and +8 bp of the human adrenomedullin gene was placed upstream of luciferase in the promoterless plasmid, pGL3-basic. Two noncanonical c-myc binding sites, CACGAG and CTCGTG, identified by DNA sequencing, are indicated. Open boxes denote noncoding exons, and a hatched box indicates initial sequence encoding preproadrenomedullin. NF-IL6, nuclear factor for IL-6; AP, activator protein; SSRE, shear stress responsive element; CRE, cAMP-regulated enhancer element; GC, GC box; CAAT, CAAT box; TATA, TATA box.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2. Effects of c-myc and/or max on the transcriptional activity of the adrenomedullin gene. A, Human adrenomedullin promoterreporter construct, phADM-Luc, and Renilla luciferase-expressing plasmid were cotransfected with salmon sperm DNA (control) or pSP-myc and/or pSP-max into rat endothelial cells. Firefly luciferase activity normalized to Renilla luciferase as an internal reference standard is presented as the relative mRNA level to that of control cells transfected with phADM-Luc, Renilla luciferase, and salmon sperm DNA. B, Mouse adrenomedullin promoter-reporter construct, pmADM-Luc, was cotransfected with salmon sperm DNA (control) or pSP-myc or pSP-max into rat endothelial cells, and relative reporter activity was determined. Each column with a bar shows the mean ± SEM. *, P < 0.05; **, P < 0.01, vs. control.
|
|
To determine whether transactivation of the adrenomedullin gene by c-myc occurs in human cells as well, we cotransfected phADM-Luc with c-myc cDNA into human-derived cells. Transactivation occurred most evidently in a normal diploid fibroblast cell line (Hs68) but less evidently in two cancer-derived cell lines (HeLa and PLC/PRF/5) known to express greater levels of c-myc (Fig. 3
). These results confirm the transactivation of the adrenomedullin gene by c-myc in human cells.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 3. phADM-Luc were cotransfected with either salmon sperm DNA (control) or pSP-myc into the human normal diploid fibroblast cell line, Hs68 (A), the human uterus cancer cell line, HeLa (B), or the human hepatoma-derived cell line, PLC/PRF/5 (C), and relative reporter activities were determined as in Fig. 2 . *, P < 0.05; **, P < 0.01, vs. control.
|
|
To ascertain whether heterozygous and homozygous knockout cell lines maintained the disrupted c-myc exon 2, we quantified exon 2 and exon 3 transcripts using real-time quantitative RT-PCR (Fig. 4
). Two homozygous cell lines, HO15 and HO16, showed no detectable transcripts when amplified using primers for c-myc exon 2, whereas heterozygous cells had approximately half the mRNA levels of the diploid parental line, TGR-1 (Fig. 4A
). Stable transfectants of exogenous c-myc copies, LACO3, showed mRNA levels far exceeding the diploid levels. On the other hand, c-myc exon 3 was detectable in HO15 and HO16 and HET15 cells at levels slightly lower than the level detected in TGR-1 (Fig. 4B
). These results verify the loss of c-myc exon 2 in HO15 and HO16, as well as reduced expression levels in HET15 cells, and further demonstrate that c-myc misregulates endogenous c-myc as reported for other genes that are driven by c-myc overexpression (18).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4. Quantification of c-myc exon 2, c-myc exon 3, and adrenomedullin mRNA levels in isogenic rat fibroblasts. c-myc exon 2 (A), c-myc exon 3 (B), and adrenomedullin (C) transcripts were quantified using LightCycler in a panel of fibroblasts genetically manipulated by targeted homologous recombination and stable transfection. The data are plotted as the relative mRNA levels of genetically manipulated cells to that of the c-myc diploid cells, TGR-1. Each column with a bar shows the mean ± SEM. *, P < 0.05; **, P < 0.01, vs. parental TGR-1. Bottom panels, Gel electrophoresis of RT-PCR products using primers amplifying either exon 2 (A) or exon 3 (B).
|
|
To determine whether slight perturbations in endogenous c-myc expression affect steady-state adrenomedullin expression, rat adrenomedullin mRNA levels in each cell line were quantified (Fig. 4C
). Adrenomedullin expression was markedly enhanced in LACO3 cells, whereas it was modestly reduced in both heterozygous (HET15) and homozygous cells (HO15 and HO16). These observations indicate that, although c-myc transactivates the adrenomedullin gene, it is not essential for basal expression of adrenomedullin.
To determine whether transactivation of the adrenomedullin gene by c-myc results in markedly increased levels of adrenomedullin peptide synthesis, we measured the adrenomedullin-like immunoreactivity released from each cell line (Fig. 5
). Compared with diploid parental cells, TGR-1, adrenomedullin release showed significant reductions in heterozygous and c-myc-null cells and a significant, but limited, increase in LACO3 cells (Fig. 5
).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5. Adrenomedullin-like immunoreactivity released from fibroblasts with differential c-myc expression. Cells were incubated in serum-free medium for 8 h, and the adrenomedullin released into the medium was measured by RIA. Each column with a bar shows the mean ± SEM. *, P < 0.05, vs. parental TGR-1.
|
|
Although the adrenomedullin mRNA level was approximately 5-fold higher in LACO3 compared with TGR-1 cells, the increase in adrenomedullin peptide release was less than 2-fold. This discrepancy could be due to accelerated mRNA degradation resulting from overexpressed c-Myc. The degradation of adrenomedullin mRNA in each cell line was estimated by the time course of changes in adrenomedullin transcript levels after pretreatment with actinomycin D, which inhibits RNA synthesis. The adrenomedullin mRNA level in LACO3 cells was markedly higher compared with diploid cells at baseline and decreased to the levels of c-myc diploid and null cells within 1 h (Fig. 6
), suggesting rapidly accelerating mRNA degradation by c-myc.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6. RNA degradation rate in fibroblasts expressing different c-myc levels. Total RNA was extracted from cells preincubated with actinomycin D for the indicated times, and adrenomedullin mRNA was quantified using real-time quantitative RT-PCR. The time courses of the changes of adrenomedullin mRNA levels in each cell line relative to diploid cells (TGR-1) are plotted against time.
|
|
 |
Discussion
|
|---|
In the present study, we have demonstrated transactivation of rat and human adrenomedullin genes by c-myc. Recent reports indicate that regulation of c-myc target genes occurs via intron E-box sites (11, 34, 35) as well as via upstream canonical and noncanonical sites (6, 7, 8, 9). Our luciferase reporter plasmid, phADM-Luc, was designed to contain the two E-box sites of the adrenomedullin gene, one in the upstream sequence and the other in intron 1, so that it might respond to c-Myc protein similarly to the endogenous human adrenomedullin gene. Thus, the induction of phADM-Luc by cotransfecting c-myc-expressing plasmid indicates transactivation of the human adrenomedullin gene by c-myc. Transactivation of the rat adrenomedullin gene was demonstrated using rat fibroblasts stably overexpressing c-myc, in which the adrenomedullin transcript levels were markedly elevated compared with the diploid parental cells. LACO3 cells are ideal for evaluating the potential of c-myc because their expression levels are within the physiological range (26), which is approximately 4- to 5-fold higher than the endogenous c-myc mRNA level in the diploid parental cells, TGR-1.
A number of genes have been proposed as c-myc targets, mainly using subtractive hybridization and differential display. However, because ectopic c-Myc influences cell-cycle progression, it is difficult to separate any direct effect of c-Myc from the indirect effects of changes in the cell cycle as overexpression approaches. A loss of function approach is critical for evaluating the potential of endogenous c-Myc in normal cellular physiology. In a study using c-myc-null cells, a limited number of the previously proposed c-myc targets proved to be regulated by c-myc (18). In the present study, we used isogenic fibroblast cell lines that were nontransformed and stably diploid and maintained the original morphological characteristics at the time of the experiments. Quantification of adrenomedullin mRNA revealed significant but limited suppression in heterozygous and null cells, demonstrating that c-myc is not essential for basal expression of the adrenomedullin gene. Other transcription factors might be involved in the steady-state expression of the adrenomedullin gene.
The heterozygous and homozygous c-myc cell lines used in this study are genetically stable and morphologically indistinguishable from wild types (20, 26). The observed effects are considered to be the direct consequences of c-myc knockout, and not secondary or tertiary effects, by the following lines of evidences. First, cell lines were obtained by targeted homologous recombination and confirmed to show no discernible additional genetic changes, such as nonhomologous integration of targeting module (20, 26). Second, two independent cell lines were confirmed to display the same phenotype at the initial (20) and second round of gene targeting experiments (26). Third, the phenotype was reversed by introducing a c-myc transgene (20). The heterozygous and homozygous cell lines are very stable in culture, and our quantification of the exon 2 and exon 3 c-myc sequences revealed that they maintained disrupted exon 2. A panel of cell lines, including the parental diploid cells, did not express N-myc or L-myc, which could compensate for the loss of c-myc, thus demonstrating that the homozygous knockout cell lines represent the c-myc-null phenotype (20, 25). Thus, we conclude that the adrenomedullin gene is induced by the c-myc transgene but is misregulated by the c-myc-null deletion.
Along with transcriptional regulation, RNA stability is also an important factor affecting gene expression levels. Each mRNA has a different half-life, and mRNAs that encode proteins produced in rapid response to stimuli tend to have short half-lives (36, 37). RNA sequences, such as the AU-rich element and iron-responsive element, are associated with RNA destabilization, whereas RNA stability can also be influenced by environmental factors such as hormones, stress, and cell differentiation. For example, TSH destabilizes RNA and down-regulates TSH-ß both transcriptionally and posttranscriptionally (37, 38), and hypoxia induces vascular endothelial growth factor through RNA stabilization (39). In contrast to these factors reported to influence RNA stability, transcriptional factors have rarely been described in relation to RNA decay. Down-regulation of c-myc during differentiation may be due, in part, to accelerated RNA turnover (40). In the present study, we have demonstrated enhanced adrenomedullin mRNA degradation in cells overexpressing c-myc, leading to a limited increase in adrenomedullin protein synthesis and subsequent cellular release, despite the adrenomedullin gene transactivation. Adrenomedullin release from the cells overexpressing c-myc was higher than the adrenomedullin release from the parental cells, but this does not appear to reflect the markedly elevated adrenomedullin mRNA levels in these cells. Thus, it is expected that c-Myc contributes to the synthesis and secretion of rat and human adrenomedullin upon its induction but may not exert an extended effect. Our finding that c-Myc destabilizes adrenomedullin RNA indicates the possibility that other transcriptional factors might also be involved in RNA turnover regulation. It is also tempting to speculate that c-Myc might destabilize RNA of other target genes, thus alleviating the effect of transactivation on their protein production.
The human adrenomedullin gene 5'-flanking region contains, in addition to the noncanonical c-myc binding site, TATA, CAAT, and GC boxes that are involved in the basal expression of the adrenomedullin gene (41). There are also multiple binding sites for activator protein-2 and a consensus sequence of the nuclear factor for the IL-6 binding site, suggesting roles for phospholipase C and protein kinase C in the regulation of adrenomedullin gene induction (Fig. 1
). The presence of the cAMP-regulated enhancer element suggests a feedback mechanism by cAMP, whereas the shear stress responsive element and the interferon-
responsive element imply involvement of physical and chemical stimuli in the transcriptional regulation. Our present results also demonstrate that, because rising adrenomedullin levels induce c-myc expression, elevated c-Myc protein acts to degrade adrenomedullin mRNA. Thus, regulation of adrenomedullin mRNA turnover by the c-myc gene, together with the transcriptional feedback mechanism at the cAMP-regulated enhancer element by cAMP produced by autocrine adrenomedullin stimulation, may constitute a built-in feedback signaling loop capable of finely regulating its own expression levels.
The intriguing question arises of whether there are any pathophysiological conditions that mirror these molecular findings. We previously demonstrated that adrenomedullin is abundantly expressed in injured vasculature and is actively involved in vascular remodeling at inflammation sites (42). Both adrenomedullin expression and neointimal thickening after balloon injury of the common carotid arteries were markedly suppressed by treatment with the adrenomedullin receptor antagonist, calcitonin gene-related peptide (8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37). In vascular smooth muscle cells at the site of injured vessels and in many cancer cells, abundantly expressed adrenomedullin acts as a potent growth-promoting factor (43). However, in injured vessels and other sites of inflammation, c-myc is induced by inflammatory cytokines as well as by physical and chemical stimuli, which may subsequently contribute to the degradation of adrenomedullin mRNA and the lessening of any overproduction of adrenomedullin. The fact that c-myc-induced expression of adrenomedullin is disrupted by high c-Myc levels can be viewed as a built-in safety mechanism for the maintenance of normal vascular pathology, such as in atherosclerosis, vascular remodeling, and tumor cell growth.
 |
Acknowledgments
|
|---|
We are grateful to Shinobu H. Yamaguchi and Hiroko Yasuda for technical assistance, to John M. Sedivy (Brown University, Providence, RI) for supplying the c-myc knockout cell lines, to R. N. Eisenman (Fred Hutchinson Cancer Research Center, Seattle, WA) for pSP-myc and pSP-max plasmids, and to Elizabeth J. Taparowsky (Purdue University, West Lafayette, IN) for pGL2BmgAM5'-3 plasmid.
 |
Footnotes
|
|---|
This work was supported in part by a grant-in-aid from the Ministry of Education, Science, Sports, Culture and Technology of Japan.
Received March 31, 2003.
Accepted for publication June 3, 2004.
 |
References
|
|---|
- Kitamura K, Kangawa K, Kawamoto M, Ichiki Y, Nakamura S, Matsuo H, Eto T 1993 Adrenomedullin: a novel hypotensive peptide isolated from human pheochromocytoma. Biochem Biophys Res Commun 192:553560[CrossRef][Medline]
- Hinson JP, Kapas S, Smith DM 2000 Adrenomedullin, a multifunctional regulatory peptide. Endocr Rev 21:138167[Abstract/Free Full Text]
- Isumi Y, Minamino N, Katafuchi T, Yoshioka M, Tsuji T, Kangawa K, Matsuo H 1998 Adrenomedullin production in fibroblasts: its possible function as a growth regulator of Swiss 3T3 cells. Endocrinology 139:25522563[Abstract/Free Full Text]
- Sugo S, Minamino N, Kangawa K, Miyamoto K, Kitamura K, Sakata J, Eto T, Matsuo H 1994 Endothelial cells actively synthesize and secrete adrenomedullin. Biochem Biophys Res Commun 201:11601166[CrossRef][Medline]
- Sugo S, Minamino N, Shoji H, Kangawa K, Kitamura K, Eto T, Matsuo H 1994 Production and secretion of adrenomedullin from vascular smooth muscle cells: augmented production by tumor necrosis factor-
. Biochem Biophys Res Commun 203:719726[CrossRef][Medline]
- Blackwood EM, Eisenman RN 1991 Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc. Science 251:12111217[Abstract/Free Full Text]
- Prendergast GC, Ziff EB 1991 Methylation-sensitive sequence-specific DNA binding by the c-Myc basic region. Science 251:186189[Abstract/Free Full Text]
- Halazonetis TD, Kandil AN 1991 Determination of the c-Myc DNA-binding site. Proc Natl Acad Sci USA 88:61626166[Abstract/Free Full Text]
- Blackwell TK, Huang J, Ma A, Kretzner L, Alt FW, Eisenman RN, Weintraub H 1993 Binding of myc proteins to canonical and noncanonical DNA sequences. Mol Cell Biol 13:52165224[Abstract/Free Full Text]
- Prendergast GC, Diamond LE, Dahl D, Cole MD 1990 The c-myc-regulated gene mrl encodes plasminogen activator inhibitor 1. Mol Cell Biol 10:12651269[Abstract/Free Full Text]
- Gaubatz S, Meichle A, Eilers M 1994 An E-box element localized in the first intron mediates regulation of the prothymosin
gene by c-myc. Mol Cell Biol 14:38533862[Abstract/Free Full Text]
- Benvenisty N, Leder A, Kuo A, Leder P 1992 An embryonically expressed gene is a target for c-Myc regulation via the c-Myc-binding sequence. Genes Dev 6:25132523[Abstract/Free Full Text]
- Reisman D, Elkind NB, Roy B, Beamon J, Rotter V 1993 c-Myc trans-activates the p53 promoter through a required downstream CACGTG motif. Cell Growth Differ 4:5765[Abstract]
- Wagner AJ, Meyers C, Laimins LA, Hay N 1993 c-Myc induces the expression and activity of ornithine decarboxylase. Cell Growth Differ 4:879883[Abstract]
- Miltenberger RJ, Sukow KA, Farnham PJ 1995 An E-box-mediated increase in cad transcription at the G1/S-phase boundary is suppressed by inhibitory c-Myc mutants. Mol Cell Biol 15:25272535[Abstract]
- Mai S, Jalava A 1994 c-Myc binds to 5' flanking sequence motifs of the dihydrofolate reductase gene in cellular extracts: role in proliferation. Nucleic Acids Res 22:22642273[Abstract/Free Full Text]
- Galaktionov K, Chen X, Beach D 1996 Cdc25 cell-cycle phosphatase as a target of c-myc. Nature 382:511517[CrossRef][Medline]
- Bush A, Mateyak M, Dugan K, Obaya A, Adachi S, Sedivy J, Cole M 1998 c-myc null cells misregulate cad and gadd45 but not other proposed c-Myc targets. Genes Dev 12:37973802[Abstract/Free Full Text]
- Evan GI, Wyllie AH, Gilbert CS, Littlewood TD, Land H, Brooks M, Waters CM, Penn LZ, Hancock DC 1992 Induction of apoptosis in fibroblasts by c-myc protein. Cell 69:119128[CrossRef][Medline]
- Mateyak MK, Obaya AJ, Adachi S, Sedivy JM 1997 Phenotypes of c-Myc-deficient rat fibroblasts isolated by targeted homologous recombination. Cell Growth Differ 8:10391048[Abstract]
- Philipp A, Schneider A, Vasrik I, Finke K, Xiong Y, Beach D, Alitalo K, Eilers M 1994 Repression of cyclin D1: a novel function of MYC. Mol Cell Biol 14:40324043[Abstract/Free Full Text]
- Li LH, Nerlov C, Prendergast G, MacGregor D, Ziff EB 1994 c-Myc represses transcription in vivo by a novel mechanism dependent on the initiator element and Myc box II. EMBO J 13:40704079[Medline]
- Shichiri M, Adachi S, Sedivy JM, Marumo F, Hirata Y 1997 Biphasic regulation of the preproendothelin-1 gene by c-myc. Endocrinology 138:45844590[Abstract/Free Full Text]
- Wang X, Peters MA, Utama FE, Wang Y, Taparowsky EJ 1999 The adrenomedullin gene is a target for negative regulation by the Myc transcription complex. Mol Endocrinol 13:254267[Abstract/Free Full Text]
- Prouty SM, Hanson KD, Boyle AL, Brown JR, Shichiri M, Follansbee MR, Kang W, Sedivy JM 1993 A cell culture model system for genetic analyses of the cell cycle by targeted homologous recombination. Oncogene 8:899907[Medline]
- Shichiri M, Hanson KD, Sedivy JM 1993 Effects of c-myc expression on proliferation, quiescence, and the G0 to G1 transition in nontransformed cells. Cell Growth Differ 4:93104[Abstract]
- Hanson KD, Shichiri M, Follansbee MR, Sedivy JM 1994 Effects of c-myc expression on cell cycle progression. Mol Cell Biol 14:57485755[Abstract/Free Full Text]
- Kato H, Shichiri M, Marumo F, Hirata Y 1997 Adrenomedullin as an autocrine/paracrine apoptosis survival factor for rat endothelial cells. Endocrinology 138:26152620[Abstract/Free Full Text]
- Emori T, Hirata Y, Imai T, Eguchi S, Kanno K, Marumo F 1993 Cellular mechanism of natriuretic peptides-induced inhibition of endothelin-1 biosynthesis in rat endothelial cells. Endocrinology 133:24742480[Abstract/Free Full Text]
- Shichiri M, Hirata Y 2001 Antiangiogenesis signals by endostatin. FASEB J 15:10441053[Abstract/Free Full Text]
- Shichiri M, Yokokura M, Marumo F, Hirata Y 2000 Endothelin-1 inhibits apoptosis of vascular smooth muscle cells induced by nitric oxide and serum deprivation via MAP kinase pathway. Arterioscler Thromb Vasc Biol 20: 989997
- Shichiri M, Kato H, Doi M, Marumo F, Hirata Y 1999 Induction of max by adrenomedullin and calcitonin gene-related peptide antagonizes endothelial apoptosis. Mol Endocrinol 13:13531363[Abstract/Free Full Text]
- Shichiri M, Tanaka A, Hirata Y 2003 Intravenous gene therapy for familial hypercholesterolemia using ligand-facilitated transfer of a lipodome: LDL receptor gene complex. Gene Ther 10:827831[CrossRef][Medline]
- Packham G, Cleveland JL 1997 Induction of ornithine decarboxylase by IL-3 is mediated by sequential c-Myc-independent and c-Myc-dependent pathways. Oncogene 15:12191232[CrossRef][Medline]
- Bello-Fernandez C, Packham G, Cleveland JL 1993 The ornithine decarboxylase gene is a transcriptional target of c-Myc. Proc Natl Acad Sci USA 90:78047808[Abstract/Free Full Text]
- Guhaniyogi J, Brewer G 2001 Regulation of mRNA stability in mammalian cells. Gene 265:1123[CrossRef][Medline]
- Staton JM, Thomson AM, Leedman PJ 2000 Hormonal regulation of mRNA stability and RNA-protein interactions in the pituitary. J Mol Endocrinol 25:1734[Abstract]
- Staton JM, Leedman PJ 1998 Posttranscriptional regulation of thyrotropin ß-subunit messenger ribonucleic acid by thyroid hormone in murine thyrotrope tumor cells: a conserved mechanism across species. Endocrinology 139:10931100[Abstract/Free Full Text]
- Levy AP, Levy NS, Goldberg MA 1996 Hypoxia-inducible protein binding to vascular endothelial growth factor mRNA and its modulation by the von Hippel-Lindau protein. J Biol Chem 271:2549225497[Abstract/Free Full Text]
- Yeilding NM, Lee WM 1997 Coding elements in exons 2 and 3 target c-myc mRNA downregulation during myogenic differentiation. Mol Cell Biol 17:26982707[Abstract]
- Ishimitsu T, Kojima M, Kangawa K, Hino J, Matsuoka H, Kitamura K, Eto T, Matsuo H 1994 Genomic structure of human adrenomedullin gene. Biochem Biophys Res Commun 203:631639[CrossRef][Medline]
- Shimizu K, Tanaka H, Sunamori M, Marumo F, Shichiri M 1999 Adrenomedullin receptor antagonism by calcitonin gene-related peptide(837) inhibits carotid artery neointimal hyperplasia after balloon injury. Circ Res 85:11991205[Abstract/Free Full Text]
- Shichiri M, Hirata Y 2003 Regulation of cell growth and apoptosis by adrenomedullin. Hypertens Res 26:S9S14
This article has been cited by other articles:

|
 |

|
 |
 
K. Tsuchiya, T. Yoshimoto, Y. Hirono, T. Tateno, T. Sugiyama, and Y. Hirata
Angiotensin II induces monocyte chemoattractant protein-1 expression via a nuclear factor-{kappa}B-dependent pathway in rat preadipocytes
Am J Physiol Endocrinol Metab,
October 1, 2006;
291(4):
E771 - E778.
[Abstract]
[Full Text]
[PDF]
|
 |
|