help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2004-0889
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
146/1/237    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, Y.
Right arrow Articles by Hu, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, Y.
Right arrow Articles by Hu, Y.
Endocrinology Vol. 146, No. 1 237-246
Copyright © 2005 by The Endocrine Society

The Orphan Nuclear Receptors NURR1 and NGFI-B Modulate Aromatase Gene Expression in Ovarian Granulosa Cells: A Possible Mechanism for Repression of Aromatase Expression upon Luteinizing Hormone Surge

Yimin Wu, Sagar Ghosh, Yoshihiro Nishi, Toshihiko Yanase, Hajime Nawata and Yanfen Hu

Department of Biochemistry and Molecular Genetics (Y.W., S.G., Y.H.), School of Medicine, University of Virginia, Charlottesville, Virginia 22908-0733; and Department of Medicine and Bioregulatory Science (Y.N., T.Y., H.N.), Graduate School of Medical Sciences, Kyushu University, Higashi-Ku, Fukuoka 812-8582, Japan

Address all correspondence and requests for reprints to: Yanfen Hu, Department of Biochemistry and Molecular Genetics, School of Medicine, P.O. Box 800733, University of Virginia, Charlottesville, Virginia 22908-0733. E-mail: yh4b{at}virginia.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ovarian granulosa cells play pivotal roles in many aspects of ovary functions including folliculogenesis and steroidogenesis. In response to FSH and LH, the elevation of intracellular cAMP level in granulosa cells leads to activation of multiple ovarian genes. Here, we report findings from a genome-wide study of the cAMP-responsive gene expression profiles in a human granulosa-like tumor cell line, KGN. The study identified 140 genes that are either activated or repressed by 2-fold or greater after stimulation by the adenylyl cyclase activator forskolin. The induction patterns of some cAMP-responsive genes were further analyzed by quantitative real-time PCR. Consistent with previous observations, the LH-responsive genes, such as the nuclear receptor 4A subfamily (NURR1, NGFI-B, and NOR-1), were rapidly but transiently induced, whereas the FSH-responsive gene CYP19 encoding aromatase was induced in a delayed fashion. Interestingly, ectopic expression of NURR1 or NGFI-B severely attenuated the cAMP-responsive activation of the ovary-specific aromatase promoter. Reduction of the endogenous NURR1 or NGFI-B by small interfering RNA significantly elevated aromatase gene expression. The cis-elements responsible for NURR1/NGFI-B-mediated repression were mapped to the minimal aromatase promoter sequence that confers camp responsiveness. Furthermore, the DNA-binding domain of NURR1 was required for the repression. Taken together, these results strongly suggest a causal relationship between the rapid decline of aromatase mRNA and induction of nuclear receptor subfamily 4A expression, which concomitantly occur upon LH surge at the later stages of ovarian follicular development.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
OVARIAN FOLLICULAR DEVELOPMENT and function are controlled by multiple components along the hypothalamic-pituitary-ovarian axis, including the gonadotropins produced by the pituitary gland and a plethora of ovarian genes activated in response to the peptide hormones (1, 2). In particular, FSH and LH play pivotal roles in both promoting follicular maturation and inducing gene expression involved in hormonal action (3, 4). Upon binding to their cognate receptors, the pituitary hormones activate the receptor-coupled adenylyl cyclase that leads to an increased intracellular cAMP level. Numerous studies have firmly established that cAMP activates the protein kinase A-dependent pathway and other signal transduction cascades, which ultimately control differentiation of ovarian granulosa cells and expression of ovarian genes (5, 6). Thus, cAMP can be viewed as a molecular switch that mediates diverse FSH/LH-stimulated functions of ovarian follicles. A comprehensive understanding of its impact on ovarian gene expression will shed light on the molecular and biochemical nature of the signaling cascades involved.

Many downstream target genes of FSH and LH in ovarian granulosa cells have been identified over the years (1, 3). Extensive studies of the gonadotropin-mediated ovarian gene expression have also revealed a high degree of complexity in the regulatory pattern (1). First, the action of gonadotropins at a defined follicular development stage appears to be mediated by multiple intracellular signal transduction pathways and many trans-acting transcription factors. Furthermore, FSH-responsive gene activation occurs in a sequential order, with rapid activation of the immediate-early genes, such as c-fos and serum glucocorticoid kinase, but delayed expression of some other genes including aromatase (CYP19) and inhibin {alpha} (7, 8, 9). Finally, the effects of gonadotropins on ovarian gene expression are modulated by additional factors that are associated with specific stages of follicular development, ovulation, and luteinization. For instance, FSH induces a robust expression of aromatase in granulosa cells of preovulatory follicles but not preantral follicles (1). On the other hand, many FSH-stimulated genes in granulosa cells are down-regulated in response to the LH surge during the early stages of luteinization (10, 11). The molecular basis for modulating the FSH effect during follicle maturation remains to be better understood.

Nuclear receptor subfamily 4A (NR4A) is a group of orphan nuclear receptors that includes NGFI-B, NURR1, and NOR-1 (12, 13). The genes that encode the NR4A subfamily are considered immediate-early genes because they are rapidly induced by a variety of stimuli including cAMP, phorbol ester, and growth factors (12, 13). All three members of the NR4A subfamily share significant sequence similarity, recognize common DNA sequences, and play important and partially redundant roles in the nervous, endocrine, and immune systems. Of particular relevance to ovarian follicular maturation, NGFI-B is expressed in cultured ovarian granulosa cells and corpora lutea but not in small antral or preovulatory follicles (1). In addition, NGFI-B has been shown to activate steroidogenic gene expression during luteinization (14), thus indicating a functional relevance of the stage-specific expression of NGFI-B in follicular maturation. The preovulatory surge of LH, which triggers the transition from preovulatory follicles to ovulatory and luteinizing follicles, induces the rapid and transient expression of ovarian NGFI-B as well as the other two members of the NR4A subfamily (15). As well documented, the LH surge also leads to a rapid decline in the expression of multiple FSH-stimulated genes (e.g. aromatase) (10, 11). However, it remains unclear as to whether the concomitant induction of the NR4A family and repression of aromatase expression upon the LH surge is causally related.

In this report, we conducted a series of transcription studies using a recently established human granulosa tumor-derived cell line, KGN (16). Previous extensive characterization of this cell line demonstrates that it maintains most physiological functions of granulosa cells in vivo, such as steroidogenesis, cell growth, and apoptosis (16, 17, 18, 19). We first performed a genome-wide study of the cAMP-stimulated gene expression profile in the granulosa cells. Our study uncovers 140 genes that are either up-regulated or down-regulated upon forskolin treatment. We then followed up the microarray study by exploring the functional significance of the rapid and transient induction of the NR4A gene family in granulosa cells. Our work suggests a regulatory function of NGFI-B and NURR1 in ovarian gene expression. Specifically, they strongly inhibit transcription driven by the ovary-specific aromatase promoter. Based on these results, we propose that the LH-induced NR4A genes may play a critical role in down-regulating FSH-responsive gene expression, thus promoting the transition from preovulatory follicles to corpora lutea.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell line and plasmids
The culture condition for the human ovarian granulosa-like tumor cell line KGN has been previously described (16). To construct the expression vectors for NURR1 and NGFI-B, cDNA of both genes was amplified by RT-PCR from total RNA of forskolin-treated KGN cells and subsequently cloned into the HindIII and XhoI (or EcoRI) sites of pcDNA3-FLAG plasmid. A similar strategy was used to construct the deletion mutants of NURR1. The 5' primers used for amplifying the deletion fragments contain an additional sequence that encodes the nuclear localization sequence of the simian virus 40 large T antigen. The resulting expression vectors contain the nuclear localization sequence-encoding sequence situated between the FLAG tag and NURR1 fragments. To construct the various aromatase luciferase reporter plasmids, the corresponding genomic fragments were amplified from the human genomic DNA (Clontech, Palo Alto, CA) and subcloned into the restriction sites XhoI and HindIII located upstream of the luciferase gene in pTRE-luc plasmid (BD Bioscience Clontech) to replace the TRE-CMV sequence. The identity of all inserts was verified by sequencing. The hCYP11B2 luciferase reporter and the synthetic NR4A-responsive luciferase reporter p(Bla)8luc were described previously (20, 21).

Microarray hybridization experiments and data analysis
KGN cells were treated with either vehicle or forskolin (Sigma, St. Louis, MO) at a final concentration of 25 µM for 3 h. The cultures were harvested and processed for further analyses. RNA was isolated, and microarray hybridization was performed in duplicates as described previously (22), except that Affymetrix (Santa Clara, CA) microarray chips (HG-U133A) were used. Microarray data were analyzed using the Dchip software package previously described (23).

Real-time PCR
KGN cells were treated with forskolin for the time period as indicated in the figures. Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. RNA was reverse transcribed using the random primers of the ImPrompII kit from Promega (Madison, WI). The real-time PCR assay was conducted following the manufacturer’s procedures (Applied Biosystems, Foster City, CA). Essentially, the fluorescent dye SYBR Green was used in an ABI PRISM 7700 Sequence Detection System (Applied Biosystems). Real-time PCR for the aromatase gene shown in Fig. 5BGo was conducted using a FAM-labeled probe/primer set. The sequences of the specific PCR primers were as follows (5' to 3'): Arom (SYBR), forward: TTCCCCAAACCCAATGAATTT; reverse: ACTTTCCTGCACAGCCACG; Arom (TaqMan), forward: CCTCAATACCAGGTCCTGGC; reverse: CAGGAATCTGCCGTGGGA; probe: 6FAM-ACTGCATGGGAATTGGACCCCTCAT-TAMRA; reverse: GACGGTGCCATGGAATTTG; StAR, forward: TGCCTGAGCAGAAGGGTGTC; reverse: AGCACCATGCAAGTGGGAC; NGFI-B, forward: AACCCCGCCTCTTCCTCC; reverse: TATTGGGCTTGGATACAGGGC; NURR1, forward: GCTGGGTGTCATCTCCACTCA; reverse: GCCCATGTCGACTCCAACC; NOR-1, forward: CCTTCTCCTCCAATCTGCATG; reverse: CAGCCTGGTCAGTGGGACA; Fra1, forward: CTGCAGGCGGAGACTGACA; reverse: TTCCAGCACCAGCTCTAGGC; GADD45{alpha}, forward: CGGACCTGCACTGCGTG; reverse: TCCATGTAGCGACTTTCCCG; GADD45ß, forward: GGTGTACGAGTCGGCCAAGT; reverse: GATTTGCAGGGCGATGTCA; KLF4, forward: ATCTCAAGGCACACCTGCG; reverse: CCTGGTCAGTTCATCTGAGCG; and ß-actin, forward: CCAGATCATGTTTGAGACCTTCAAC; reverse: CCAGAGGCGTACAGGGATAGC.


Figure 5
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 5. Reduction of endogenous NURR1 in KGN cells enhances the basal and forskolin-induced expression of the aromatase gene. A, Quantitative real-time PCR analysis of the NURR1 mRNA level in the mock (buffer), control (luciferase), and NURR1-specific siRNA-transfected cells. B, Real-time PCR determining the aromatase transcript levels in the mock, control, and NURR1 knockdown cells. Results are averages of triplicates that are normalized against the transcript levels of ß-actin.

 
Dual luciferase reporter assay
KGN cells were transfected using FuGene 6 (Roche, Indianapolis, IN) according to the manufacturer’s instructions. On the following day, cells were treated overnight with either vehicle or forskolin at a final concentration of 25 µM. Typically, 250 ng of firefly luciferase reporter plasmid, 10–250 ng of the NR4A expression vectors, and 1 ng of phRL-CMV Renilla luciferase plasmid (Promega) were used. The dual luciferase activity was measured using the reagents from Promega. The firefly luciferase values were normalized against those of the Renilla luciferase. The presented data were averages of quadruplets.

Small interfering RNA (siRNA) knockdown
Transient transfection of the luciferase or NGFI-B- or NURR1-specific siRNA oligonucleotides (200 nmol per well in a six-well dish) was conducted using Oligofectamine (Invitrogen). The luciferase (catalog no. D-001100-01-80) and NURR1-specific oligonucleotides (catalog no. D-003427-04) were purchased from Dharmacon (Lafayette, CO). Two consecutive transfections were carried out, followed by forskolin treatment for 24 h.

Immunoblotting
KGN cells were treated with forskolin as indicated. Total cell lysates were prepared by lysing the cells in the sodium dodecyl sulfate sample buffer. Equal amount of total proteins was resolved by SDS-PAGE, and immunoblotting was performed following the manufacturer’s instructions using anti-NURR1 (catalog no. SC5568; Santa Cruz Biotechnology Inc., Santa Cruz, CA) and anti-NGFI-B (catalog no. 554088; BD PharMingen, San Diego, CA) or anti-FLAG antibodies (F-3165; Sigma).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Whole-genome analysis of cAMP-regulated genes
The KGN granulosa-like tumor cell line was recently established (16). It exhibits properties similar to those of ovarian granulosa cells in vivo including cAMP-inducible aromatase expression (16, 17, 18, 19), thus validating its utility in studying granulosa cell differentiation and steroidogenesis. To conduct a genome-wide search for cAMP-responsive genes in KGN cell line, asynchronously growing cells were treated with either vehicle or 25 µM forskolin for 3 h. Total RNA was isolated from the mock- or forskolin-treated cells. Fluorescence-labeled cDNA was used to cohybridize Affymetrix microarray chips (HG-U133A) that contain 14,000 well-characterized human open reading frames. Two independent cohybridizations were performed, and data were analyzed. A total of 140 genes displayed over 2.0-fold difference in expression between the mock- and forskolin-treated samples at the 95% confidence level (P ≤ 0.05). Among these genes, 56 were stimulated upon forskolin treatment (Table 1Go), whereas the remaining 84 genes were down-regulated after the treatment (Supplemental Table 1, published on The Endocrine Society’s Journals Online web site, http://endo.endojournals.org). The list of cAMP-stimulated genes includes those with known functions in the cAMP-mediated signal transduction pathway (e.g. CREM) and ovarian follicles (e.g. aromatase and inhibin ßA). The cAMP-responsive gene set entails genes involved in a diverse range of cellular and biological processes. Interestingly, many of the forskolin-activated genes are transcription regulators, some of which have been implicated in regulation of gonadal gene expression, such as NURR1, NOR-1 (15), and GATA-4 (24). On the other hand, some of the forskolin-repressed genes are known for their functions in stress response and inhibition of cell proliferation (e.g. GADD45{alpha} and GADD45ß) (25).


View this table:
[in this window]
[in a new window]
 
TABLE 1. List of forskolin-induced genes (2-fold or more)

 
Confirmation of the microarray data by real-time PCR
Using real-time RT-PCR analysis, we confirmed the effect of forskolin on the expression of five cAMP-activated genes (NURR-1, NOR-1, aromatase, StAR, and KLF4) and three cAMP-repressed genes (GADD45{alpha}, GADD45ß, and FRA1). Because the two most activated genes in the microarray belong to the NR4A orphan receptor family (18.9-fold for NR4A2/NURR1 and 15.7-fold for NR4A3/NOR-1), we also included NR4A1/NGFI-B, the third member of the NR4A family, in the real-time PCR study. Total RNA was isolated from the KGN cells treated with either vehicle or 25 µM forskolin. As shown in Fig. 1Go, A–F, mRNA levels of NGFI-B, NURR1, NOR-1, aromatase, StAR, and KLF4 were increased to various degrees after forskolin treatment, which is consistent with their being cAMP-activated genes. In contrast, transcripts of GADD45{alpha}, GADD45ß, and FRA1 were reduced in response to forskolin (Fig. 1Go, G–I), thus corroborating the repressive effect of forskolin on these genes as observed in the microarray study.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. Confirmation of the microarray data on several forskolin-responsive genes by real-time RT-PCR. KGN cells were treated with vehicle or forskolin (25 µM) for various periods of time. Real-time RT-PCR was conducted on the total RNA to assess the transcription level of several forskolin-responsive genes. The results are averages of duplicates that are normalized against ß-actin mRNA levels.

 
Several distinct patterns of induction were observed among the cAMP-activated genes. The three immediate-early genes that encode NR4A subfamily (NGFI-B, NURR1, and NOR-1) all showed rapid but transient expression pattern, reaching the peaks of expression by 1–3 h after forskolin treatment and declining significantly by 6 h (Fig. 1Go, A–C). Furthermore, the protein expression patterns of NGFI-B and NURR1 closely followed the patterns of the mRNA (Fig. 2Go). The transient expression pattern of NR4A in the forskolin-treated KGN cells mirrors the expression of these genes previously observed in LH-treated rat preovulatory follicles (15). In contrast to NR4A, induction of two important steroidogenic genes (StAR and aromatase) occurred in a delayed fashion (Fig. 1Go, D and E). Again, this is in agreement with the previous reports of delayed expression patterns of these genes in response to gonadotropins (7). Distinct from the expression patterns of the first two subgroups of cAMP-activated genes, KLF4 was induced as rapidly as the NR4A genes, but its mRNA level decreased at a slower pace than the levels of the NR4A genes (compare Fig. 1FGo with Fig. 1Go, A–C). The differential induction patterns likely result from gene-specific regulation at both transcriptional and posttranscriptional levels.


Figure 2
View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2. Forskolin (FSK)-induced expression of NURR1 and NGFI-B proteins. An equal amount of whole-cell lysates was analyzed by immunoblotting for the presence of NGFI-B and NURR1 proteins, the positions of which are indicated by bars. The band indicated by an asterisk in the anti-NURR1 blot was not related to NURR1. In addition, {alpha}-tubulin was shown as a loading control.

 
Ectopic NURR1 and NGFB-I represses transcription from the aromatase promoter
The real-time PCR study clearly indicates that the decline of the NR4A mRNA levels coincides with a surge in the aromatase expression at the later time points of forskolin treatment. This is reminiscent of the changes in the mRNA abundance of these genes upon the ovarian LH surge in preovulatory follicles, where the rapid decrease in aromatase mRNA level is accompanied by enhanced expression of the NR4A proteins (10, 11, 15). However, the function of the NR4A family members in folliculogenesis and steroidogenesis is poorly understood. In light of the regulatory role of the NR4A in transcription, we tested a possible causal relationship between NR4A and aromatase expression by cotransfecting into the KGN cells the NURR1 expression vector and a luciferase reporter construct driven by the ovary-specific promoter II (PII) of the aromatase gene. As shown in Fig. 3AGo, NURR1 severely mitigated the cAMP-induced transcriptional activation of the aromatase promoter in a dose-dependent manner. In contrast, the same amounts of NURR1 resulted in strong stimulation of the CYP11B2 promoter (Fig. 3BGo), a known NURR1-activated promoter (20). This suggests a promoter-specific repression of NURR1 on the aromatase promoter.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 3. Ectopic expression of NURR1 in KGN cells inhibits transcription from the ovary-specific PII promoter of the aromatase gene. Luciferase reporter plasmids (aromatase promoter in A and hCYP11B2 promoter in B) were cotransfected into the KGN cells with an increasing amount of the NURR1 expression vector (10, 30, 100, and 250 ng for lanes 3–6). The total amount of expression vector was kept constant in each experiment using the pcDNA3 empty vector. The results are averages of four different sets of data. FSK, Forskolin.

 
We also extended the luciferase-based reporter assay to include NGFI-B, another member of the NR4A subfamily (Fig. 4Go). The NGFI-B expression vector impaired transcription from the aromatase PII promoter to a similar extent as NURR1 (Fig. 4AGo). In contrast, the CYP11B2 promoter and a synthetic NR4A-responsive promoter p(Bla)8luc harboring tandem repeats of the NR4A binding site (21) were robustly stimulated by NGFI-B and NURR1 (Fig. 4Go, B and C). Intriguingly, ectopic expression of NOR-1 did not result in an appreciable level of repression (data not shown), and the molecular basis of this awaits further exploration. Thus, at least two members of the NR4A subfamily may play an important role in down-regulating transcription of key steroidogenic genes in granulosa cells.


Figure 4
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 4. Both NURR1 and NGFI-B repress transcription in a promoter-specific manner. A luciferase reporter plasmid harboring the aromatase promoter (A), a synthetic NR4A-responsive promoter (B), or the hCYP11B2 promoter (C) were cotransfected with various expression vectors. The transfected cells were subsequently treated with forskolin (FSK), and luciferase assay was conducted.

 
Knockdown of endogenous NURR1 leads to increased expression of the endogenous aromatase genes
To investigate the role of endogenous NURR1 in modulating forskolin-induced activation of the native aromatase gene, we transiently transfected KGN cells with an siRNA oligonucleotide that is known to specifically knock down NURR1 expression (Dharmacon) and examined its effect on the endogenous mRNA level of aromatase. As expected, the real-time PCR analysis showed a substantial reduction of the NURR1 mRNA level by the NURR1-specific siRNA (compare lane 2 with lane 3 and lane 5 with lane 6 in Fig. 5AGo). Importantly, the NURR1 knockdown resulted in a significant increase in both the basal and forskolin-stimulated expression of the aromatase gene (compare lane 2 with lane 3 and lane 5 with lane 6 in Fig. 5BGo). Reduction of NGFI-B by siRNA also led to a similar elevation of the endogenous aromatase mRNA (data not shown). Thus, the functional study clearly indicates that the NR4A proteins can act as transcription repressors to modulate aromatase gene activation in granulosa cells.

Further characterization of the NGFI-B- and NURR1-mediated transcriptional repression
To map the cis-element in the aromatase PII promoter that mediates the NR4A repression, a series of 5' deletions of the promoter constructs were generated (Fig. 6AGo) and tested in the luciferase assay for their responsiveness to NURR1 and NGFI-B. As shown in Fig. 6BGo, deletion of most of the distal sequences of the PII promoter (e.g. between –1016 bp and –213 bp) reduced the magnitude of the forskolin-mediated transcription activation (compare lane 1 with lane 10). However, the same deletions did not abrogate the repressive effect of NGFI-B and NURR1 (compare lanes 1–3 with lanes 10–12 in Fig. 6BGo). The –213 bp construct of the aromatase promoter contains the binding sites for steroidogenic factor 1 and a cAMP-responsive element-like sequence, two critical cis-elements for conferring cAMP-responsive transcription of the aromatase PII promoter (26, 27, 28, 29). Thus, our data indicate that the same promoter-proximal region in the aromatase PII promoter also mediates the transcription repression by NGFI-B and NURR1.


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 6. The promoter-proximal sequence of the ovary-specific aromatase PII promoter contains the cis-regulatory element that confers NURR1-mediated repression. A, A diagram indicating the 5' ends of various deletion constructs in the ovary-specific aromatase PII promoter. Also indicated are the positions of the cis-acting elements critical for the promoter activity. CLS, cAMP-responsive element-like sequence. B, The effects of NGFI-B and NURR1 on the transcription activity of various promoter-deletion constructs. The reporter vector alone does not contain any sequence from the aromatase promoter. All samples were treated with forskolin overnight before harvest.

 
Like other nuclear receptors, members of the NR4A subfamily can be divided structurally into an N-terminal activation function (AF) 1 region, a central DNA-binding domain (DBD), and a C-terminal ligand-binding domain (LBD; also known as AF2) (12). Multiple lines of evidence suggest that the N-terminal domain of NR4A proteins is mainly responsible for transactivation, whereas the C-terminal domain may modulate nuclear localization and transcriptional activation (30, 31, 32, 33, 34). In the current study, deletion of the C-terminal LBD moderately enhanced the activation of CYP11B2 by NURR1 (compare lane 2 with lane 5 in Fig. 7CGo). The same construct also efficiently repressed transcription of the aromatase promoter (compare lane 2 with lane 5 in Fig. 7BGo). However, further deletion that removed the DBD impaired both NURR1-mediated activation and repression (lane 4 in Fig. 7Go, B and C). Interestingly, an N-terminal deletion construct that lacks the entire AF1 domain was still capable of at least partial transcriptional activation and repression (lane 3 of Fig. 7Go, B and C). As indicated in Fig. 7DGo, all deletion constructs were expressed at least to the same level as the wild-type protein. Thus, the DBD appears essential for NURR1-mediated transcriptional regulation, whereas either AF1 or LBD might also be required for NURR1 functions in both gene activation and repression.


Figure 7
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 7. Domain-mapping study of the NURR1 protein. A, A diagram indicating the multiple functional domains common to nuclear receptor superfamily. Also indicated are the lengths of various NURR1 deletion constructs. The full-length NGFI-B and NURR1, as well as the NURR1 deletion constructs, were compared for their effects on the promoter activity of the aromatase (B) and hCYP11B2 promoters (C). All samples were treated with forskolin at a final concentration of 25 µM. D, An anti-FLAG immunoblot indicating the expression of all tagged NGFI-B and NURR1 proteins in KGN cells. The positions of molecular mass markers (kDa) are indicated on the left. An anti-{alpha}-tubulin immunoblot is also shown as a loading control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The gonadotropin-responsive, cAMP-mediated signal transduction pathways play a central role in ovarian follicular and luteal development. In the past decade, gene-specific approaches have uncovered a number of important ovarian genes that are intimately controlled by the intracellular cAMP level. We carried out a genome-wide study of the cAMP-responsive gene expression profiles in ovarian granulosa cells. Our microarray analysis revealed 140 genes that were either activated or repressed by the cAMP-dependent signaling cascades. These include genes that are known to be cAMP- and gonadotropin-regulated genes, as well as numerous genes that have not been reported previously to be cAMP-responsive genes. Gene-specific real-time PCR analysis not only verified the microarray finding but also indicated distinct patterns of cAMP-mediated gene activation. In particular, members of the NR4A subfamily of the orphan nuclear receptors were robustly and transiently up-regulated, whereas expression of aromatase responded to the cAMP surge in a delayed fashion. Importantly, our work shows that NR4A proteins are capable of curtailing aromatase expression by inhibiting transcription from the ovary-specific aromatase PII promoter. Thus, the combination of genome-wide and gene-specific approaches shed light on the functional relationship among multiple cAMP-responsive genes in ovarian granulosa cells.

A recent miroarray study of gene expression in rat Sertoli cells has revealed a large number of FSH-responsive genes (35). By comparing the current forskolin-regulated gene sets in human granulosa cells with the published gene profile in rat Sertoli cells, we found several cAMP-repsonsive genes that are common to both microarray data sets. These include NURR1, NOR-1, and CREM. Of particular interest is the finding that NGFI-B was one of the most up-regulated genes from the published microarray study in rat Sertoli cells. Furthermore, the expression of NGFI-B in both human KGN and rat Sertoli cells followed a similar pattern in response to the cAMP surge. Given the analogous functions of ovarian granulosa cells and testicular Sertoli cells in folliculogenesis and spermatogenesis, respectively, these results suggest that the NR4A proteins may play a physiological function in both male and female reproductive development. It is also worth noting that a significant proportion of the activated genes from the two microarray studies does not overlap. Moreover, although most FSH-responsive genes in rat Sertoli cells are induced genes, more than 50% of the forskolin-affected genes in KGN cells are repressed. This could be due to several underlying reasons, including the differences in species, gender, culture system, or the number of genes represented in the arrays.

In addition to providing a comprehensive picture of gene expression profiles, information obtained from the gene array study may also aid in the understanding of the intricate interplay among specific ovarian genes. As an initial step toward elucidating the physiological significance of the cAMP-mediated induction of the NR4A orphan nuclear receptors, we showed that at least two members of this family, NGFI-B and NURR1, strongly inhibited transcription from the ovary-specific promoter (PII) of the aromatase gene. The functional relationship between NR4A proteins and aromatase as revealed in the tissue culture system may bear significant relevance to the maturation of ovarian follicles. A large body of studies in animal models and tissue culture systems has firmly established that hormone-dependent gene activation in ovarian follicles occurs in a sequential and stage-specific manner (1). In particular, granulosa cells of preovulatory follicles respond to the ovarian LH surge by undergoing two major physiological events, ovulation and luteinization. One of the biochemical hallmarks for luteinization is the rapid and dramatic reduction of the mRNA levels of many FSH-stimulated genes including aromatase (1, 10, 11). Intriguingly, NGFI-B and the other members of the NR4A subfamily are strongly stimulated by LH, which appears to activate both the cAMP/protein kinase A pathway as well as the calcium/protein kinase C pathway (15) (1). Consistently, it has been shown that NGFI-B mRNA is present in cultured ovarian granulosa cells and corpora lutea but not in small antral or preovulatory follicles (1). The strong inhibitory effect of NR4A on aromatase expression rationalizes the inverse correlation of the expression of these two genes upon LH surge, thus providing the first evidence for a causal relationship between these two gene regulatory events.

It has been well documented that different FSH-responsive ovarian genes in vivo follow distinct induction patterns in response to tonic secretion of FSH (1, 2, 6). In contrast to the immediate-early genes, such as Sgk and cyclin D2, the aromatase gene displays a more delayed response to FSH, thus resembling the pattern observed in the forskolin-treated KGN cells. However, the physiological relevance of the delayed expression of aromatase in vivo remains to be explored. Furthermore, the molecular basis for such a delay is unclear. In light of the inhibitory effect of NURR1 and NGFI-B on aromatase gene expression, the transient peak of NR4A expression that precedes the aromatase expression in forskolin-treated KGN cells could contribute to the delay in expression of aromatase and possibly other steroidogenic genes. Conceivably, the resulting delay in aromatase expression could serve to ensure a controlled and coordinated steroidogenic event. In this regard, it would be interesting to determine the effect of FSH on the expression of the NR4A genes in a more physiological setting.

The underlying mechanism of NR4A-mediated transcription repression remains to be elucidated. The NR4A orphan nuclear factors are well known for their ligand-independent transcription activation functions upon binding as a monomer to the NGFI-B response element (5'-AAAGGTCA-3') (36, 37). In addition, NGFI-B and NURR1 can also form heterodimers with the 9-cis retinoic acid X receptor and activate gene expression in a vitamin A-responsive manner (38, 39). Although no transcription repression function has been ascribed to the NR4A subfamily members in the literature, two possible mechanisms of NR4A-mediated repression of aromatase gene expression can be envisioned. In the first scenario, NURR1 and NGFI-B could indirectly inhibit aromatase gene expression by activating the expression of a putative transcription repressor, which in turn, may bind to the ovary-specific PII promoter of the aromatase gene. Interestingly, several known transcription repressors, including TCP8 and ID2, are among the forskolin-activated genes, as revealed by the microarray study. In the second model for NR4A-mediated repression, NR4A may be able to directly bind to the aromatase promoter via a noncanonical site, but such a protein-DNA interaction might be too transient or too weak to be detected by the gel shift assay. In this regard, it is interesting to note that NGFI-B and steroidogenic factor 1 (SF-1) binding sites share the same core sequence (5'-AGGTCA-3'), although the two orphan nuclear receptors require distinct nucleotides 5' to the core sequence. Nevertheless, it remains possible that a modified form of NR4A or a protein complex between NR4A proteins and their partners may have altered DNA binding specificity such that it would compete with SF-1 for the same DNA binding site at the aromatase promoter, resulting in inhibition of transcription initiation. We do not favor this possibility because in vitro translated NR4A proteins were not capable of either binding to the SF-1 site or preventing SF-1 from binding to the same site in a gel shift assay (Supplemental Fig. 1, published on The Endocrine Society’s Journals Online web site, http://endo.endojournals.org). It is also possible that NURR1 or NGFI-B may be associated with the aromatase promoter via its interaction with another site-specific DNA binding protein. A well-characterized example is glucocorticoid receptor, which can both activate and repress transcription via either a direct interaction with a glucocorticoid response element or interaction with promoter-bound nuclear factor {kappa}B or AP1 (40). In the event that NURR1/NGFI-B is associated with the aromatase PII promoter, it is conceivable that the AF1 or AF2 domain of the orphan nuclear receptors may recruit transcription corepressors to achieve transcriptional inhibition.

The NR4A orphan nuclear receptors have been extensively characterized with respect to their physiological roles in the nervous, immune, and endocrine systems (12, 41). Given the high degree of sequence conservation and similarity in biochemical properties among the NR4A proteins, it is not surprising that their functions in vivo appear to be partially redundant. Consistent with this notion, NGFI-B knockout mice have no apparent phenotype (42). On the other hand, Nurr-1 knockout mice die shortly after birth and exhibit severe defects in differentiation of the nigral dopaminergic neurons (43), strongly arguing that the biological functions of the different NR4A genes are not totally exchangeable. In the current study, both ectopically expressed NURR1 and NGFI-B were capable of repressing aromatase promoter activity, yet knockdown of the endogenous NURR1 was sufficient to stimulate aromatase expression. Mutations in NURR1 are associated with familial Parkinson disease (44). It would be interesting to see whether the female Nurr1+/– mice display any phenotypes that could be attributed to elevated expression of aromatase in ovaries. In addition, it is tempting to speculate that the NURR1 mutation carriers in human may also be associated with increased risks of endocrine-related diseases such as breast cancer.

Human aromatase gene is expressed in a broad spectrum of tissues including ovary, bone, adipose tissue, brain, and various fetal tissues (45). Tissue-specific expression of aromatase is conferred largely by tissue-specific promoters and alternative splicing (46). Given the distinct sets of trans-acting and cis-acting elements involved in regulation of each tissue-specific aromatase promoter, we surmise that NGFI-B/NURR1 may exert differential effects on these aromatase promoters. In light of the important roles of both NURR1 and estrogen in brain function (12, 47), it would be of interest to determine whether NURR1 in the nervous system could influence the local estrogen biosynthesis by regulating aromatase expression from the brain-specific aromatase promoter.


    Acknowledgments
 
We thank Drs. Yves Labele and Williams E. Rainey for the luciferase constructs, Dr. Asma Amleh for critical reading of the manuscript, and members of the Hu and Rong Li laboratories for stimulating discussion.


    Footnotes
 
This work was supported by Grant DAMD17-03-1-0398 (to Y.H.) from the Department of Defense Breast Cancer Research Program.

First Published Online October 14, 2004

Abbreviations: AF, Activation function; DBD, DNA-binding domain; LBD, ligand-binding domain; NR4A, nuclear receptor subfamily 4A; PII, ovary-specific promoter II; SF-1, steroidogenic factor 1; siRNA, small interfering RNA.

Received July 12, 2004.

Accepted for publication October 7, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[CrossRef][Medline]
  2. Richards JS, Fitzpatrick SL, Clemens JW, Morris JK, Alliston T, Sirois J 1995 Ovarian cell differentiation: a cascade of multiple hormones, cellular signals, and regulated genes. Recent Prog Horm Res 50:223–254
  3. Richards JS, Russell DL, Robker RL, Dajee M, Allison TN 1998 Molecular mechanisms of ovulation and luteinization. Mol Cell Endocrinol 145:47–54[CrossRef][Medline]
  4. Robker RL, Richards JS 1998 Hormonal control of the cell cycle in ovarian cells: proliferation versus differentiation. Biol Reprod 59:476–482[Free Full Text]
  5. Tayor SS 1989 cAMP-dependent protein kinase. J Biol Chem 264:8443–8446[Free Full Text]
  6. Richards JS 2001 New signaling pathways for hormones and cyclic adenosine 3',5'-monophosphate action in endocrine cells. Mol Endocrinol 15:209–218[Abstract/Free Full Text]
  7. Gonzalez-Robayna IJ, Alliston TN, Buse P, Firestone GL, Richards JS 1999 Functional and subcellular changes in the A-kinase-signaling pathway: relation to aromatase and Sgk expression during the transition of granulosa cells to luteal cells. Mol Endocrinol 13:1318–1337[Abstract/Free Full Text]
  8. Delidow BC, Lynch JP, White BA, Peluso JJ 1992 Regulation of proto-oncogene expression and deoxyribonucleic acid synthesis in granulosa cells of perifused immature rat ovaries. Biol Reprod 47:428–435[Abstract]
  9. Woodruff TK, Meunier H, Jones PBC, Hsueh AJ, Mayo KE 1987 Rat inhibin, molecular cloning of {alpha}- and ß-subunit complementary deoxyribonucleic acids and expression in the ovary. Mol Endocrinol 1:561–568[Abstract]
  10. Fitzpatrick SL, Richards JS 1991 Regulation of cytochrome P450 aromatase messenger RNA and activity by steroids and gonadotrophins in rat granulosa cells. Endocrinology 129:1452–1462[Abstract]
  11. Hickey GJ, Chen S, Besman MJ, Shively JE, Hall PF, Gaddy-Kurten D, Richards JS 1988 Hormonal regulation, tissue distribution, and content of aromatase cytochrome P450 mRNA and enzyme in rat ovarian follicles and corpora lutea: relationship to estradiol biosynthesis. Endocrinology 122:1426–1436[Abstract]
  12. Maruyama K, Tsukada T, Ohkura N, Bandoh S, Hosomo T, Yamaguchi K 1998 The NGFI-B subfamily of the nuclear receptor superfamily. Int J Oncol 12:1237–1243[Medline]
  13. Herschman HR 1991 Primary response genes induced by growth factors and tumor promoters. Annu Rev Biochem 60:281–319[CrossRef][Medline]
  14. Stocco CO, Zhong L, Sugimoto Y, Ichikawa A, Lau LF, Gibori G 2000 Prostaglandin F2-{alpha}-induced expression of 20-{alpha}-hydroxysteroid dehydrogenase involves the transcription factor NUR77. J Biol Chem 275:37202–37211[Abstract/Free Full Text]
  15. Park JI, Park HJ, Lee YI, Seo YM, Chun SY 2003 Regulation of NGFI-B expression during the ovulatory process. Mol Cell Endocrinol 202:25–29[Medline]
  16. Nishi Y, Yanase T, Mu YM, Oba K, Ichino I, Saito M, Nomura M, Mukasa C, Okabe T, Goto K, Takayanagi R, Kashimura Y, Haji M, Nawata H 2001 Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulation hormone receptor. Endocrinology 142:437–445[Abstract/Free Full Text]
  17. Mukasa C, Nomura M, Tanaka T, Tanaka K, Nishi Y, Okabe T, Goto K, Yanase T, Nawata H 2003 Activin signaling through type IB activin receptor stimulates aromatase activity in the ovarian granulosa cell-like human granulosa (KGN) cells. Endocrinology 144:1603–1611[Abstract/Free Full Text]
  18. Chu S, Nishi Y, Yanase T, Nawata H, Fuller PJ 2004 Transrepression of estrogen receptor-ß by nuclear factor {kappa}B in ovarian granulosa cells. Mol Endocrinol 18:1919–1928[Abstract/Free Full Text]
  19. Morinaga H, Yanase T, Nomura M, Okabe T, Goto K, Harada N, Nawata H 2004 A benzimidazole fungicide, benomyl, and its metabolite, carbendazim, induce aromatase activity in a human ovarian granulose-like tumor cell line (KGN). Endocrinology 145:1860–1869[Abstract/Free Full Text]
  20. Bassett MH, Suzuki T, Sasano H, White PC, Rainey WE 2004 The orphan nuclear receptors NURR1 and NGFI-B regulate adrenal aldosterone production. Mol Endocrinol 18:279–290[Abstract/Free Full Text]
  21. Laflamme C, Filion C, Bridge JA, Ladanyi M, Goldring MB, Labelle Y 2003 The homeotic protein Six3 is a coactivator of the nuclear receptor NOR-1 and a corepressor of the fusion protein EWS/NOR-1 in human extraskeletal myxoid chondrosarcomas. Cancer Res 63:449–454[Abstract/Free Full Text]
  22. Gallagher PG, Bao Y, Serrano SMT, Kamiguti AS, Theakston RDG, Fox JW 2003 Use of microarrays for investigating the subtoxic effects of snake venoms: insights into venom-induced apoptosis in human umbilical vein endothelial cells. Toxicon 41:429–440[Medline]
  23. Li C, Wong WH 2001 Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc Natl Acad Sci USA 98:31–36[Abstract/Free Full Text]
  24. Tremblay JJ, Viger RS 2001 GATA factors differentially activate multiple gonadal promoters through conserved GATA regulatory elements. Endocrinology 142:977–986[Abstract/Free Full Text]
  25. Sheikh MS, Hollander MC, Fornace AJ 2000 Role of Gadd45 in apoptosis. Biochem Pharmacol 59:43–45[CrossRef][Medline]
  26. Morohashi KI, Honda SI, Inomata Y, Handa H, Omura T 1992 A common trans-acting factor, Ad4-binding protein, to the promoters of steroidogenic P-450s. J Biol Chem 267:17913–17919[Abstract/Free Full Text]
  27. Fitzpatrick SL, Richards JS 1994 Identification of a cyclic adenosine 3'-5'-monophosphate-response element in the rat aromatase promoter that is required for transcriptional activation in rat granulosa cells and R2C Leydig cells. Mol Endocrinol 8:1309–1319[Abstract]
  28. Carlone DL, Richards JS 1997 Functional interactions, phosphorylation, and levels of 3',5'-cyclic adenosine monophosphate-regulatory element binding protein and steroidogenic factor-1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292–304[Abstract/Free Full Text]
  29. Young M, McPhaul MJ 1997 Definition of the elements required for the activity of the rat aromatase promoter in steroidogenic cell lines. J Steroid Biochem Mol Biol 61:341–348[CrossRef][Medline]
  30. Davis IJ, Hazel TG, Chen RH, Blenis J, Lau LF 1993 Functional domains and phosphorylation of the orphan receptor Nur77. Mol Endocrinol 7:953–964[Abstract]
  31. Wansa KDSA, Harris JM, Yan G, Ordentlich P, Muscat GEO 2003 The AF-1 domain of the orphan nuclear receptor NOR-1 mediates trans-activation, coactivator recruitment, and activation by the purine anti-metabolite 6-mercaptopurine. J Biol Chem 278:24776–24790[Abstract/Free Full Text]
  32. Paulsen RE, Weaver CA, Fahrner TJ, Milbrandt J 1992 Domains regulating transcriptional activity of the inducible orphan receptor NGFI-B. J Biol Chem 267:16491–16496[Abstract/Free Full Text]
  33. Kuang AA, Cado D, Winoto A 1999 Nur77 transcription activity correlates with its apoptotic function in vivo. Eur J Immunol 29:3722–3728[CrossRef][Medline]
  34. Castro DS, Arvidsson M, Bolin MB, Perlmann T 1999 Activity of the Nurr1 carboxyl-terminal domain depends on cell type and integrity of the activation function 2. J Biol Chem 274:37483–37490[Abstract/Free Full Text]
  35. McLean DJ, Friel PJ, Pouchnik D, Griswold MD 2002 Oligonucleotide microarray analysis of gene expression in follicle-stimulating hormone-treated rat Sertoli cells. Mol Endocrinol 16:2780–2792[Abstract/Free Full Text]
  36. Wilson TE, Fahrner TJ, Johnston M, Milbrandt J 1991 Identification of the DNA binding site for NGFI-B by genetic selection in yeast. Science 1991:1296–1300
  37. Wilson TE, Fahrner TJ, Milbrandt J 1993 The orphan receptors NGFI-B and steroidogenic factor 1 establish monomer binding as a third paradigm of nuclear receptor-DNA interaction. Mol Cell Biol 13:5794–5804[Abstract/Free Full Text]
  38. Forman BM, Umesono K, Chen J, Evans RM 1995 Unique response pathways are established by allosteric interactions among nuclear hormone receptors. Cell 81:541–550[CrossRef][Medline]
  39. Perlmann T, Jansson L 1995 A novel pathway for vitamin A signaling mediated by RXR heterodimerization with NGFI-B and NURR1. Genes Dev 9:769–782[Abstract/Free Full Text]
  40. Bosscher KD, Berghe WV, Haegeman G 2003 The interplay between the glucocorticoid receptor and nuclear factor {kappa}B or activator protein-1: molecular mechanisms for gene repression. Endocr Rev 24:488–522[Abstract/Free Full Text]
  41. Winoto A, Littman DR 2002 Nuclear hormone receptors in T lymphocytes. Cell 109:S57–S66
  42. Lee SL, Wesselschmidt RL, Linette GP, Kanagawa O, Russell JH, Milbrandt J 1995 Unimpaired thymic and peripheral T cell death in mice lacking the nuclear receptor NGFI-B (Nur77). Science 269:532–535[Abstract/Free Full Text]
  43. Zetterstrom RH, Solomin L, Jansson L, Hoffer BJ, Olson L, Perlmann T 1997 Dopamine neuron agenesis in Nurr1-deficient mice. Science 276:248–250[Abstract/Free Full Text]
  44. Le WD, Xu P, Jankovic J, Jiang H, Appel SH, Smith RG, Vassilatis DK 2003 Mutations in NR4A2 associated with familial Parkinson disease. Nat Genet 33:85–89[CrossRef][Medline]
  45. Simpson ER, Davis SR 2001 Minireview: aromatase and the regulation of estrogen biosynthesis—some new perspectives. Endocrinology 142:4589–4594[Abstract/Free Full Text]
  46. Bulun SE, Sebastian S, Takayama K, Suzuki T, Sasano H, Shozu M 2003 The human CYP19 (aromatase P450) gene: update on physiologic roles and genomic organization of promoters. J Steroid Biochem Mol Biol 86:219–224[CrossRef][Medline]
  47. Smith RG 2000 The aging process: where are the drug opportunities? Curr Opin Chem Biol 4:371–376[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. S. Mix, M. G. Attur, H. Al-Mussawir, S. B. Abramson, C. E. Brinckerhoff, and E. P. Murphy
Transcriptional Repression of Matrix Metalloproteinase Gene Expression by the Orphan Nuclear Receptor NURR1 in Cartilage
J. Biol. Chem., March 30, 2007; 282(13): 9492 - 9504.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. Lu, A. Amleh, J. Sun, X. Jin, S. D. McCullough, R. Baer, D. Ren, R. Li, and Y. Hu
Ubiquitination and Proteasome-Mediated Degradation of BRCA1 and BARD1 during Steroidogenesis in Human Ovarian Granulosa Cells
Mol. Endocrinol., March 1, 2007; 21(3): 651 - 663.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. Miyoshi, F. Otsuka, J. Suzuki, M. Takeda, K. Inagaki, Y. Kano, H. Otani, Y. Mimura, T. Ogura, and H. Makino
Mutual Regulation of Follicle-Stimulating Hormone Signaling and Bone Morphogenetic Protein System in Human Granulosa Cells
Biol Reprod, June 1, 2006; 74(6): 1073 - 1082.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. R. Holla, J. R. Mann, Q. Shi, and R. N. DuBois
Prostaglandin E2 Regulates the Nuclear Receptor NR4A2 in Colorectal Cancer
J. Biol. Chem., February 3, 2006; 281(5): 2676 - 2682.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
J. J. TREMBLAY and N. M. ROBERT
Role of Nuclear Receptors in INSL3 Gene Transcription in Leydig Cells
Ann. N.Y. Acad. Sci., December 1, 2005; 1061(1): 183 - 189.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. F. Couse, M. M. Yates, B. J. Deroo, and K. S. Korach
Estrogen Receptor-{beta} Is Critical to Granulosa Cell Differentiation and the Ovulatory Response to Gonadotropins
Endocrinology, August 1, 2005; 146(8): 3247 - 3262.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
146/1/237    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, Y.
Right arrow Articles by Hu, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, Y.
Right arrow Articles by Hu, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews