help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2003-1742
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/9/4401    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cingel-Ristic, V.
Right arrow Articles by Flyvbjerg, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cingel-Ristic, V.
Right arrow Articles by Flyvbjerg, A.
Endocrinology Vol. 145, No. 9 4401-4407
Copyright © 2004 by The Endocrine Society

Administration of Human Insulin-Like Growth Factor-Binding Protein-1 Increases Circulating Levels of Growth Hormone in Mice

Vesna Cingel-Ristic, Johan W. van Neck, Jan Frystyk, Stenvert L. S. Drop and Allan Flyvbjerg

Laboratory of Pediatrics, Subdivision of Molecular Endocrinology (V.C.-R., S.L.S.D.), and Department of Plastic and Reconstructive Surgery (J.W.V.N.), Erasmus Medical Center, 3000 DR Rotterdam, Rotterdam, The Netherlands; and Medical Research Laboratories, Clinical Institute, Aarhus University Hospital (V.C.-R., J.F., A.F.), DK-8000 Aarhus, Denmark

Address all correspondence and requests for reprints to: Dr. Allan Flyvbjerg, Medical Research Laboratories, Clinical Institute, Aarhus University Hospital, DK-8000 Aarhus C., Denmark. E-mail: allan.flyvbjerg{at}dadlnet.dk.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GH is the major regulator of circulating IGF-I, which, in return, controls pituitary GH secretion by negative feedback. IGF-binding protein-1 (IGFBP-1) is believed to modify this feedback through its effects on free IGF-I. In the present study we investigated the potential influence of IGFBP-1 on GH secretion in the absence or presence of a GH receptor antagonist (GHRA) that specifically blocks peripheral GH action. We administered human (h) IGFBP-1 and GHRA to mice alone or in combination for 2 or 7 d. GHRA was administered in a dose previously shown to block GH action without an effect on circulating GH or IGF-I levels. hIGFBP-1 administration increased stimulated circulating GH levels and serum total IGF-I and IGFBP-3 levels. Coadministration of GHRA abolished the hIGFBP-1-induced increase in serum IGF-I and IGFBP-3 levels, whereas stimulated GH levels remained increased. Free IGF-I levels in serum were unchanged in all treatment groups. In conclusion, GH serum levels increased in response to hIGFBP-1 administration, even in the setting of normal IGF-I levels. This finding suggests a direct involvement of IGFBP-1 in GH secretion.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
GH, RELEASED FROM anterior pituitary somatotrophs, is a major participant in growth and metabolism. The primary regulators of GH synthesis and secretion are two hypothalamic peptides: GHRH and somatostatin (SS). GH itself can regulate its own production at the hypothalamic level, where it modulates the release of GHRH and SS (1), and at pituitary level, where it has an autocrine inhibitory effect on secretion from the somatotroph (2). GH secretion is also regulated through a negative feedback, through circulating IGF-I (3, 4).

The IGF family consists of a complex system of peptides involving two growth factors (IGF-I and IGF-II), two types of IGF receptors, and six high affinity IGF-binding proteins (IGFBPs), which serve as important regulators of IGF bioactivity (5). Under normal conditions, circulating GH is bound to a high affinity GH-binding protein (GHBP), which represents the extracellular domain of the GH receptor (GHR) (6). Most of the circulating IGF-I is bound as a 150-kDa ternary complex that includes IGF-I, IGFBP-3, and acid-labile subunit (ALS). The remaining fraction of IGF-I circulates either as free peptide or bound in a binary complex with one of five other IGFBPs. In addition to stimulating IGF-I synthesis in the liver, GH promotes the formation of IGFBP-3, the most abundant circulating IGFBP, and ALS (7). GH suppresses transcription of IGFBP-1 in vitro (8). Serum IGFBP-1 concentrations show an inverse relationship to GH status (9, 10, 11, 12, 13), but it is generally believed that such an effect is secondary to a GH-induced increase in insulin levels (14). However, a suppressive effect of GH on IGFBP-1 appears to be unmasked in the presence of low insulin levels (15).

Whether IGFBP-1 has a direct feedback effect on GH is unknown. The GH-deficient Snell dwarf mouse is not an ideal model to address questions about the effect of IGFBP-1 on the GH/IGF axis because it exhibits combined pituitary hormone deficiencies (16). Accordingly, we decided to examine the effect of exogenously administered human (h) IGFBP-1 to intact mice. To specifically block peripheral GH action at the receptor level, we used a GHRA [B2036-polyethylene glycol (PEG)], an analog of GH with altered binding properties preventing GHR dimerization and PEG-modified to prolong its action (17, 18). This GHRA blocks peripheral GH action without enhancing GH secretion (19). Recently, administration of this GHRA in mice was shown to reduce serum IGF-I levels in a dose-dependent manner (18). In the present study, we used a GHRA dose shown not to alter serum IGF-I, IGFBP-3, or GH levels or renal and hepatic IGF-I contents (18), but still with a GHR-blocking effect (20, 21).

The main aim of the present study was to determine whether hIGFBP-1 has direct feedback on GH secretion. In addition, we studied the effect of hIGFBP-1 administration on gene expression of IGFBP-1 and IGF-I and their protein levels in liver and kidney.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
hIGFBP-1 isolation and purification
hIGFBP-1 was isolated from midgestational amniotic fluid obtained for diagnostic purposes with approval of the ethical committee (Sophia Children’s Hospital, Rotterdam, The Netherlands). Filtered amniotic fluid was precipitated overnight with 1.8 M ammonium sulfate. After centrifugation, the pellet was dissolved in 50 mM Tris-HCl (pH 7.5). This was centrifuged again, and MeOH was added to the supernatant to a final concentration of 65% and incubated for 30 min at room temperature before a second centrifugation. The supernatant was separated on a C18 Sep-Pak column (Waters Chromatography Division, Millipore Corp., Bedford, MA), and 0.6 vol acetone was added for an overnight precipitation at –20 C. After centrifugation, the air-dried pellet was dissolved in 30% MeOH/50 mM Tris, pH 8.2 (Fig. 1AGo, lane 2), and further purified on a RESOURCE RPC 3-ml column connected to a fast protein chromatography system (Automatic FPLC; Pharmacia Biotech, Uppsala, Sweden) using a 48–90% methanol gradient (22). hIGFBP-1 fractions were pooled and examined for purity on SDS-PAGE (Coomassie Blue stain), followed by Amido Black staining and immunostaining of Western blots (Fig. 1AGo, lane 1) (23). Acetone (0.6 vol)-precipitated pellets were dissolved in 10 mM NH4HCO3, freeze-dried (Edwards Modulyo, Crawley, UK) and stored at –20 C. The binding of purified hIGFBP-1 was tested by incubating aliquots of hIGFBP-1/0.154 M NaCl at 37 C for up to 9 h, which were subsequently visualized on Western ligand blots (WLB) with 125I-labeled IGF-II (24, 25) (Fig. 1BGo).



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 1. hIGFBP-1 purification (A). Material loaded onto a RESOURCE RPC/ FPLC column (lane 2) and purified hIGFBP-1 (lane 1) was examined by Amido Black staining (upper panel) and immunostaining (lower panel) of Western blots. The arrow indicates the hIGFBP-1 band. The binding of purified hIGFBP-1 (B) incubated for 0, 2, 4, 6, and 8 h (lanes 1–5, respectively) at 37 C was examined by immunostaining of Western blots (upper panel) and by WLB (lower panel).

 
Animals and study design
Adult female BALB/c (a) mice (Taconic M&B, Ry, Denmark), 8 wk old, with an initial body weight of 17–18 g were used. The mice were housed seven per cage in a room with a 12-h light, 12-h dark cycle at constant temperature (22 ± 2 C) and humidity (55 ± 2%). They had free access to tap water and standard food pellets (Altromin 1324, Lage, Germany). Animal handling complied with Danish regulations for laboratory animals.

The study consisted of three parts: experiment 1 (7-d duration), experiment 2, and experiment 3 (2-d duration each). In each experiment the animals were randomized into four groups and injected with equal volumes of 1) placebo (0.154 M NaCl; n = 7); 2) GHRA (n = 7); 3) hIGFBP-1 (n = 7); and 4) hIGFBP-1/GHRA (n = 7). hIGFBP-1 was administered by three daily sc injections (0800, 1600 and 2400 h) in a dose of 120 µg hIGFBP-1/mouse/d for 7 d (experiment 1) or 2 d (experiments 2 and 3). Placebo groups received an equivalent volume of vehicle (0.154 M NaCl). GHRA (B2036-PEG; Pfizer, New York, NY) was dissolved in 0.154 M NaCl, and 2.5 mg/kg were injected sc on d 0, 2, 4, and 6 in experiment 1 or on d 0 and 1 in experiments 2 and 3 [1.25 mg GHRA/kg/d) (18)]. The animals were weighed, and their food consumption and blood glucose levels (Precision Xtra; Abbott Laboratories, MediSense Products, Bedford, MA) were determined. In experiment 1, serum GH was measured on d 7. Because no significant differences between the groups were seen, in experiment 2 we measured circulatory GH levels before and 10 min after stimulation by the GH secretagogue, ipamorelin (Novo-Nordisk A/S, Bagsvaerd, Denmark). Ipamorelin was administered ip in a dose of 40 µg/600 µl/mouse (26). Experiment 3 was performed following the same protocol as that used in experiment 2, except without ipamorelin stimulation to avoid interference with GH/IGF system mRNA measurements.

Animals were killed on d 7 (experiment 1) or d 2 (experiments 2 and 3), exactly 2.5 h after the last hIGFBP-1 injection. Blood samples were collected from the retroorbital venous plexus through heparinized capillary tubes, exactly 5 min after sodium barbital (10 mg/kg body weight, ip) anesthesia. The serum samples were kept at –80 C until analysis. Immediately after bleeding, kidneys and liver were weighed, snap-frozen in liquid nitrogen, and stored at –80 C.

Immunoassays
Serum GH, serum total IGF-I, and tissue IGF-I (liver and kidney) were measured by RIA as described previously (20). For measurement of free IGF-I (27), serum was pooled from two or three animals to achieve a volume sufficiently large to allow determination by ultrafiltration. The pooled serum samples were ultrafiltered without preceding dilution. Serum insulin was measured by an ultrasensitive rat insulin enzyme-linked immunosorbent assay (DRG Diagnostics, Marburg, Germany). Semilog linearity of mouse serum and rat insulin was found at multiple dilutions, indicating antigen similarity between mouse and rat insulins. The intra- and interassay coefficients of variation were less than 5% and less than 10%, respectively, for the GH, total IGF-I, and insulin assays. The within- and between-assay coefficients of variation of free IGF-I were both 20%. Complete removal of serum and tissue IGFBPs was verified by WLB (see below) and Western immunoblotting with a polyclonal goat IGFBP-1 antibody or a polyclonal goat IGFBP-2 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) in a dilution of 1:1000. The IGFBP-1 antibody cross-reacts with both human and mouse (m) IGFBP-1.

WLB
Serum, liver, and kidney IGFBPs were analyzed by SDS-PAGE and WLB as described previously (28). Autoradiographs of WLBs were quantified using a Shimadzu CS-9001 PC dual wavelength, flying spot scanner (Shimadzu Europe GmbH, Duisburg, Germany). The relative densities of the bands were expressed in pixels.

Real-time PCR
Total RNA was extracted from liver and kidney samples by TRIzol reagent (Invitrogen Life Technologies, Gaithersburg, MD) (29). Hepatic and renal GH/IGF system mRNA levels were determined by quantitative real-time PCR (TaqMan) on an ABI PRISM 7700 Sequence Detection System (Applied Biosystems, Foster City, CA) using SYBR-Green technology, as described previously (30). The primers used for mouse hypoxanthine phosphoribosyltransferase (household gene) were: forward primer, TTGCTCGAGATGTCATGAAGGA; and reverse primer, AGCAGGTCAGCAAAGAACTTATAG, resulting in an amplicon size of 90 bp. The primer set used for mIGF-I was: forward primer, CCACACTGACATGCCCAAGAC; and reverse primer, CCTTCTCCTTTGCAGCTTCGT, resulting in an amplicon size of 75 bp. The primer set used for mIGFBP-1 was: forward primer, ATCCTGTGGAACGCCATCA; and reverse primer, TTTCTTGAGGTCGGCGATCT, resulting in an amplicon size of 65 bp. The primer set used for mIGFBP-3 was: forward primer, GCAGGCAGCCTAAGCACCTA; and reverse primer, TGCTCCTCCTCGGACTCACT, resulting in an amplicon size of 70 bp. The primer set used for mGHR was: forward primer, CGGGTGAGATCCAGACAACG; and reverse primer, CCTAAGATGGTGTTCACCTCC, resulting in an amplicon size of 299 bp. The primer set used for mGHBP was: forward primer, CGGGTGAGATCCAGACAACG; and reverse primer, CTTGGGATGGCGGATCCTCT, resulting in an amplicon size of 186 bp.

Threshold cycles were defined as the number of PCR cycles at which the fluorescent signal reached a fixed threshold signal. PCR efficiencies for all primer sets were greater than 95%. Relative expression levels were determined according to the comparative method (31). All measured values are normalized to household gene expression. The value of the placebo group is set at 1, and the values of other groups are recalculated to that, resulting in artificial values.

Statistical analysis
Means were compared by one-way ANOVA, followed by pairwise comparisons with the least significant difference method. Results are given as the mean ± SEM, with n indicating the number of mice studied. P < 0.05 was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Body, liver, and kidney weights; food consumption; and blood glucose and serum insulin levels
After 7 d of hIGFBP-1 and/or GHRA administration (experiment 1), none of the above-mentioned parameters was significantly changed in any of the groups compared with the control values (Table 1Go). Similar results were obtained after 2 d of hIGFBP-1 and/or GHRA administration (experiments 2 and 3; data not shown).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Body weight (BW), liver weight (LW), kidney weight (KW), food consumption (FC), blood glucose levels (BGL), and serum insulin levels in adult female mice receiving placebo, GHRA, hIGFBP-1, or hIGFBP-1/GHRA for 7 d

 
Serum GH, total and free IGF-I, IGFBP-1, and IGFBP-3
Basal serum GH levels were initially measured in experiment 1. Because no significant differences between the groups were found (data not shown), circulating GH levels were measured before and 10 min after stimulation with ipamorelin (experiment 2; Fig. 2Go). Stimulated serum GH values were markedly elevated in both groups receiving hIGFBP-1 to levels significantly above the stimulated GH levels in mice receiving placebo or GHRA (P < 0.001).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 2. Serum GH levels after 2 d, before ({square}) and 10 min after ({cjs2113}) GH stimulation with ipamorelin in mice receiving placebo, GHRA, hIGFBP-1, or hIGFBP-1/GHRA. Values are the mean ± SEM (n = 7). *, P < 0.001 vs. placebo group (stimulated values); #, P < 0.001 vs. hIGFBP-1/GHRA group (stimulated values); {Delta}, P < 0.05 vs. all groups (basal values).

 
After 2 d of hIGFBP-1 and/or GHRA administration, serum total IGF-I and IGFBP-3 levels were significantly increased in mice receiving hIGFBP-1 compared with those in all other groups (Fig. 3AGo). There were no significant differences in free IGF-I levels among the groups (Fig. 3AGo). Serum IGFBP-1 levels were increased in both groups receiving hIGFBP-1 (Fig. 3AGo). Changes in circulating IGF-I and IGFBP-3 levels among the groups after 7 d were similar to those after 2 d (data not shown).



View larger version (64K):
[in this window]
[in a new window]
  		FIG. 3. Serum total IGF-I, free IGF-I, IGFBP-3, and IGFBP-1 (A), liver IGF-I (B), and liver IGF-I, IGFBP-3, and IGFBP-1 mRNA (C) levels after 2 d in mice receiving placebo ({square}), GHRA ({cjs2112}), hIGFBP-1 ({cjs2113}), or hIGFBP-1/GHRA ({cjs2110}). Values are means ± SEM (n = 7). *, P < 0.02 vs. placebo group, #, P < 0.01 vs. hIGFBP-1/GHRA group. Insert: representative serum WLB, note that IGFBP-1 band consists of endogenous mIGFBP-1 and hIGFBP-1 in mice receiving hIGFBP-1 or hIGFBP-1/GHRA.

 
IGF-I and IGFBP-1 levels in tissues
Hepatic and renal IGF-I and renal IGFBP-1 protein levels were measured after 2 d of the hIGFBP-1/GHRA regimen without ipamorelin administration (experiment 3). Hepatic and renal IGF-I protein contents were increased in mice injected with hIGFBP-1 compared with levels in all groups (Figs. 3BGo and 4AGo). Renal IGFBP-1 levels were significantly higher in both groups receiving hIGFBP-1 compared with other two groups (Fig. 4BGo).



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 4. Kidney IGF-I (A) and IGFBP-1 (B) protein and mRNA levels after 2 d in mice receiving placebo ({square}), GHRA ({cjs2112}), hIGFBP-1 ({cjs2113}), or hIGFBP-1/GHRA ({cjs2110}). Values are the mean ± SEM (n = 7). *, P < 0.01 vs. placebo group; #, P < 0.05 vs. hIGFBP-1/GHRA group.

 
Expression of GH/IGF system genes in liver and kidney
The expression of GHR, GHBP, IGF-I, IGFBP-1, and IGFBP-3 genes was measured after 2 d of GHRA and/or hIGFBP-1 administration without ipamorelin stimulation (experiment 3). Hepatic GHR mRNA levels were significantly increased in mice receiving GHRA compared with those in groups receiving placebo and hIGFBP-1/GHRA (Fig. 5Go). GHBP mRNA levels were decreased in livers of both groups receiving hIGFBP-1 compared with those in mice receiving placebo, and in the hIGFBP-1/GHRA group compared with the GHRA group (Fig. 5Go). The expression of IGF-I and IGFBP-3 was decreased in both groups receiving GHRA compared with control values and in the hIGFBP-1/GHRA group compared with mice receiving hIGFBP-1 only (Fig. 3C). IGF-I mRNA levels were significantly higher in livers of mice receiving hIGFBP-1 than those in mice receiving placebo (Fig. 3CGo). Hepatic IGFBP-1 mRNA levels were decreased in all groups compared with control values, reaching significance in mice receiving GHRA alone and in mice receiving hIGFBP-1 alone (Fig. 3CGo). Renal GHR and GHBP mRNA levels were increased in the hIGFBP-1/GHRA group compared with those in the placebo and GHRA groups (Fig. 5). The increase in the hIGFBP-1 group compared with the placebo group was statistically significant only for GHBP mRNA levels. The expression of IGF-I was down-regulated in kidneys of mice receiving hIGFBP-1/GHRA compared with placebo and hIGFBP-1 groups (Fig. 4AGo). Renal IGFBP-1 mRNA levels were significantly higher in both groups receiving hIGFBP-1 compared with controls (Fig. 4BGo).



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 5. GHR and GHBP mRNA in liver (A) and kidney (B) in mice receiving placebo ({square}), GHRA ({cjs2112}), hIGFBP-1 ({cjs2113}), or hIGFBP-1/GHRA ({cjs2110}). Values are the mean ± SEM (n = 7). **, P < 0.01; *, P < 0.05 vs. placebo group. #, P < 0.02 vs. hIGFBP-1/GHRA group.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The major new finding of the present study is data supporting a direct, IGF-I-independent, stimulating effect of IGFBP-1 on GH secretion. The hIGFBP-1-induced increase in serum total IGF-I levels was abolished by GHRA coadministration, whereas the increase in serum GH was not affected. Furthermore, free IGF-I levels were unaffected by hIGFBP-1 administration. This suggests that the hIGFBP-1 induced increase in serum GH levels was not due to a IGF-I-dependent feedback mechanism.

Circulating IGF-I has an important feedback function within the somatotropic axis. Serum GH levels are increased in both liver-specific IGF-I knockout mice, also known as liver IGF-I-deficient (LID), consistent with the reduction in the inhibitory effect of circulating IGF-I on GH release from the somatotroph (32, 33). IGFBP-1 may affect GH secretion indirectly by lowering the free IGF-I level in the circulation, thereby activating a negative feedback. Several clinical investigations have suggested that IGFBP-1 is one of the most important regulators of IGF-I in vivo (34, 35). Transgenic (TG) mice with liver-specific expression of hIGFBP-1 have diminished serum total IGF-I levels and restricted postnatal growth, although serum GH is not altered (36, 37, 38). In these mice, the GH content of the pituitary was significantly reduced as a consequence of hIGFBP-1 overexpression, and exogenous hGH increased serum IGF-I and body weight. Insufficient GH production probably occurred due to a suppressed number of somatotrophs, with a resulting increased GH synthesis by the smaller somatotroph population reflecting an appropriate response of the hypothalamo-pituitary system to the sequestration of free IGF-I by excess IGFBP-1 (39). In concert with the observed reduction in body growth in IGFBP-1 TG mice, administration of hIGFBP-1 to Snell dwarf mice inhibited IGF-I-stimulated body growth, but stimulated kidney growth (22). Recombinant hIGFBP-1 administered to GH- or IGF-I-treated hypophysectomized rats reduces the effects of these growth stimulators on somatic growth (40). All of these studies indirectly indicate that IGFBP-1 is able to alter GH secretion via an IGF-I feedback mechanism.

The present study was designed to test the effects of excess IGFBP-1 on GH and IGF-I generation with and without peripheral blockade by GHRA. Although the administration of GHRA alone did not have any effect on serum levels of IGF-I and IGFBP-3, it abolished the hIGFBP-1-induced increase in serum IGF-I and IGFBP-3 as well as their hepatic mRNA expressions. However, GHRA did not attenuate the hIGFBP-1-induced increase in ipamorelin-stimulated serum GH values; furthermore, there was no difference in free IGF-I serum levels between the groups. Hepatic GHR mRNA levels were increased in response to the functional peripheral blockade of the GHR by GHRA, as described previously (18). Up-regulation of the GHR concentration in liver microsomes was demonstrated in TG dwarf mice expressing GHRA (41). Coadministration of hIGFBP-1 normalized GHR gene expression in the liver. Taken together, these results suggest that hIGFBP-1 is directly responsible for the increased serum GH levels.

Another possibility is that IGFBP-1 down-regulates the bioactivity of the circulating IGF-I pool despite the unchanged levels of free IGF-I. Based on human studies, circulating levels of free IGF-I appear to be more closely related to changes in GH secretion than total IGF-I (42, 43). However, in mice, the role of circulating free IGF-I in controlling GH secretion remains less certain. In LID mice as well as in LID-ALS knockout mice, serum levels of free IGF-I are elevated despite markedly increased GH secretion and highly reduced levels of total IGF-I. In the present study we found normal levels of ultrafiltered free IGF-I after IGFBP-1 treatment. On the other hand, Lang et al. (44) recently published the results of study in which they observed a reduction in serum free IGF-I, as determined by ultrafiltration, after continuous iv infusion of purified human amniotic IGFBP-1. Whether it is the sc administration route, the sampling time (2.5 h after injection), or the IGFBP-1 dose that we chose that is responsible for the lack of reduction in free IGF-I after IGFBP-1 infusion remains unsolved. Because we used morning samples rather than longitudinal samples, we cannot fully exclude the possibility that free IGF-I levels were lower at other time points and therefore are indeed responsible for the increased GH secretion.

It is well known that serum IGFBP-1 levels are inversely related to changes in insulin secretion (13). However, GH is able to modulate the dominant insulin regulation of IGFBP-1, mostly by down-regulation of IGFBP-1 expression (13). In the present study GHRA administration decreased IGFBP-1 gene expression in the liver, although it did not alter IGFBP-1 serum levels. Furthermore, insulin levels were not affected by any of the treatments.

The renal IGF-I content was increased after hIGFBP-1 administration and was normalized by GHRA coadministration, reflecting the changes seen in serum and liver. However, renal IGF-I mRNA levels were unchanged after hIGFBP-1 injection (unlike hepatic IGF-I levels), suggesting that renal IGF-I accumulation is due to sequestration of circulating IGF-I, rather than to local synthesis. It is possible that IGFBP-1 traps IGF-I in the kidney. Accordingly, IGFBP-1 has been suggested to play a role in sequestering circulatory IGF-I, leading to the increased renal IGF-I content preceding kidney enlargement seen in early experimental diabetes in rodents (45). The administration of hIGFBP-1 to Snell dwarf mice resulted in kidney growth (22). Finally, it has been suggested that the well known inhibitory effect of a long-acting SS analog (octreotide) on the early increase in renal IGF-I concentration and renal size in diabetes may be mediated through a direct inhibitory effect on renal IGFBP-1 levels (46). Although GHRA administration significantly increased hepatic GHR mRNA levels, renal GHR and GHBP mRNA levels did not change significantly. These results, indicating that the regulation of mouse GHR expression is tissue specific, are in agreement with those of other studies examining renal GHR/GHBP mRNA levels (18, 21, 47, 48).

In summary, our data support a direct stimulating effect of IGFBP-1 on serum GH levels, suggesting that IGFBP-1 is involved in the complex network of feedback mechanisms in the regulation of GH secretion. Additional studies are warranted to elucidate the complex nature of the regulation of GH secretion and the specific role of IGFBP-1.


   Acknowledgments
 
Excellent technical assistance was provided by Natasja Dits, Cora Groffen, Karen Mathiassen, Kirsten Nyborg, and Ninna Rosenqvist. We thank Dr. Jaap Twisk (Division of Biopharmaceutics, Leiden/Amsterdam Center for Drug Research, Leiden, The Netherlands) for setting up the real-time PCR method.


   Footnotes
 
This work was supported by grants from the Dutch Diabetes Research Foundation, the Danish Diabetes Association, the Danish Medical Research Council, and the Clinical Institute at Aarhus University Hospital.

Abbreviations: ALS, Acid-labile subunit; GHBP, GH-binding protein; GHR, GH receptor; GHRA, GH receptor antagonist; GHRH, GH-releasing hormone; h, human; IGFBP-1, IGF-binding protein-1; LID, liver IGF-I-deficient; m, mouse; PEG, polyethylene glycol; SS, somatostatin; TG, transgenic; WLB, Western ligand blot.

Received December 23, 2003.

Accepted for publication May 20, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Giustina A, Veldhuis JD 1998 Pathophysiology of the neuroregulation of growth hormone secretion in experimental animals and the human. Endocr Rev 19:717–797[Abstract/Free Full Text]
  2. Asa SL, Coschigano KT, Bellush L, Kopchick JJ, Ezzat S 2000 Evidence for growth hormone (GH) autoregulation in pituitary somatotrophs in GH antagonist-transgenic mice and GH receptor-deficient mice. Am J Pathol 156:1009–1015[Abstract/Free Full Text]
  3. Berelowitz M, Szabo M, Frohman LA, Firestone S, Chu L, Hintz RL 1981 Somatomedin-C mediates growth hormone negative feedback by effects on both the hypothalamus and the pituitary. Science 212:1279–1281[Abstract/Free Full Text]
  4. Wallenius K, Sjogren K, Peng XD, Park S, Wallenius V, Liu JL, Umaerus M, Wennbo H, Isaksson O, Frohman L, Kineman R, Ohlsson C, Jansson JO 2001 Liver-derived IGF-I regulates GH secretion at the pituitary level in mice. Endocrinology 142:4762–4770[Abstract/Free Full Text]
  5. Firth SM, Baxter RC 2002 Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev 23:824–854[Abstract/Free Full Text]
  6. Baumann G 2002 Growth hormone binding protein. The soluble growth hormone receptor. Minerva Endocrinol 27:265–276[Medline]
  7. Le Roith D, Bondy C, Yakar S, Liu JL, Butler A 2001 The somatomedin hypothesis: 2001. Endocr Rev 22:53–74[Abstract/Free Full Text]
  8. Hu M, Robertson DG, Murphy LJ 1996 Growth hormone modulates insulin regulation of hepatic insulin-like growth factor binding protein-1 transcription. Endocrinology 137:3702–3709[Abstract]
  9. Drop SL, Kortleve DJ, Guyda HJ, Posner BI 1984 Immunoassay of a somatomedin-binding protein from human amniotic fluid: levels in fetal, neonatal, and adult sera. J Clin Endocrinol Metab 59:908–915[Abstract]
  10. Busby WH, Snyder DK, Clemmons DR 1988 Radioimmunoassay of a 26,000-dalton plasma insulin-like growth factor-binding protein: control by nutritional variables. J Clin Endocrinol Metab 67:1225–1230[Abstract]
  11. Rosenfeld RG, Lamson G, Pham H, Oh Y, Conover C, De Leon DD, Donovan SM, Ocrant I, Giudice L 1990 Insulinlike growth factor-binding proteins. Recent Prog Horm Res 46:99–163
  12. Seneviratne C, Luo JM, Murphy LJ 1990 Transcriptional regulation of rat insulin-like growth factor-binding protein-1 expression by growth hormone. Mol Endocrinol 4:1199–1204[Abstract]
  13. Kachra Z, Yang CR, Murphy LJ, Posner BI 1994 The regulation of insulin-like growth factor-binding protein 1 messenger ribonucleic acid in cultured rat hepatocytes: the roles of glucagon and growth hormone. Endocrinology 135:1722–1728[Abstract]
  14. Lee PD, Giudice LC, Conover CA, Powell DR 1997 Insulin-like growth factor binding protein-1: recent findings and new directions. Proc Soc Exp Biol Med 216:319–357[Abstract]
  15. Nørrelund H, Fisker S, Vahl N, Børglum J, Richelsen B, Christiansen JS, Jørgensen JO 1999 Evidence supporting a direct suppressive effect of growth hormone on serum IGFBP-1 levels. Experimental studies in normal, obese and GH-deficient adults. Growth Horm IGF Res 9:52–60[CrossRef][Medline]
  16. Lupu F, Terwilliger JD, Lee K, Segre GV, Efstratiadis A 2001 Roles of growth hormone and insulin-like growth factor 1 in mouse postnatal growth. Dev Biol 229:141–162[CrossRef][Medline]
  17. Kopchick JJ, Parkinson C, Stevens EC, Trainer PJ 2002 Growth hormone receptor antagonists: discovery, development, and use in patients with acromegaly. Endocr Rev 23:623–646[Abstract/Free Full Text]
  18. van Neck JW, Dits NF, Cingel V, Hoppenbrouwers IA, Drop SL, Flyvbjerg A 2000 Dose-response effects of a new growth hormone receptor antagonist (B2036-PEG) on circulating, hepatic and renal expression of the growth hormone/insulin-like growth factor system in adult mice. J Endocrinol 167:295–303[Abstract]
  19. Thorner MO, Strasburger CJ, Wu Z, Straume M, Bidlingmaier M, Pezzoli SS, Zib K, Scarlett JC, Bennett WF 1999 Growth hormone (GH) receptor blockade with a PEG-modified GH (B2036-PEG) lowers serum insulin-like growth factor-I but does not acutely stimulate serum GH. J Clin Endocrinol Metab 84:2098–2103[Abstract/Free Full Text]
  20. Flyvbjerg A, Bennett WF, Rasch R, Kopchick JJ, Scarlett JA 1999 Inhibitory effect of a growth hormone receptor antagonist (G120K-PEG) on renal enlargement, glomerular hypertrophy, and urinary albumin excretion in experimental diabetes in mice. Diabetes 48:377–382[Abstract]
  21. Flyvbjerg A, Bennett WF, Rasch R, van Neck JW, Groffen CA, Kopchick JJ, Scarlett JA 1999 Compensatory renal growth in uninephrectomized adult mice is growth hormone dependent. Kidney Int 56:2048–2054[CrossRef][Medline]
  22. Van Buul-Offers SC, Van Kleffens M, Koster JG, Lindenbergh-Kortleve DJ, Gresnigt MG, Drop SL, Hoogerbrugge CM, Bloemen RJ, Koedam JA, Van Neck JW 2000 Human insulin-like growth factor (IGF) binding protein-1 inhibits IGF-I-stimulated body growth but stimulates growth of the kidney in Snell dwarf mice. Endocrinology 141:1493–1499[Abstract/Free Full Text]
  23. Schuller AG, Lindenbergh-Kortleve DJ, de Boer WI, Zwarthoff EC, Drop SL 1993 Localization of the epitope of a monoclonal antibody against human insulin-like growth factor binding protein-1, functionally interfering with insulin-like growth factor binding. Growth Regul 3:32–34[Medline]
  24. Hossenlopp P, Seurin D, Segovia-Quinson B, Hardouin S, Binoux M 1986 Analysis of serum insulin-like growth factor binding proteins using Western blotting: use of the method for titration of the binding proteins and competitive binding studies. Anal Biochem 154:138–143[CrossRef][Medline]
  25. van Buul-Offers SC, Reijnen-Gresnigt MG, Hoogerbrugge CM, Bloemen RJ, Kuper CF, Van den Brande JL 1994 Recombinant insulin-like growth factor-II inhibits the growth-stimulating effect of growth hormone on the liver of Snell dwarf mice. Endocrinology 135:977–985[Abstract]
  26. Raun K, Hansen BS, Johansen NL, Thogersen H, Madsen K, Ankersen M, Andersen PH 1998 Ipamorelin, the first selective growth hormone secretagogue. Eur J Endocrinol 139:552–561[Abstract]
  27. Frystyk J, Grønbæk H, Skjærbæk C, Flyvbjerg A 1995 Effect of hyperthyroidism on circulating levels of free and total IGF-I and IGFBPs in rats. Am J Physiol 269:E840–E845
  28. Flyvbjerg A, Kessler U, Dorka B, Funk B, Ørskov H, Kiess W 1992 Transient increase in renal insulin-like growth factor binding proteins during initial kidney hypertrophy in experimental diabetes in rats. Diabetologia 35:589–593[CrossRef][Medline]
  29. Chomczynski P 1993 A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 15:532–537[Medline]
  30. van Neck JW, Cingel V, van Vliet AK, Drop SL, Flyvbjerg A 2002 High-protein induced renal enlargement is growth hormone independent. Kidney Int 62:1187–1195[CrossRef][Medline]
  31. Meijerink J, Mandigers C, van de Locht L, Tonnissen E, Goodsaid F, Raemaekers J 2001 A novel method to compensate for different amplification efficiencies between patient DNA samples in quantitative real-time PCR. J Mol Diagn 3:55–61[Abstract/Free Full Text]
  32. Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B, LeRoith D 1999 Normal growth and development in the absence of hepatic insulin-like growth factor I. Proc Natl Acad Sci USA 96:7324–7329[Abstract/Free Full Text]
  33. Sjögren K, Liu JL, Blad K, Skrtic S, Vidal O, Wallenius V, LeRoith D, Törnell J, Isaksson OG, Jansson JO, Ohlsson C 1999 Liver-derived insulin-like growth factor I (IGF-I) is the principal source of IGF-I in blood but is not required for postnatal body growth in mice. Proc Natl Acad Sci USA 96:7088–7092[Abstract/Free Full Text]
  34. Skjærbæk C, Frystyk J, Moller J, Christiansen JS, Ørskov H 1996 Free and total insulin-like growth factors and insulin-like growth factor binding proteins during 14 days of growth hormone administration in healthy adults. Eur J Endocrinol 135:672–677[Abstract]
  35. Frystyk J, Grofte T, Skjærbæk C, Ørskov H 1997 The effect of oral glucose on serum free insulin-like growth factor-I and -II in health adults. J Clin Endocrinol Metab 82:3124–3127[Abstract/Free Full Text]
  36. Gay E, Seurin D, Babajko S, Doublier S, Cazillis M, Binoux M 1997 Liver-specific expression of human insulin-like growth factor binding protein-1 in transgenic mice: repercussions on reproduction, ante- and perinatal mortality and postnatal growth. Endocrinology 138:2937–2947[Abstract/Free Full Text]
  37. Doublier S, Seurin D, Fouqueray B, Verpont MC, Callard P, Striker LJ, Striker GE, Binoux M, Baud L 2000 Glomerulosclerosis in mice transgenic for human insulin-like growth factor-binding protein-1. Kidney Int 57:2299–2307[CrossRef][Medline]
  38. Rajkumar K, Barron D, Lewitt MS, Murphy LJ 1995 Growth retardation and hyperglycemia in insulin-like growth factor binding protein-1 transgenic mice. Endocrinology 136:4029–4034[Abstract]
  39. Seurin D, Froment P, Bluet-Pajot MT, Epelbaum J, Monget P, Binoux M 2002 Functional alteration of the somatotrophic axis in transgenic mice with liver-specific expression of human insulin-like growth factor binding protein-1. Pediatr Res 52:168–174[CrossRef][Medline]
  40. Cox GN, McDermott MJ, Merkel E, Stroh CA, Ko SC, Squires CH, Gleason TM, Russell D 1994 Recombinant human insulin-like growth factor (IGF)-binding protein-1 inhibits somatic growth stimulated by IGF-I and growth hormone in hypophysectomized rats. Endocrinology 135:1913–1920[Abstract]
  41. Sotelo AI, Bartke A, Kopchick JJ, Knapp JR, Turyn D 1998 Growth hormone (GH) receptors, binding proteins and IGF-I concentrations in the serum of transgenic mice expressing bovine GH agonist or antagonist. J Endocrinol 158:53–59[Abstract]
  42. Chapman IM, Hartman ML, Pieper KS, Skiles, EH, Pezzoli SS, Hintz RL, Thorner MO 1998 Recovery of growth hormone release from suppression by exogenous insulin-like growth factor I (IGF-I): evidence for a suppressive action of free rather than bound IGF-I. J Clin Endocrinol Metab 83:2836–2842[Abstract/Free Full Text]
  43. Frystyk J, Vestbo E, Skjaerbaek C, Mogensen CE, Orskov H 1995 Free insulin-like growth factors in human obesity. Metabolism 44:37–44[CrossRef][Medline]
  44. Lang CH, Vary TC, Frost RA 2003 Acute in vivo elevation of insulin-like growth factor (IGF) binding protein-1 decreases plasma free IGF-I and muscle protein synthesis. Endocrinology 144:3922–3933[Abstract/Free Full Text]
  45. LeRoith D, Werner H, Phillip M, Roberts Jr CT 1993 The role of insulin-like growth factors in diabetic kidney disease. Am J Kidney Dis 22:722–726[Medline]
  46. Raz I, Rubinger D, Popovtzer M, Grønbæk H, Weiss O, Flyvbjerg A 1998 Octreotide prevents the early increase in renal insulin-like growth factor binding protein 1 in streptozotocin diabetic rats. Diabetes 47:924–930[Abstract]
  47. Chen NY, Chen WY, Kopchick JJ 1997 Liver and kidney growth hormone (GH) receptors are regulated differently in diabetic GH and GH antagonist transgenic mice. Endocrinology 138:1988–1994[Abstract/Free Full Text]
  48. Segev Y, Landau D, Rasch R, Flyvbjerg A, Phillip M 1999 Growth hormone receptor antagonism prevents early renal changes in nonobese diabetic mice. J Am Soc Nephrol 10:2374–2381[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
D. Glintborg, R. K. Stoving, C. Hagen, A. P. Hermann, J. Frystyk, J. D. Veldhuis, A. Flyvbjerg, and M. Andersen
Pioglitazone Treatment Increases Spontaneous Growth Hormone (GH) Secretion and Stimulated GH Levels in Polycystic Ovary Syndrome
J. Clin. Endocrinol. Metab., October 1, 2005; 90(10): 5605 - 5612.
[Abstract] [Full Text] [PDF]

Home page
 Exp. Biol. Med.Home page
V. Cingel-Ristic, B. F. Schrijvers, A. K. van Vliet, R. Rasch, V. K. M. Han, S. L. S. Drop, and A. Flyvbjerg
Kidney Growth in Normal and Diabetic Mice Is Not Affected by Human Insulin-Like Growth Factor Binding Protein-1 Administration
Experimental Biology and Medicine, February 1, 2005; 230(2): 135 - 143.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/9/4401    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cingel-Ristic, V.
Right arrow Articles by Flyvbjerg, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cingel-Ristic, V.
Right arrow Articles by Flyvbjerg, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals