help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2004-0595
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gavi, S.
Right arrow Articles by Malbon, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gavi, S.
Right arrow Articles by Malbon, C. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Endocrinology Vol. 146, No. 1 450-457
Copyright © 2005 by The Endocrine Society

The 15-Amino Acid Motif of the C Terminus of the ß2-Adrenergic Receptor Is Sufficient to Confer Insulin-Stimulated Counterregulation to the ß1-Adrenergic Receptor

Shai Gavi, Dezhong Yin, Elena Shumay, Hsien-yu Wang and Craig C. Malbon

Department of Molecular Pharmacology (S.G., D.Y., E.S., C.C.M.), University Medical Center, State University of New York/Stony Brook, Stony Brook, New York 11794-8651; and Department of Physiology and Biophysics (H.-y.W.), Diabetes and Metabolic Diseases Research Program, University Medical Center, State University of New York/Stony Brook, Stony Brook, New York 11794-8661

Address all correspondence and requests for reprints to: Craig C. Malbon, Department of Pharmacology, Health Sciences Center, State University of New York/Stony Brook, Stony Brook, New York 11794-8651. E-mail craig{at}pharm.sunysb.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Insulin counterregulates catecholamine action in part by inducing the sequestration of ß2-adrenergic receptors. Although similar to agonist-induced sequestration, insulin-induced internalization of ß2-adrenergic receptors operates through a distinct and better-understood cellular pathway. The effects of insulin treatment on the function and trafficking of both ß1- and ß2-adrenergic receptors were tested. The ß2-adrenergic receptors were counterregulated and internalized in response to insulin. The ß1-adrenergic receptors, in sharp contrast, are shown to be resistant to the ability of insulin to counterregulate function and induce receptor internalization. Using chimeric receptors composed of ß1-/ß2-adrenergic receptors in tandem with mutagenesis, we explored the role of the C-terminal cytoplasmic tail of the ß2-adrenergic receptors for insulin-induced counterregulation. Substitution of the C-terminal cytoplasmic tail of the ß2-adrenergic receptor on the ß1-adrenergic receptor enabled the chimeric G protein-coupled receptor to be functionally and spatially regulated by insulin. Truncation of the ß2-adrenergic receptor C-terminal cytoplasmic tail to a 15-amino acid motif harboring a potential Src homology 2-binding domain at Y350 and an Akt phosphorylation site at S345,346 was sufficient to enable receptor regulation by insulin.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
G PROTEIN-COUPLED RECEPTORS (GPCRs) and growth factor receptors with intrinsic tyrosine kinase activity represent two dominant pathways controlling cellular signaling (1, 2, 3, 4). Integration of signaling between GPCR and tyrosine kinase pathways has been investigated and includes the existence of cross-regulation at the most proximal point, receptor-to-receptor interaction with GPCRs acting as substrates for tyrosine kinases (5, 6, 7). Insulin cross-talk with ß2-adrenergic receptor 2AR) serves an important counterregulation of glucose homeostasis. Treating cells with insulin stimulates the phosphorylation of the ß2AR on tyrosyl residues Y350/354 and Y364 for in vivo studies (5, 6) as well as in vitro (7) studies using recombinant, purified ß2AR and insulin receptors. The Y350 residue, a prominent residue for insulin receptor-catalyzed phosphorylation of the cytoplasmic tail of the ß2AR, is embedded in a sequence motif (Tyr-Gly-Asn-Gly) that is similar to the motifs known to interact with Caenorhabditis elegans sem5 Src homology 2 (SH2) domains when phosphorylated (8). Phosphorylation of the ß2AR by the insulin receptor and the IGF-I receptor includes a motif for tyrosine kinases at Y364 (9), the SH2/Grb2 binding site at Y350 (6, 10), and a potential SHC binding site at Y132 (6, 7, 9). For insulin action, activation of 1-phosphatidylinositol 3-kinase (PI3-kinase) is an early event, following temporally the phosphorylation of the insulin receptor and insulin receptor substrate-1 (11, 12). In response to insulin stimulation, the p85 regulatory subunit of PI3-kinase binds the insulin receptor substrate-1 via SH2 domain(s), activating the catalytic p110 subunit that in turn phosphorylates various phosphoinositides at the 3'-position of the inositol ring (13). Ample reports support the premise that PI 3-kinase and its 3'-phosphoinositide products are critical to intracellular trafficking both of membrane-bound elements in general (14) and downstream elements of tyrosine kinase-mediated cell signaling, particularly that of insulin (15).

We have shown that insulin, much like ß-adrenergic agonists, provokes rapid sequestration of ß2AR (16, 17). In addition, downstream activation of Erk1/2 by insulin in mammalian cells was shown to be amplified by ß2AR expression, i.e. the higher the level of cellular complement of ß2AR, the greater was the amplification of insulin activation of Erk1/2, identifying the ability of the ß2AR to act as a scaffold for some aspect of insulin action. The ability of the ß2AR to amplify the insulin response was dependent on the integrity of the Y350 residue, which is phosphorylated by the insulin receptor and constitutes a binding site for an SH2 domain to which Grb2, and other proteins can bind (18). The later identification of an Akt phosphorylation sites in the C-terminal tail of the ß2AR (19) and the central role of Akt in insulin action (20, 21, 22, 23) brought into focus the question of what domain(s) in the ß2AR confer to this GPCR its ability to be regulated by insulin. In the current work, we demonstrate that unlike the ß2AR, the ß1-adrenergic receptor (ß1AR) does not internalize in response to insulin. We make use of this marked difference in receptor trafficking to define the motifs in the ß2AR through which insulin catalyzes sequestration, demonstrating that the donation of the Y350 and Akt phosphorylation sites to the ß1AR enable insulin to internalize the chimeric ß1AR.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids
The human ß1AR gene including the FLAG epitope on the 5' end was generated by PCR using plasmid pUC18-hß1AR (kindly provided by Dr. Stephen Liggett, Department of Medicine, University of Cincinnati, Cincinnati, OH) as the template and a pair of primers designed with HindIII or BamHI linkers. The PCR product was digested with HindIII and BamHI and cloned into the unique HindIII/BamHI sites of peGFP-N1 expression vector (Clontech, Palo Alto, CA) so that the human ß1AR gene was fused to the amino terminus of the GFP. The plasmid encoding the enhanced-green fluorescent protein (GFP)-tagged human ß2AR (in pCDNA3), and including the FLAG epitope at the amino terminus, was a generous gift from Dr. Jeffrey Benovic (Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA). A ß1AR/ß2AR 12CTAR) chimera containing the N-terminal FLAG epitope and the C terminus eGFP epitope was made by replacement of the C terminus of the ß1AR with the C terminus of the ß2AR (ß1AR from Met1-Ser380 and ß2AR from Pro329-Leu413) by using overlap extension PCR as previously described (24) and cloned into the unique HindIII/BamHI sites of peGFP-N1 expression vector. Another ß12 AR chimera (ß12CT342–356) containing the N-terminal FLAG epitope and the C-terminal eGFP was generated by replacement of 15 amino acids in the C terminus of the ß1AR (from Cys393 to Thr407) with 15 amino acids of the ß2AR (from Lys342-Ser356) using overlap extension PCR and cloned into the HindIII/BamHI sites of peGFP-N1 expression vector. The sequence of constructs was confirmed by DNA sequencing.

Cell culture
Chinese hamster ovary (CHO)-K1 cells and human carcinoma HeLa cells were maintained in DMEM supplemented with 5% fetal bovine serum, plus penicillin (60 µg/ml) and streptomycin (100 µg/ml), grown in humidified atmosphere chamber supplied with 5% CO2 and 95% air at 37 C.

Assay of intracellular accumulation of cAMP
CHO-K1 cells transiently transfected with the human ß2AR, ß1AR, ß12CTAR, and ß12CT342–356AR were seeded in a 96-well plate for 24 h. On the day of experiment, cell culture medium was aspirated, the cells washed and replenished with Krebs-Ringer phosphate (KRP) buffer containing 10 µM RO-201724 (a cAMP phosphodiesterase inhibitor), and then treated with the indicated hormones in a total assay volume of 50 µl. The reaction was terminated by the addition of 50 µl of 100% ethanol, and the AMP content was measured by the competitive binding assay as described (25). To assay insulin counterregulation, cells were treated for 30 min with insulin (100 nM) dissolved in a KRP buffer and challenged with the ß-adrenergic agonist isoproterenol (10 µM) for 15 min to enable the accumulation of intracellular cAMP. Each experiment was performed with triplicate determinations.

ß-Adrenergic antagonist binding and receptor sequestration assays
The expression of ß2AR, ß1AR, and the chimera was quantified by assay of the binding of the high-affinity, ß-adrenergic antagonist iodocyanolpindolol [125I]CYP to whole-cell preparations of the transiently transfected cells, as detailed elsewhere (24). Nonspecific binding was determined using ß-adrenergic antagonist propranolol (10 µM). The expression and sequestration of receptors on plasma membrane in CHO-K1 cells transiently transfected with the human ß2AR, ß1AR, and chimera were quantified using the hydrophilic, cell-impermeable radiolabeled ß-adrenergic antagonist [3H]CGP-12177 (26). Cells were treated for 30 min with insulin (100 nM) or isoproterenol (10 µM) for at 37 C and then placed at 4 C for 6 h with 70 nM [3H] CGP-12177. The cells were rapidly washed free of unbound ligand and collected on GF/C membranes by vacuum filtration. The radioligand bound to the washed cell mass retained on the filter was quantified by liquid scintillation spectrometry. Binding affinity (Kd) of ß1AR, ß2AR, and chimera was determined using concentrations of [3H]CGP-12177 from 0.023–2.3 nM as previously described (26). Confocal microscopy of eGFP-tagged receptors was performed as described earlier (24).

Membrane preparations
Cells were harvested with ice-cold PBS containing 1 mM EDTA and collected by centrifugation (1000 x g). The cell pellets then were resuspended in 5 ml of a hypotonic buffer composed of 20 mM HEPES (pH 7.4); 2 mM MgCl2; and 1 mM EDTA (HME buffer) plus the protease inhibitors, leupeptin (5 µg/ml), aprotinin (5 µg/ml), and phenylmethylsulfonyl fluoride (200 nM). After incubation on ice for 15 min, the cells were homogenized with five to eight strokes of a Dounce homogenizer operating with a tight-fitting Teflon pestle. Membrane fractions were collected from 1,000 x g postnuclear supernatants by centrifugation at 10,000 x g. The crude membrane pellets were resuspended in 200 µl HME buffer, and protein concentration was determined. The Lowry method was used to determine the amount of protein in the samples before gel loading. The samples were subject to SDS-PAGE using 10% acrylamide gels. The resolved proteins were transferred electrophoretically onto nitrocellulose blots, probed with the anti-GFP antibody, and stained with a secondary antibody to which horseradish peroxidase was coupled. The chemiluminescence reagent was used to detect immunocomplexes.

Site-directed mutagenesis
Double mutation of serine residues 345 and 346 to alanine and tyrosyl residues 350 and 354 to phenylalanine in the ß12CTAR was performed using the Quickchange site directed mutagenesis kit (Stratagene, La Jolla, CA), according to the manufacturer’s suggested protocols. The sequences of the mutagenic primers were as follows: S345/346A, GCTTCTGTGCCTGCGCAGGGCCGCCTTGAAGGCCTATGGC; and Y350/354F, GGTCTTCTTTGAAGGCCTTCGGCAATGGCTTCTCCAGCAACGGCAACACAGGGG. The DNA sequence of the mutant receptors was confirmed by use of direct DNA sequencing of the mutant plasmid DNA.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To investigate the motif(s) that confer the ability of insulin to sequester ß2ARs, we needed to satisfy several criteria. First, ß2ARs are expressed virtually ubiquitously in cells in culture, and a cell line essentially deficient of ß2ARs is optimal for such studies. The CHO-K1 cells were used because these cells express vanishing few, if any, ß2AR (27). To investigate the domains/protein motif(s) through which insulin exerts its effects on sequestration of ß2AR, a recipient GPCR was required that was similar to the ß2AR but one that failed to undergo insulin-stimulated counterregulation. Earlier observations suggested that the action of the ß1AR, which shares many properties in common with the ß2AR, does not display counterregulation by insulin (2). Finally, the studies required that a functional assay of ßAR activity be coupled with the ability to study the sequestration by radioligand binding and independently by confocal microscopy.

Expression of ß1AR, ß2AR, and chimera in CHO-K1 cells
The ability to express the GFP-tagged ß1AR and ß2AR was investigated in CHO-K1 cells transiently transfected with mammalian expression vectors harboring the cDNAs of each. Crude cell membranes were prepared from the cells transiently transfected with the appropriate expression vector and harvested 30 h later. Using [125I]ICYP to assess the expression of total ßAR, we observed the following values (femtomoles per 106 cells): the ß1AR-expressing cells, 225.5 ± 49.5, and ß2AR-expressing cells, 186.0 ± 23 (27). Binding affinity to their antagonist [3H]CGP-12177 was determined using Scatchard plot. The results revealed Kd values (nanomoles) for ß1AR of 0.52 ± 0.02 and ß2AR of 0.66 ± 0.14. Thus, CHO-K1 cells transiently transfected with the same expression vector, but harboring different ßAR cDNAs, yielded comparable amounts of receptor expression. Aliquots of the crude cell membranes were subjected to SDS-PAGE and the separated proteins blotted with antibodies specific for the GFP-moiety (Fig. 1Go). The results of the immunoblotting demonstrate the expression of the receptors, ß1AR and ß2AR [mobility (Mr) ~98 kDa], both demonstrating relative mobilities that agree well with the expected Mr for their GFP-tagged versions of their ßAR subtypes (28). Some lower Mr forms likely to be products of differential glycosylation were apparent for the blots of either receptor subtype (29, 30).



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 1. Immunoblots (IBs) from membrane preparations of wild-type CHO-K1 cells and CHO-K1 cells with transient transfection of ß1AR-GFP, ß2AR-GFP, and ß12CTAR-GFP. CHO-K1 cells were transiently transfected with expression vector harboring the human ß2AR, ß1AR, or ß12CTAR chimera. Cells were then homogenized with a Dounce homogenizer and subjected to centrifugation at 10,000 x g. Samples were subject to SDS-PAGE using 10% acrylamide gels and probed with an antibody against GFP. Immunoblotting demonstrates expression of ß2AR, ß1AR, or ß12CTAR chimera with relative mobilities consistent with the expected Mr for their GFP-tagged versions of their ßAR subtypes. Some lower Mr forms of the either receptor subtype are likely to be products of differential glycosylation.

 
We also constructed a ß1/ß2CTAR chimera (human ß1AR from Met1-Ser380 and human ß2AR from Pro329-Leu413) to ascertain what effect, if any, the substitution of the ß2AR C terminus in the ß1AR would have on the ability of the chimera to respond to insulin. In transiently transfected CHO-K1 cells, the ß1/ß2CTAR chimeric receptor was expressed at levels (265.0 ± 21.9 fmol/106 cells) comparable with ß1AR and ß2AR, displaying the same approximated relative Mr on SDS-PAGE as the ß1AR (Fig. 1Go). Kd value (nanomoles) for binding of [3H]CGP-12177 to the ß1/ß2CTAR chimera was 0.51 ± 0.11, similar to ß1AR and ß2AR subtypes.

ß2AR and the ß1/ß2CTAR chimera, but not ß1AR, demonstrate insulin-sensitive counterregulation of isoproterenol-stimulated cAMP response
The ability of the ß-adrenergic agonist isoproterenol (10 µM) to stimulate cAMP accumulation in CHO cells transiently transfected with expression vectors harboring the cDNA for the ß1AR, ß2AR, and ß1/ß2CTAR was probed in cells expressing comparable amounts of receptors (Fig. 2Go). For the ß1AR-expressing cells, isoproterenol (10 µM) stimulated a robust increase in intracellular cAMP accumulation, and this response was not sensitive to counterregulation by insulin (100 nM). In cells expressing the ß2AR, isoproterenol stimulated a nearly equivalent cAMP response as observed in the cells expressing the ß1AR. When stimulated by both isoproterenol and insulin together, cells expressing the ß2AR, in contrast to those expressing the ß1AR, displayed an insulin-sensitive counterregulation of the isoproterenol-stimulated cAMP response, as reported earlier in other cell lines (6, 16, 31, 32, 33).



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 2. Insulin counterregulates the isoproterenol-stimulated cAMP response mediated by the ß2AR and the ß12CTAR chimera but not the ß1AR. CHO-K1 cells transiently transfected with expression vector harboring the human ß2AR, ß1AR, or ß12CTAR chimera were treated with or without 100 nM insulin (Ins) for 30 min and then challenged with 10 µM isoproterenol (Iso) for 15 min. Insulin suppressed isoproterenol-stimulated cAMP response in the cell transfected with the vectors harboring the ß2AR and ß12CTAR chimera but not the ß1AR. These data are mean values ± SEM representative of three separate experiments. Asterisks denote P ≤ 0.05 for the difference between insulin and KRP buffer treatments.

 
To ascertain whether the C-terminal region of the ß2AR is the dominant element of the receptor that confers the ability to be counterregulated by insulin, we studied a chimeric receptor composed of the core of the ß1AR (residues Met1-Ser380, which lacks the entire C-terminal cytoplasmic tail) to which the cytoplasmic C-terminal tail of the ß2AR (residues Pro329-Leu413) has been spliced (ß1/ß2CTAR, Fig. 2Go). The ß1/ß2CTAR was expressed at levels comparable with those observed for either the ß1AR or ß2AR and was able to stimulate cAMP accumulation in response to isoproterenol. Unlike the ß1AR that failed to display counterregulation by insulin, the ß1/ß2CTAR chimera was found to display an insulin-stimulated counterregulation of the cAMP response to isoproterenol. These data reveal that by substitution of the C terminus of the ß2AR to the ß1AR, an insulin-stimulated counterregulation was conferred to the ß1AR.

ß2AR and ß1/ß2CTAR chimera, but not ß1AR, demonstrate insulin-stimulated internalization
We sought to quantify the level of cell surface ßARs to test further the observations made by functional assay of insulin action on ß-adrenergic agonist-stimulated cAMP accumulation. The high-affinity, radiolabeled, and hydrophilic antagonist CGP-12177 is unique as a radioligand binding reagent because it is restricted to the extracellular aqueous environment and binds only to those ßARs localized in the cell membrane. Using [3H]CGP-12177 and intact cells, the surface complement of ß1AR, ß2AR, and ß1/ß2CTAR chimera were quantified in cells after a challenge with either isoproterenol (10 µM) or insulin (100 nM, Fig. 3Go). For either ß1AR or ß2AR, treatment with isoproterenol provoked a 60% reduction in the cell surface complement. The ß2AR displayed internalization of more than 40% in response to100 nM insulin. The ß1AR, in contrast, displayed no internalization in response to treatment of the cells with100 nM insulin.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 3. Insulin internalizes the ß2AR and the ß12CTAR chimera but not the ß1AR. CHO-K1 cells transiently transfected with expression vectors harboring the human ß1AR, ß2AR, or ß12CTAR chimera were treated with either 100 nM insulin (Ins) or 10 µM isoproterenol (Iso) for 30 min at 37 C. The internalization of the receptor was measured by use of a hydrophilic, cell-impermeable, radiolabeled ß-adrenergic antagonist [3H]CGP-12177. Insulin treatment promotes internalization of the ß2AR and ß12CTAR but not of the ß1AR. All three receptors displayed internalization in response to stimulation with the ß-adrenergic agonist isoproterenol. These data are mean values ± SEM of three separate experiments. The surface receptor expression in unstimulated cells is set at 100%. Asterisks denote P ≤ 0.05 for the difference between insulin treatment and control.

 
We also tested the ability of the ß1/ß2CTAR chimeric receptor to respond to agonist-induced internalization by 10 µM isoproterenol (Fig. 3Go). The ß1/ß2CTAR chimera displayed a robust approximately 80% reduction in cell surface localization in response to stimulation with the ß-adrenergic agonist. Unlike the parent ß1AR, which displays no insulin-sensitive internalization, the ß1/ß2CTAR chimera displayed counterregulation by insulin. More than 25% of the chimeric receptor was internalized within 30 min of challenge with insulin.

Insulin internalizes the ß2AR and the ß12CTAR chimera, but not the ß1AR: analysis by confocal microscopy
Confocal microscopy of the eGFP-tagged version of these receptors would allow us to detail the localization of the receptors in response to treatment with ß-adrenergic agonist and insulin. In human carcinoma cells (HeLa), most of the eGFP-tagged receptors are localized to the cell membrane under basal conditions and therefore serve as a good model for visualizing receptor trafficking. As such, we explored the localization of the eGFP-tagged ß1AR, ß2AR, and ß1/ß2CTAR chimera in HeLa cells. Isoproterenol readily stimulated the internalization of ß2AR-GFP and ß1AR-GFP expressed in these HeLa cells (Fig. 4Go). Both the ß2AR and ß1AR localized to the cell membrane (see white arrows) in the absence of treatment with hormones, appearing as punctate structures decorating the lipid bilayer of the plasma membrane. Treatment with isoproterenol provoked marked sequestration of the ß2AR-GFP within 30 min (see yellow arrowheads). This agonist-induced sequestration is a hallmark of GPCRs (34). The ß1AR-GFP, like the ß2AR-GFP, displayed a robust internalization in response to ß-adrenergic agonist-induced stimulation. In response to the counterregulatory effects of insulin, the ß2AR-GFP displayed internalization. This confirmed the imaging data obtained with the hydrophilic radioligand CGP-12177. In sharp contrast to the data obtained with the ß2AR-GFP, confocal images of the ß1AR-GFP reveal no internalization in response to insulin. The failure to detect internalization of ß1AR in response to insulin also confirmed the [3H]CGP-12177 radioligand binding data, providing a molecular explanation for the inability of insulin to counterregulate isoproterenol-stimulated cAMP accumulation in the ß1AR-bearing cells.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 4. Insulin internalizes the ß2AR and the ß12CTAR chimera but not the ß1AR: analysis by confocal microscopy. HeLa cells transiently transfected with expression vectors harboring the human ß1AR-GFP, ß2AR-GFP, or ß12CTAR-GFP chimera were treated for 30 min with either 100 nM insulin (Ins) or 10 µM isoproterenol (Iso) for 30 min at 37 C. The cells were fixed and the internalization of these GFP-tagged receptors was examined by confocal microscopy. The results displayed are from a single experiment and represent more than three independent experiments. White arrows indicate receptor localized to the cell membrane, appearing as punctate structures decorating the lipid bilayer. Yellow arrowheads indicate sequestered receptors that were no longer on the plasma membrane.

 
The GFP-tagged ß1/ß2CTAR chimera also was expressed in cells and examined by confocal microscopy. Like the GPCRs from which it was constructed, the ß1/ß2CTAR chimera-GFP displays ß-agonist-induced sequestration from the plasma membrane to intracellular, perinuclear regions of the cell (Fig. 4Go). Unlike the parent ß1AR from which the core of the chimera is composed, however, the ß1/ß2CTAR chimera now clearly displays the ability to be sequestered to the intracellular, perinuclear region of the cell in response to insulin. The ß1/ß2CTAR chimera by virtue of the substitution of the C-terminal tail from the ß2AR, has acquired the ability to be functionally and spatially regulated by a prominent member of the receptor tyrosine kinase family.

Mutation of the SH2 domain and Akt phosphorylation sites in the C terminus of the ß2AR abolishes insulin action on ß1/ß2CTAR chimera
It has been shown that stimulating cells with insulin catalyzes phosphorylation of an SH2 domain (Y350) and Akt phosphorylation sites (S345/346) in the cytoplasmic C-terminal domain of the ß2AR, both in vivo and in vitro (6, 7, 19, 35). We explored whether a Y350/354F double mutation that eliminates the SH2-binding domain in the C-terminal tail of the ß2AR would impact on the ability of the ß1/ß2CTAR chimera to signal and be counterregulated by insulin (Fig. 5Go). The Y350F mutation in the ß1/ß2CTAR chimera abolished the ability of insulin to counterregulate isoproterenol-stimulated cAMP accumulation. Likewise, mutation of an Akt phosphorylation site (S345/346A) in the ß1/ß2CTAR chimera abolished insulin-stimulated counterregulation of the cAMP response to isoproterenol. Elimination of either the Y350 or S345/346 residues can abolish the ability of insulin to counterregulate ß-adrenergic action on the chimera.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5. Mutation of either Y350/354F or S345/346A of the ß12CTAR abolishes counterregulation of ß-adrenergic agonist-stimulated cAMP accumulation by insulin. CHO-K1 cells transiently transfected with the human ß12CTAR, Y350/354F ß12CTAR (Y350/354F), and S345/346A ß12CTAR (S345/346A) were treated with or without 100 nM insulin (Ins) for 30 min and then with 10 µM isoproterenol (Iso) for 15 min. Insulin suppresses the isoproterenol-stimulated cAMP response in the ß12CTAR transfected cells but not in the Y350/354F or S345/346A mutants. The data are mean values ± SEM representative of three separate experiments. Asterisks denote P ≤ 0.05 for the difference between treatment insulin and KRP buffer treatments.

 
The ability of insulin to stimulate the sequestration of the ß1/ß2CTAR chimera harboring either the Y350F mutation or S345/346A mutation was also explored, using the CGP-12177 hydrophilic radioligand (Fig. 6Go). The ß1/ß2CTAR chimera displayed the ability to be sequestered to intracellular, perinuclear areas of the cell in response to insulin, a property inherent in the C-terminal domain of the ß2AR present in the chimera. Mutation of either the SH2 domain or the Akt phosphorylation site abolished the ability of these mutated chimeras to be sequestered from the cell surface in response to insulin, although their abilities to be sequestered in response to ß-adrenergic agonist was unaffected. Confocal microscopy of the mutant chimeras expressed in HeLa cells (data not shown) only confirmed the inability of either the Y350/354F or S345/346A mutant forms of the chimera from undergoing insulin-stimulated internalization. Both of the mutant chimeras retained the ability to undergo ß-adrenergic agonist-induced internalization (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 6. Mutation of either Y350/354F or S345/346A of the ß12CTAR abolishes sequestration of the ßAR chimera in response to insulin. CHO-K1 cells transiently transfected with the human ß12CTAR, Y350/354F ß12CTAR (Y350/354F), and S345/346A ß12CTAR (S345/346A) were treated with either 100 nM insulin (Ins) or 10 µM isoproterenol (Iso) for 30 min at 37 C. The internalization of the receptor was measured using a hydrophilic, impermeant, radiolabeled ß-adrenergic antagonist [3H]CGP-12177 (70 nM). Insulin treatment promotes internalization of the ß12CTAR in the transfected cells but not the Y350/354F or S345/346A mutants. All three chimers internalized in response to isoproterenol. The data are mean values ± SEM representative of three separate experiments. The surface receptor expression in unstimulated cells set at 100%. Asterisks denote P ≤ 0.05 for the difference between insulin treatment and control.

 
Elucidation of a 15-amino acid motif of the ß2AR that confers insulin-stimulated counterregulation when substituted in the ß1AR
To further define the sites on the ß2AR that are necessary for insulin mediated counterregulation, the C-terminal cytoplasmic tail was truncated to a short 15-amino acid motif from Lys342-Ser356. The motif included the Y350/354 (potential SH2-binding domain) and the S345/346 (potential Akt phosphorylation site). This 15-amino acid motif extended two to three amino acids on either side of these binding sites to maintain recognition sites flanking the sites of phosphorylation. We tested the ability of the ß12CT342–356AR chimeric receptor to respond to counterregulation of cAMP accumulation by 100 nM insulin. The ß12CT342–356AR was able to stimulate cAMP accumulation in response to isoproterenol. This response was sensitive to counterregulation by 100 nM insulin (Fig. 7AGo).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 7. Elucidation of a 15-amino acid motif (Lys342-Ser356) of the ß2AR C-terminal cytoplasmic tail is sufficient to confer insulin-stimulated counterregulation of the ß1AR. CHO-K1 cells transiently transfected with the human ß12CT342–356AR were treated with or without 100 nM insulin (Ins) for 30 min and then challenged with 10 µM isoproterenol (Iso) for 15 min. Insulin suppressed isoproterenol-stimulated cAMP response in the cell transfected with the vectors harboring the ß12CT342–356AR chimera (A). The internalization of the receptor was measured by use of a hydrophilic, cell-impermeable, radiolabeled ß-adrenergic antagonist [3H]CGP-12177 (70 nM). Insulin treatment promotes internalization of the ß12CT342–356AR (B). The data are mean values ± SEM representative of three separate experiments. Asterisks denote P ≤ 0.05 for the difference between insulin and KRP buffer treatments. HeLa cells transiently transfected with expression vectors harboring the human ß12CT342–356AR-GFP chimera were treated for 30 min at 37 C with either 100 nM insulin (Ins) or 10 µM isoproterenol (Iso). The cells were fixed and the internalization of these GFP-tagged receptors was examined by confocal microscopy (C). The results displayed are from a single experiment and representative of more than three independent experiments. White arrows indicate receptor localized to the cell membrane. Yellow arrowheads indicate sequestered receptors that were no longer on the plasma membrane.

 
We further evaluated the ability of insulin, compared with isoproterenol, to stimulate the internalization of the ß12CT342–356AR. The ß12CT342–356AR chimera displayed a robust approximately 60% reduction in cell surface localization in response to ß-adrenergic agonist. Unlike the parent ß1AR, it displayed approximately 15% internalization within 30 min of challenge with insulin (Fig. 7BGo). The tagged ß12CT342–356AR chimera was also expressed in cells and examined by confocal microscopy. As demonstrated with the hydrophilic radioligand [3H]CGP-12177 binding data, the ß12CT342–356AR displays the ability to be sequestered intracellularly, in response to ß-adrenergic agonist, and, more importantly, to insulin (Fig. 7CGo). Thus, the 15-amino acid motif of the C-terminal tail of the ß2AR containing the Y350 and Akt phosphorylation sites inserted into the ß1AR conferred response to insulin-mediated counterregulation of cAMP accumulation and receptor sequestration.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Insulin counterregulates catecholamine action at many loci, including directly at the ß2AR, receptor to receptor. Insulin exerts its counterregulation of ß2AR by interfering with signal transduction from the ß2AR to the heterotrimer G protein Gs by creating a functional SH2 binding domain to which molecules such as Grb2, dynamin, and the p85 regulatory subunit of PI3-kinase can bind the ß2AR (phosphoY350) and trafficking the ß2AR away from the cell membrane. These insulin-induced changes in ß2AR function and sequestration are essential for the ability of insulin to suppress ß-adrenergic action in normal physiology. The actions of agonist-induced desensitization and insulin-stimulated counterregulation of ß2AR appear to achieve the same goals of uncoupling the ß2AR from its cognate G protein and sequestering the receptor to the intracellular compartment, yet the mechanisms by which these two regulatory pathways exert their influence is quite different (36).

Although ßAR-agonist and insulin each catalyze phosphorylation of the ß2AR, the sites phosphorylated on the ß2AR and the protein kinases involved in the regulation are distinctly different (36). Insulin stimulates its receptor to catalyze the phosphorylation of several specific tyrosyl residues in the C terminus of the ß2AR, especially Y350/354. Phosphorylation of Y350 in vivo or in vitro creates an SH2 binding domain capable of binding many well-known signaling and adaptor molecules, including the p85 regulatory subunit of PI3-kinase, dynamin, and Grb2 (7). ßAR-agonist, in contrast, stimulates protein kinase A and/or members of the GPCR kinase family to phosphorylate the ß2AR, events also largely confined to the C-terminal cytoplasmic tail of this prototypic GPCR (4). The phosphorylation event itself and subsequent binding of other molecules to the phosphorylated ß2AR provide a likely explanation of the loss of the ability of the receptor to signal properly to Gs, essentially disrupting the functional capacity of the receptor. Somewhat later, but within 30 min of treatment with either ß-adrenergic agonist or insulin, the phosphorylated ß2AR undergoes sequestration to an intracellular, perinuclear compartment of the cell not accessible to catecholamine stimulation. Although the kinetics of the intracellular trafficking of the ß2AR by ß-adrenergic agonist, compared with insulin, appear similar, detailed analyses of the pathways with chemical inhibitors and dominant-negative mutant versions of key signaling in the pathway molecules clearly demonstrate that these pathways for receptor trafficking events are different (36).

The current work explored to what extent the C-terminal tail of the ß2AR provides the actual basis for the ability of insulin to counterregulate functionally and spatially the ß2AR. The ß1AR, like the ß2AR, binds and is activated by catecholamines, signals to the same heterotrimeric G protein Gs, and provokes the activation of adenylyl cyclase and accumulation of intracellular cAMP. Both the ß1AR and ß2AR are expressed ubiquitously but display unique aspects of regulation (4, 37, 38). ß2ARs are subject to insulin-stimulated counterregulation but not its ß1AR counterpart (31). In the current work, we tested this premise directly in several cell lines, observing that the ß1AR is largely resistant to insulin action on signaling to cAMP accumulation and receptor sequestration. To test whether the C-terminal tail of the ß2AR contains the motif(s) essential for insulin counterregulation, we compared the effects of insulin on ß1AR, ß2AR, and an interesting ß1/ß2CTAR chimera in which the C-terminal tail is ß2AR in origin, whereas the core of the chimera is ß1AR in origin.

The results clearly demonstrate that donation of the C-terminal tail of the ß2AR confers to the chimera the ability to be regulated by insulin. Insulin was able to counterregulate ß-adrenergic agonist stimulation of cAMP accumulation in the ß1/ß2CTAR chimera but not the parent ß1AR. The presence of the ß2AR C terminus on the chimera likewise enabled insulin to exert its ability to sequester the ß1/ß2CTAR chimera to intracellular, perinuclear areas of the cells, much like that observed for the ß2AR but not ß1AR.

More detailed analysis was performed by targeted mutagenesis of two important domains of the cytoplasmic C-terminal tail of the ß2AR for the action of insulin, i.e. the tyrosine phosphorylation site (Y350) that creates an SH2 binding domain when phosphorylated and the sites of Akt-catalyzed phosphorylation (S345/346). Mutation of either of these insulin-targeted sites impaired the ability of the ß2AR C terminus to confer insulin-stimulated counterregulation of function and intracellular trafficking to the ß1/ß2CTAR chimera.

To further define the sites necessary for counterregulation of insulin on the ß2AR, we constructed a shortened version of the C-terminal tail of the ß2AR to include only the putative sites of SH2 domain and Akt phosphorylation site. This motif of 15 amino acids from the C-terminal tail of the ß2AR extends from Lys342 to Ser356. Reducing the C-terminal tail of the ß2AR from 84 amino acids to 15 amino acids maintained insulin-mediated counterregulation of cAMP accumulation and sequestration of the ß1AR. Thus, the SH2 domain and the Akt phosphorylation sites are obligate for the ability of the ß2AR to be counterregulated by insulin and represent, as a unit, a transferable motif that links insulin counterregulation to GPCRs.


    Footnotes
 
This work was supported by United States Public Health Service Grants DK30111 and DK25410 from the National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health.

First Published Online September 23, 2004

Abbreviations: ß1AR, ß2AR, ß1- and ß2-Adrenergic receptors; ß12CTAR, ß1AR/ß2AR chimera containing the C terminus of ß2AR; CHO, Chinese hamster ovary; GFP, green fluorescent protein; GPCR, G protein-coupled receptor; Kd, binding affinity; KRP, Krebs-Ringer phosphate; Mr, mobility; PI3-kinase, 1-phosphatidylinositol 3-kinase; SH2, Src homology 2.

Received May 11, 2004.

Accepted for publication September 13, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ullrich A, Schlessinger J 1990 Signal transduction by receptors with tyrosine kinase activity. Cell 61:203–212[CrossRef][Medline]
  2. Benovic JL 2002 Novel ß2-adrenergic receptor signaling pathways. J Allergy Clin Immunol 110(6 Suppl):S229–S235
  3. Pawson T 2004 Specificity in signal transduction: from phosphotyrosine-SH2 domain interactions to complex cellular systems. Cell 116:191–203[CrossRef][Medline]
  4. Morris AJ, Malbon CC 1999 Physiological regulation of G protein-linked signaling. Physiol Rev 79:1373–1430[Abstract/Free Full Text]
  5. Hadcock JR, Port JD, Gelman MS, Malbon CC 1992 Cross-talk between tyrosine kinase and G-protein-linked receptors. Phosphorylation of ß2-adrenergic receptors in response to insulin. J Biol Chem 267:26017–26022[Abstract/Free Full Text]
  6. Karoor V, Baltensperger K, Paul H, Czech MP, Malbon CC 1995 Phosphorylation of tyrosyl residues 350/354 of the ß-adrenergic receptor is obligatory for counterregulatory effects of insulin. J Biol Chem 270:25305–25308[Abstract/Free Full Text]
  7. Baltensperger K, Karoor V, Paul H, Ruoho A, Czech MP, Malbon CC 1996 The ß-adrenergic receptor is a substrate for the insulin receptor tyrosine kinase. J Biol Chem 271:1061–1064[Abstract/Free Full Text]
  8. Pawson T, Scott JD 1997 Signaling through scaffold, anchoring, and adaptor proteins. Science 278:2075–2080[Abstract/Free Full Text]
  9. Songyang Z, Shoelson SE, Chaudhuri M, Gish G, Pawson T, Haser WG, King F, Roberts T, Ratnofsky S, Lechleider RJ 1993 SH2 domains recognize specific phosphopeptide sequences. Cell 72:767–778[CrossRef][Medline]
  10. Hawash IY, Kesavan KP, Magee AI, Geahlen RL, Harrison ML 2002 The Lck SH3 domain negatively regulates localization to lipid rafts through an interaction with c-Cbl. J Biol Chem [Erratum (2002) 277:17376] 277:5683–5691
  11. White MF, Kahn CR 1994 The insulin signaling system. J Biol Chem 269:1–4[Free Full Text]
  12. Quon MJ, Butte AJ, Zarnowski MJ, Sesti G, Cushman SW, Taylor SI 1994 Insulin receptor substrate 1 mediates the stimulatory effect of insulin on GLUT4 translocation in transfected rat adipose tissue. J Biol Chem 269:27920–27924[Abstract/Free Full Text]
  13. Rordorf-Nikolic T, Van Horn DJ, Chen D, White MF, Backer JM 1995 Regulation of phosphatidylinositol 3'-kinase by tyrosyl phosphoproteins. Full activation requires occupancy of both SH2 domains in the 85-kDa regulatory subunit. J Biol Chem 270:3662–3666[Abstract/Free Full Text]
  14. Schu PV, Takegawa K, Fry MJ, Stack JH, Waterfield MD, Emr SD 1993 Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein sorting. Science 260:88–91[Abstract/Free Full Text]
  15. Heller-Harrison RA, Morin M, Guilherme A, Czech MP 1996 Insulin-mediated targeting of phosphatidylinositol 3-kinase to GLUT4-containing vesicles. J Biol Chem 271:10200–10204[Abstract/Free Full Text]
  16. Karoor V, Wang L, Wang HY, Malbon CC 1998 Insulin stimulates sequestration of ß-adrenergic receptors and enhanced association of ß-adrenergic receptors with Grb2 via tyrosine 350. J Biol Chem 273:33035–33041[Abstract/Free Full Text]
  17. Malbon CC, Karoor V 1998 G-protein-linked receptors as tyrosine kinase substrates: new paradigms in signal integration. Cell Signal 10:523–527[CrossRef][Medline]
  18. Shih M, Malbon CC 1998 Serum and insulin induce a Grb2-dependent shift in agonist affinity of ß-adrenergic receptors. Cell Signal 10:575–582[CrossRef][Medline]
  19. Doronin S, Shumay E, Wang HH, Malbon CC 2002 Akt mediates sequestration of the ß2-adrenergic receptor in response to insulin. J Biol Chem 277:15124–15131[Abstract/Free Full Text]
  20. Calera MR, Martinez C, Liu H, Jack AK, Birnbaum MJ, Pilch PF 1998 Insulin increases the association of Akt-2 with Glut4-containing vesicles. J Biol Chem 273:7201–7204[Abstract/Free Full Text]
  21. Wang Q, Somwar R, Bilan PJ, Liu Z, Jin J, Woodgett JR, Klip A 1999 Protein kinase B/Akt participates in GLUT4 translocation by insulin in L6 myoblasts. Mol Cell Biol 19:4008–4018[Abstract/Free Full Text]
  22. Chalecka-Franaszek E, Chuang DM 1999 Lithium activates the serine/threonine kinase Akt-1 and suppresses glutamate-induced inhibition of Akt-1 activity in neurons. Proc Natl Acad Sci USA 96:8745–8750[Abstract/Free Full Text]
  23. Hill MM, Clark SF, Tucker DF, Birnbaum MJ, James DE, Macaulay SL 1999 A role for protein kinase Bß/Akt2 in insulin-stimulated GLUT4 translocation in adipocytes. Mol Cell Biol 19:7771–7781[Abstract/Free Full Text]
  24. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR 1989 Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61–68[CrossRef][Medline]
  25. Ros M, Northup JK, Malbon CC 1988 Steady-state levels of G-proteins and ß-adrenergic receptors in rat fat cells. Permissive effects of thyroid hormones. J Biol Chem 263:4362–4368[Abstract/Free Full Text]
  26. Staehelin M, Hertel C 1983 [3H]CGP-12177, a ß-adrenergic ligand suitable for measuring cell surface receptors. J Recept Res 3:35–43[Medline]
  27. George ST, Berrios M, Hadcock JR, Wang HY, Malbon CC 1988 Receptor density and cAMP accumulation: analysis in CHO cells exhibiting stable expression of a cDNA that encodes the ß2-adrenergic receptor. Biochem Biophys Res Commun 150:665–672[CrossRef][Medline]
  28. Freedman NJ, Liggett SB, Drachman DE, Pei G, Caron MG, Lefkowitz RJ 1995 Phosphorylation and desensitization of the human ß1-adrenergic receptor. Involvement of G protein-coupled receptor kinases and cAMP-dependent protein kinase. J Biol Chem 270:17953–17961[Abstract/Free Full Text]
  29. Fan G, Shumay E, Wang HH, Malbon CC 2001 The scaffold protein gravin (AKAP250) binds the b2-adrenergic receptor via the receptor cytoplasmic R329 to L413 domain and provides a mobile scaffold during desensitization. J Biol Chem 276:24005–24014[Abstract/Free Full Text]
  30. Gagnon AW, Kallal L, Benovic JL 1998 Role of clathrin-mediated endocytosis in agonist-induced down-regulation of the ß2-adrenergic receptor. J Biol Chem 273:6976–6981[Abstract/Free Full Text]
  31. Karoor V, Malbon CC 1998 G-protein-linked receptors as substrates for tyrosine kinases: cross-talk in signaling. Adv Pharmacol 42:425–428
  32. Karoor V, Malbon CC 1996 Insulin-like growth factor receptor-1 stimulates phosphorylation of the ß2-adrenergic receptor in vivo on sites distinct from those phosphorylated in response to insulin. J Biol Chem 271:29347–29352[Abstract/Free Full Text]
  33. Karoor V, Shih M, Tholanikunnel B, Malbon CC 1996 Regulating expression and function of G-protein-linked receptors. Prog Neurobiol 48:555–568[CrossRef][Medline]
  34. Lefkowtiz RJ 2004 Historical review: a brief history and personal retrospective of seven-transmembrane receptors. Trends Pharmacol Sci 25:413–422[CrossRef][Medline]
  35. Doronin S, Lin F, Wang H, Malbon CC 2000 The full-length, cytoplasmic C-terminus of the ß2-adrenergic receptor expressed in E. coli acts as a substrate for phosphorylation by protein kinase A, insulin receptor tyrosine kinase, GRK2, but not protein kinase C and suppresses desensitization when expressed in vivo. Protein Expr Purif 20:451–461[CrossRef][Medline]
  36. Shumay E, Gavi S, Wang HY, Malbon CC 2004 Trafficking of ß2-adrenergic receptors: insulin and ß-agonists regulate internalization by distinct cytoskeletal pathways. J Cell Sci 117:593–600[Abstract/Free Full Text]
  37. Bahouth SW, Park EA, Beauchamp M, Cui X, Malbon CC 1996 Identification of a glucocorticoid repressor domain in the rat ß1-adrenergic receptor gene. Recept Signal Transduct 6:141–149[Medline]
  38. Hadcock JR, Malbon CC 1988 Regulation of ß-adrenergic receptors by permissive hormones: glucocorticoids increase steady-state levels of receptor mRNA. Proc Natl Acad Sci USA 85:8415–8419[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gavi, S.
Right arrow Articles by Malbon, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gavi, S.
Right arrow Articles by Malbon, C. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals