| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Veterinary Preclinical Studies, University of Glasgow Veterinary School, University of Glasgow, Glasgow G61 1QH, United Kingdom
Address all correspondence and requests for reprints to: P. J. O’Shaughnessy, Institute of Comparative Medicine, University of Glasgow Veterinary School, Bearsden Road, Glasgow G61 1QH, United Kingdom. E-mail: p.j.o'shaughnessy{at}vet.gla.ac.uk.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
After the LH surge and ovulation, the corpus luteum rapidly develops to become a highly active steroidogenic tissue and it plays an essential role in the establishment and maintenance of pregnancy. Several functional differences between presurge granulosa cells and luteal cells have been identified but the underlying, early molecular events that occur during terminal granulosa cell differentiation remain unclear. Earlier studies using microarray, differential display and subtractive hybridization techniques have identified a number of genes that show changes in expression during early luteinization (6, 7). This work has provided valuable insight into the luteinization process, but it is likely that genes identified in these studies represent a small fraction of those undergoing change. As a step toward understanding the process of luteinization, and to identify genes undergoing regulation during the early phase of terminal differentiation, we have used the technique of serial analysis of gene expression (SAGE) (8) to provide a comprehensive profile of gene expression in granulosa cells before and after a luteinizing dose of human chorionic gonadotropin (hCG).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To generate a preovulatory granulosa cell SAGE library, immature mice (aged 18–22 d) were injected ip with a single dose of 5 IU pregnant mare serum gonadotropin (PMSG) and granulosa cells were collected 48 h later. To generate a SAGE library of granulosa cells undergoing luteinization, immature mice were treated with PMSG followed 48 h later by hCG, and granulosa cells were isolated after a further 12 h. To isolate the cells, ovaries were placed in DMEM (Invitrogen Ltd., Paisley, Scotland, UK) and granulosa cells were released from large antral follicles using needles. No attempt was made to remove oocytes from the isolated granulosa cells. Cells were stored in liquid N2 until RNA extraction.
Construction and analysis of SAGE libraries
The RNA from PMSG and PMSG/hCG-treated granulosa cells was extracted using TRIzol reagent (Invitrogen Ltd.). The SAGE libraries were constructed from RNA pooled from granulosa cells of 30 different mice. Poly-A+ RNA was isolated using oligo deoxythymidine cellulose (Invitrogen Ltd.) and SAGE libraries were constructed and analyzed as previously described (9). Fourteen nucleotide SAGE tags, representing individual transcripts, were extracted from the sequence data and initially analyzed using SAGE 2000 software (http://www.sagenet.org/sage_protocol.htm). Differences in tag frequency between SAGE libraries were statistically analyzed using the 
2 test (10). Tags were identified through mouse SAGEmap database build 136. The original SAGE data from each library described here have been deposited in the National Center for Biotechnology Information (NCBI) public gene expression database (http://www.ncbi.nlm.nih.gov/geo/) accession nos. GSM30721 and GSM30722.
Rapid amplification of cDNA ends (RACE)
For those tags which could not be identified by comparison to the NCBI database, it was necessary to generate additional 3' sequence to identify the source mRNA species. This was done using a 3' RACE technique similar to that described previously (11) but using biotinylated primer TTCTAGAATTCAGCGGCCGC(T)30(AGC)(AGCT) to prime reverse transcription.
Real-time PCR
Levels of specific mRNA species were measured by real-time PCR using the Taqman method as described previously (12). The tissue used to generate RNA for real-time PCR was prepared using the same protocols as above for generation of SAGE libraries (see Construction and analysis of SAGE libraries). The sequences of primers and probes used for real-time PCR were as shown in Table 1
and in previous studies (12, 13).
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
SAGE libraries
The total number of tags sequenced in the PMSG library (treatment with PMSG alone) was 51,528, and the total number sequenced in the PMSG/hCG library (treatment with PMSG followed by hCG) was 53,696. The combined total of 105,224 tags corresponded to 40,248 unique transcripts, of which 9,877 were represented by two or more tags. Of the transcripts represented by more than one tag, 5,689 were shared between both libraries, 1,806 were unique to the PMSG library, and 2,382 were unique to the PMSG/hCG library. Using 2 analysis to test for significant differences in tag abundance between those tags with greater than five transcripts present in the combined libraries, 499 tags were significantly up-regulated by hCG treatment (P < 0.05), and 216 tags were significantly down-regulated (P < 0.05).
Abundant, differentially expressed SAGE tags
The most abundant tags that were shown to be differentially expressed between SAGE libraries by 2 test are shown in Table 2. Most of these tags match unambiguously to known genes and a number of them are known to be expressed in granulosa cells during FSH-dependent development [e.g. inhibin ßB and follistatin (14, 15)] or to show a change in expression after luteinization [e.g. P450 11a1, 17ß-hydroxysteroid dehydrogenase type 1 and scavenger receptor class B type 1 (SRB1) (16, 17, 18)]. This list also contains 36 tags, including six of the eight most abundant tags, which have no match, are linked to sequence of unknown function or have multiple assignments. A number of these tags, without confirmed or reliable matches in the SAGEmap database, were analyzed further using 3'RACE (indicated by an asterisk in Table 2). The transcript associated with the tag CAGTCAATAC is of interest because it shows abundant, differentially regulated expression. The 3'RACE data from this tag matched it to Unigene cluster Mm.290944, which shows 95% homology with a noncoding human mRNA sequence. This tag, in addition, is not highly expressed in other mouse SAGE libraries and appears to show a degree of selectivity for the granulosa cell. The expression pattern for this sequence has been confirmed using real-time PCR (Fig. 1, noncoding RNA). Other tags extended by 3'RACE could be linked to Unigene clusters or to individual expressed sequence tags (ESTs). These ESTs may be linked to Unigene clusters (e.g. TTGTTGCTAC matches EST BY419395, which is located on the genome close to Mm.190648) or may represent unique transcribed regions.
|
|
|
shows the frequency of expression of a number of tags in the PMSG and PMSG/hCG libraries, which represent genes linked with established functional groups. The list is not exhaustive and does not, in general, include genes with low levels of expression. This table is designed to show changes (or lack of them) in the expression of selected genes during granulosa cell luteinization. In each of the categories, there are genes listed that have been shown previously to be regulated during luteinization or which are know to be expressed in the corpus luteum [e.g. gap junction protein Cx43 (
1), steroidogenic acute regulatory protein (StAR), adrenodoxin, tissue inhibitor of metalloproteinase 1 (TIMP 1), and cathepsin L (6, 19, 20, 21, 22, 23)]. In addition, there are a number of genes listed which have not previously been shown to be regulated during luteinization such as cofilin, seizure-related 6 homolog (mouse)-like 2 (Sez6l2), and the listed transcription factors.
|
|
(Fig), and ataxia-telangiectasia mutated (ATM) present in either library, whereas zona pellucida (ZP)-2 and ZP-3 were represented by a single tag each in one library. The signaling molecules bone morphogenic protein 15 (BMP15) and growth differentiation factor 9 (GDF9) were represented by a maximum of four and 11 tags, respectively.
Real-time PCR
Real-time PCR was used to determine whether differences in gene expression between granulosa cell SAGE libraries could be confirmed for a number of transcripts. To normalize the data from real-time PCR, the housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used because it is expressed equally in both SAGE libraries (Table 3
). Results in Fig. 1 show that, for these selected transcripts, there is good correlation between data obtained by real-time PCR and data derived from SAGE libraries.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A number of previous studies have examined changes in gene expression in granulosa cells during luteinization (6, 18, 19, 21, 22, 27, 28). In general, these studies examined changes in a single or limited number of genes over the time course of luteinization and have served to provide a valuable insight into the development of the corpus luteum. Genes that have been shown to alter expression during luteinization include, for example, the steroidogenic enzymes and associated proteins [e.g. P45011a1, adrenodoxin, P45019a1, StAR, and SRB1 (6, 18, 21, 22)], extracellular matrix modifiers [e.g. A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif 1 (ADAMTS-1), cathepsin L (6, 19)], signaling molecules [e.g. epiregulin, secreted frizzled-related protein-4 and wnt 4 (27, 28)] and others [e.g. regulator of G protein signaling protein-2 and cell surface antigen CD63 (6)]. In general, results from these previous studies correlate well with the SAGE data reported here. When taken alongside results using real-time PCR (Fig. 1), this is a further indication that the SAGE results are a reliable measure of changes in gene expression at the selected stage of luteinization. Previous SAGE studies have also shown that the technique is highly reproducible and accurate (29).
The SAGE libraries reported in this study were generated predominantly from granulosa cell mRNA, but oocytes were present in the isolated cell mix and would have contributed to the total mRNA pool used in library construction. The expression of tags representing the oocyte-specific genes (24, 25, 26) Nobox, Fig, ATM, ZP-3, and ZP-2 was very low or undetectable, and only BMP15 and GDF9 were represented by more than a single tag. Both ZP-3 and ATM are known to be highly expressed within the oocyte (24), and it is unlikely, therefore, that oocyte-derived genes will contribute significantly to the overall tag number. Care in interpretation may be required for low abundance tags, however, because these could have an oocyte origin.
Genes known to be associated with luteinization
The most fundamental change in granulosa/luteal cell function after induction of luteinization is a marked increase in steroidogenic activity by the developing corpus luteum. It has been shown previously that this is associated with increased expression of P45011a1, SRB1, StAR, ferredoxin, and low-density lipoprotein receptor and decreased expression of P45019a1 (aromatase) and 17ß-hydroxysteroid dehydrogenase type 1 (18, 21, 22). The overall effect is a reduction in estrogen production and a marked increase in progesterone production through increased availability of substrate and converting enzymes. As described above in second paragraph of Discussion, each of these previously reported changes in gene expression correlates well with changes in the tag numbers associated with the SAGE libraries generated for this study. One possible anomaly, however, between the SAGE data and previous studies is the expression of 3ß-hydroxysteroid dehydrogenase (3ßHSD) during luteinization. It has previously been shown that 3ßHSD activity and expression increase in the developing corpus luteum in line with the general increase in steroidogenic activity (30, 31). Data from the SAGE libraries, in contrast, indicate that 3ßHSD type 1 expression is reduced in granulosa cells 12 h after hCG treatment. This change was confirmed by real-time PCR and it appears likely, therefore, that luteinization leads to a temporary decrease in 3ßHSD expression, perhaps through down-regulation induced by exposure to high gonadotropin levels, which reverses as the corpus luteum develops.
Data from the SAGE libraries show that the expression levels of several cytoskeletal-associated transcripts including actin, vinculin, cofilin, tubulin, and tropomyosin, are differentially regulated during luteinization. There is also significant differential expression of actin and tubulin isoforms. It is known that gonadotropins will regulate cytoskeletal gene expression in granulosa cells (32, 33) and cytoskeletal remodeling during luteinization is likely to be an essential part of the movement and morphological development of the cells.
Several membrane-binding and communication-related components such as clusterin, annexin A2, and the gap junction membrane channel proteins (connexins) are known to show fluctuations in expression levels during granulosa cell development and luteinization. The overwhelming level of Cx 43 expression in the PMSG SAGE library supports current thinking that this is the primary means of intercellular communication between granulosa cells and reinforces the hypothesis of a functional granulosa cell syncytium throughout folliculogenesis (34). Expression of Cx43 decreases markedly after induction of luteinization, as shown previously (23), although it may continue to be expressed in the developing corpus luteum (35).
Secreted acidic cysteine-rich glycoprotein (SPARC, osteonectin, basement membrane protein 40) is a highly expressed transcript which undergoes a 7-fold up-regulation during luteinization. SPARC is expressed in vivo where cells are undergoing proliferative or reorganizational activity (36), and it has previously been identified in follicular granulosa cells after the LH surge (37). It is possible that SPARC may play an essential role in the development of the corpus luteum because specific peptide fragments of the protein are strongly angiogenic (38). In the follicle, SPARC is found in both granulosa cells and oocytes, although expression in the oocyte may derive from adjacent granulosa cells (37). Calmodulin, a protein with strong structural and functional similarities to SPARC, has been implicated in the resumption of meiosis in the starfish oocyte (39), and it is possible that up-regulation of SPARC after hCG may play a role in allowing resumption of meiosis in the oocyte.
Genes with a poorly defined role in luteinization
In addition to confirming changes in gene expression previously reported or predicted, the SAGE data set reported here also identifies a number of genes of interest that have not previously been linked to the process of early luteinization. This list is made up of genes with unknown function and genes with known function but no previous association with granulosa luteinization. Genes with known function and differentially regulated during luteinization include syndecan-1, secreted phosphoprotein 1 (Spp1), prosaposin, and vanin 1.
Syndecan-1 is a heparin sulfate-rich integral membrane proteoglycan, and it is expressed in a developmental and cell type-specific pattern (40), but it has not previously been identified as having a role in folliculogenesis or luteinization. Syndecans have major roles as matrix and cell surface receptors, coreceptors for growth factor signaling, internalization receptors, and soluble paracrine effectors (40). In addition, syndecan-1 appears to be capable of independent signaling and may play a role in regulation of Wnt signaling (40). Syndecan-1 is not expressed in the PMSG-stimulated library but shows a high level of transcript expression after hCG administration. Syndecans have a well-established involvement in the regulation of cytoskeletal organization (40) and a likely function of syndecan-1 in the luteinizing follicle is in the regulation of cytoskeletal assembly.
Spp1 (also known as osteopontin or Eta-1) is among the most highly up-regulated tags after hCG administration. It is a multifunctional protein expressed in various cell types and involved in a number of physiological and pathological process including biomineralization, inflammation, leukocyte recruitment, cell survival, tissue repair, cell proliferation, and proliferation of vascular smooth muscle cells (41). It is possible, therefore, that Spp1 has multiple functions during luteinization. For example, it may act as a survival factor preventing onset of apoptosis during the critical phase of ovulation and luteinization. Equally, the effects on vascular smooth muscle suggest a possible role in the angiogenic process that accompanies formation of the corpus luteum.
Prosaposin is expressed at a medium level in the antral follicle but shows a 6-fold up-regulation after hCG administration. The protein is either secreted or acts as a precursor of smaller saposins, and it has been shown to have diverse functions including involvement in the MAPK and Akt signaling pathways and maintenance of cell growth, differentiation, and survival (42). The likely role of prosaposin in development of the corpus luteum is uncertain but may, again, relate to overall function as a survival factor.
Vanin 1 is a glycosylphosphatidylinositol-anchored cell surface molecule involved in thymic and gonadal development (43, 44). As with Spp1, it is also highly up-regulated in granulosa cells after hCG administration. Vanin 1 is expressed specifically in the Sertoli cells of the developing fetal gonad, and it has been suggested that it may be involved in the migration of mesenchynmal cells from the mesonephros into the developing gonad (43). The likely function of vanin 1 in the developing corpus luteum is unclear but, by analogy with developing thymic and gonadal tissue, it is possible that it may be involved in the cell migration that occurs early in corpus luteum formation to integrate both thecal and endothelial cells into the developing tissue.
For those genes already discussed in this section, it is possible to hypothesize a possible function in ovulation and corpus luteum development based on known properties and functions of the genes in other tissues. The SAGE libraries described here also contain many other highly expressed or differentially expressed transcripts for which this not currently possible. Included among this latter group are (Sez6l2), proline-rich protein MP-5, and epithelial V-like antigen. In addition, the list of tags differentially regulated after hCG contains a considerable number that are unmatched in the SAGEmap database or are matched only to EST clusters or uncharacterized transcripts. The challenge now will be to identify those genes from this list that are fundamentally involved in the process of luteinization and those genes that have a more downstream role in the development of the corpus luteum.
|
Footnotes |
|---|
First Published Online September 30, 2004
Abbreviations: ATM, Ataxia-telangiectasia mutated; EST, expressed sequence tag; 3ßHSD, 3ß-hydroxysteroid dehydrogenase type 1; PMSG, pregnant mare serum gonadotropin; RACE, rapid amplification of cDNA ends; SAGE, serial analysis of gene expression; SPARC, secreted acidic cysteine-rich glycoprotein; Spp1, secreted phosphoprotein 1; SRB1, scavenger receptor class B type 1; StAR, steroidogenic acute regulatory protein; ZP, zona pellucida.
Received July 30, 2004.
Accepted for publication September 24, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, adrenodoxin, and reduced nicotinamide adenine dinucleotide phosphate- cytochrome P-450 reductase in bovine follicles and corpora lutea. Changes in specific contents during the ovarian cycle. Endocrinology 118:1366–1374, a germ cell-specific transcription factor required for ovarian follicle formation. Development 127:4645–4654[Abstract]
5,4 isomerase in ovine corpora lutea during the estrous cycle. Biol Reprod 51:380–384[Abstract]
-hydroxylase during follicular and luteal development in pigs, sheep, and cows. Biol Reprod 52:1081–1094[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  Y. Ren, R. G. Cowan, R. M. Harman, and S. M. Quirk Dominant Activation of the Hedgehog Signaling Pathway in the Ovary Alters Theca Development and Prevents Ovulation Mol. Endocrinol., May 1, 2009; 23(5): 711 - 723. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Z Carletti and L. K Christenson Rapid effects of LH on gene expression in the mural granulosa cells of mouse periovulatory follicles Reproduction, May 1, 2009; 137(5): 843 - 855. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hamel, I. Dufort, C. Robert, C. Gravel, M.-C. Leveille, A. Leader, and M.-A. Sirard Identification of differentially expressed markers in human follicular cells associated with competent oocytes Hum. Reprod., May 1, 2008; 23(5): 1118 - 1127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M Mihm, P J Baker, L M Fleming, A M Monteiro, and P J O'Shaughnessy Differentiation of the bovine dominant follicle from the cohort upregulates mRNA expression for new tissue development genes Reproduction, February 1, 2008; 135(2): 253 - 265. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-Q. Su, M. Nyegaard, M. T. Overgaard, J. Qiao, and L. C. Giudice Participation of Mitogen-Activated Protein Kinase in Luteinizing Hormone-Induced Differential Regulation of Steroidogenesis and Steroidogenic Gene Expression in Mural and Cumulus Granulosa Cells of Mouse Preovulatory Follicles Biol Reprod, December 1, 2006; 75(6): 859 - 867. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. F. Rodriguez, L. A. Blomberg, K. A. Zuelke, J. R. Miles, J. E. Alexander, and C. E. Farin Identification of candidate mRNAs associated with gonadotropin-induced maturation of murine cumulus oocyte complexes using serial analysis of gene expression Physiol Genomics, November 21, 2006; 27(3): 318 - 327. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Agca, J. E Ries, S. J Kolath, J.-H. Kim, L. J Forrester, E. Antoniou, K. M Whitworth, N. Mathialagan, G. K Springer, R. S Prather, et al. Luteinization of porcine preovulatory follicles leads to systematic changes in follicular gene expression Reproduction, July 1, 2006; 132(1): 133 - 145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Peluso Multiplicity of Progesterone's Actions and Receptors in the Mammalian Ovary Biol Reprod, July 1, 2006; 75(1): 2 - 8. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Hernandez-Gonzalez, I. Gonzalez-Robayna, M. Shimada, C. M. Wayne, S. A. Ochsner, L. White, and J. S. Richards Gene Expression Profiles of Cumulus Cell Oocyte Complexes during Ovulation Reveal Cumulus Cells Express Neuronal and Immune-Related Genes: Does this Expand Their Role in the Ovulation Process? Mol. Endocrinol., June 1, 2006; 20(6): 1300 - 1321. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Peluso, A. Pappalardo, R. Losel, and M. Wehling Progesterone Membrane Receptor Component 1 Expression in the Immature Rat Ovary and Its Role in Mediating Progesterone's Antiapoptotic Action Endocrinology, June 1, 2006; 147(6): 3133 - 3140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X.-H. Ma, S.-J. Hu, H. Ni, Y.-C. Zhao, Z. Tian, J.-L. Liu, G. Ren, X.-H. Liang, H. Yu, P. Wan, et al. Serial Analysis of Gene Expression in Mouse Uterus at the Implantation Site J. Biol. Chem., April 7, 2006; 281(14): 9351 - 9360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. A. Tullet, V. Pocock, J. H. Steel, R. White, S. Milligan, and M. G. Parker Multiple Signaling Defects in the Absence of RIP140 Impair Both Cumulus Expansion and Follicle Rupture Endocrinology, September 1, 2005; 146(9): 4127 - 4137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Couse, M. M. Yates, B. J. Deroo, and K. S. Korach Estrogen Receptor-{beta} Is Critical to Granulosa Cell Differentiation and the Ovulatory Response to Gonadotropins Endocrinology, August 1, 2005; 146(8): 3247 - 3262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Peluso, A. Pappalardo, R. Losel, and M. Wehling Expression and Function of PAIRBP1 Within Gonadotropin-Primed Immature Rat Ovaries: PAIRBP1 Regulation of Granulosa and Luteal Cell Viability Biol Reprod, August 1, 2005; 73(2): 261 - 270. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
