| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Station Commune de Recherche en Ichtyophysiologie, Biodiversité et Environnement (A.S., L.D., P.P.), Institut National de la Recherche Agronomique, Institut Fedératif de Recherche 98, 35042 Rennes-Cedex, France; Kings College London (A.S., N.B.), Division of Life Sciences, London SE1 9NN, United Kingdom; Institut National de la Santé et de la Recherche Médicale U478 (J.F., M.E.R.-O.), Institut Fédératif de Recherche 02, Faculté de Médecine Xavier Bichat, 75870 Paris Cedex 18, France; Equipe dEndocrinologie Moléculaire de la Reproduction (G.F.), Unité Mixte de Recherche Centre National de la Recherche Scientifique 6026, Universite de Rennes I, 35042 Rennes-Cedex, France
Address all correspondence and requests for reprints to: P. Prunet, Institut National de la Recherche Agonomique SCRIBE, Campus de Beaulieu, 35042 Rennes-Cedex, France.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The cloning of the glucocorticoid and the mineralocorticoid receptors (GRs and MRs) in humans revealed their high degree of sequence similarity (5, 6). Furthermore, both receptors interact with the same type of palindromic consensus sequences in the regulatory regions of target genes, so-called glucocorticoid response elements (7). Despite such similarities, the GR and MR differ in agonist specificity. The MR binds corticosteroids at a higher affinity (affinity constant of 0.53 nM) than the GR does (affinity constant of 2065 nM) (3, 5, 8). Whereas both the GR and MR bind gluco- and mineralocorticoids with similar affinity, mineralocorticoids are much more efficient than glucocorticoids in transcriptionally activating the MR; the reverse is true for the GR (5, 9). The plasma concentrations of cortisol are 100- to 1000-fold greater than those of aldosterone (0.11 nM) (10). Consequently, the MR is expected to be permanently occupied by cortisol, which contradicts the well-documented specific physiological effects of aldosterone. This apparent paradox was resolved when the enzyme 11ß-hydroxysteroid dehydrogenase (11HSD) type 2 (11HSD2), which converts glucocorticoids to inactive metabolites, was discovered (11, 12). Coexpression of MR and 11HSD2 in classical mineralocorticoid target tissues, such as the tight epithelia of the kidney and intestine, is the basis for the protection of MR from glucocorticoid access, thus enabling mineralocorticoid specificity in these tissues (11, 12).
In the teleost fish, cortisol is the most abundant circulating corticosteroid and the main steroid produced by the interrenal, the piscine adrenocortical homolog (13, 14). The debate whether aldosterone exists in fish has been ongoing for a number of years (1). The current consensus is that there is no reliable evidence for aldosterone in teleosts and that the adrenocortical tissue in this group of vertebrates lacks the enzymes that accomplish the last step of aldosterone biosynthesis (13, 15). Cortisol has been shown to have both gluco- and mineralocorticoid activity in fish (16), considered as a key hormone of seawater adaptation (17, 18), and has been shown to regulate chloride cell function during freshwater adaptation (19, 20).
When Ducouret et al. (21) cloned a GR from the rainbow trout (Oncorhynchus mykiss), it was hypothesized that fish might possess only this one corticosteroid receptor (called rtGR1). However, in rainbow trout a second GR (rtGR2) has recently been isolated by cDNA cloning (22) as well as a partial cDNA sequence encoding a rainbow trout MR homolog (rtMR) (23). A similar suite of corticosteroid receptors (hbGR1, hbGR2, and hbMR) has been cloned and characterized in another teleost fish, the cichlid Haplochromis burtoni (24). The multiple corticosteroid receptors described in trout and Haplochromis are functionally distinct. The rtGR2 is transcriptionally activated in vitro by glucocorticoids at 10- to 100-fold lower concentrations than the rtGR1 (22), whereas the transactivation activity of the hbMR is enhanced by aldosterone and cortisol at lower concentrations (EC50 of 5 and 2 x 1010 M, respectively) than either hbGR1 and hbGR2 (EC50s for cortisol of 3.6 and 5.4 x 109 M, respectively) (24).
Recently, an 11HSD was identified and characterized in rainbow trout that resembles mammalian 11HSD2 in sequence and activity, converting cortisol to cortisone, and is expressed in ovary and Leydig cells of testis as well as heart, gills, and intestine (25). The coexpression of 11HSD and rtMR in tissues involved in osmoregulation, such as the gills and intestine, would open the possibility for ligands less abundant than cortisol being able to access and activate the rtMR, reminiscent of the way in which aldosterone specificity is conferred in mammals (11, 12).
In the present study, we identified the full coding sequence of the rtMR cDNA, investigated the distribution of the transcript among tissues, and analyzed the hormone dependency of its transcriptional activity. Interestingly, when we screened a broader range of corticosteroids for potential agonists, 11-deoxycorticosterone (DOC) was found to be equipotent to aldosterone, enhancing transcriptional activity of rtMR at the lower concentrations than other corticosteroids.
| Materials and Methods |
|---|
|
|
|---|
ZAP II (Stratagene, Amsterdam, The Netherlands) trout embryo cDNA bank was screened with a probe derived from a partial rtMR cDNA isolated earlier (23). One-phage clone was isolated, containing a partial rtMR cDNA of 2981 bp (E1, Fig. 1
DASH II; Stratagene) was screened with a cDNA probe derived from E1. Two-phage clones, named G1 and G2, were isolated from the trout genomic DNA bank (Fig. 1
|
Identification of a pufferfish MR
To obtain information about the prevalence of MR homologs in teleosts, the predicted amino acid sequence of the rtMR was used in a translated BLAST search of the pufferfish (Fugu rupribes) genome (26). The search identified gene fragments corresponding to different nuclear receptors, including one MR homolog. The initiation codon and the second exon of a pufferfish mineralocorticoid receptor (frMR) were located to scaffold 4754, whereas exons 39 were located to scaffold 1567 of the Fugu genome version 2 (http://bahama.jgi-psf.org/fugu/bin/blast.fugu.cgi). The coding sequence of the frMR was derived from the genomic DNA sequence, and the presence of a corresponding message in Fugu kidney was confirmed by amplification of the entire ORF by RT-PCR using primer 8, ATGGAGACCAAAAGATACCAAAGT, and primer 9, CTCTGGTGGGTTTCGAACAG, followed by subcloning and sequencing of the obtained amplicon.
Sequence analysis
Sequence comparisons were carried out between the rtMRa and b, hbMR, and the frMR (this study) and other human (hMR, GenBank accession no. P08235; GR
, 1201277A; progesterone receptor, P06401; androgen receptor, AF162704; estrogen receptor, P03372) or vertebrate steroid receptors (H. burtoni MR, AAM27890 Xenopus laevis MR U15133; rat MR P22199; rainbow trout, rtGR1 P49843, rtGR2 AY495372; H. burtoni: hbGR1 AAM27887 hbGR2 AAM27888 X. laevis GR P49844; rat GR P06536). The predicted amino acid sequences of the rtMR, frMR, and hMR were aligned using the ClustalW algorithm (BioEdit 5.0.9). Pairwise alignments, employing the Needleman-Wunsch algorithm and the EBLOSUM62 scoring matrix (http://www.ebi.ac.uk/), were used to establish the degree of amino acid identity between domains (5) of the rtMR and other receptors. Phylogenetic relationships among corticosteroid receptors were analyzed using the computer program package PHYLIP, version 3.6.a3 (27) (www.infobiogen.fr/). This involved the alignment (ClustalW) of the protein sequences of the ligand-binding domains, followed by the generation of phylogenetic trees using the neighbor-joining and bootstrap algorithms with human androgen receptor as the outgroup.
Quantitative real-time RT-PCR
Total RNA was isolated from tissues of freshwater-adapted immature female trout of an average weight of 60 g using a commercial reagent (TRI reagent; Sigma, St. Quentin Fallavier, France). One microgram of total RNA was reverse transcribed using Moloney murine leukemia virus reverse transcriptase and random hexamers (Promega). Primer 10, AGCTGGCTGGGAAACAGATGA, and primer 11, TCAGGGTGATTTGGTCCTCTATGG, used for real-time PCR of the rtMR (sum of rtMRa and rtMRb), were designed using primer3 software and generated a 93-bp product. The program parameters were adjusted to search for primers having a GC content of 5060% and a melting temperature of 6466 C. Regions permitted for upstream and downstream primers, respectively, were located in different exons, as defined by comparing the rtMR cDNA sequence to the pufferfish MR genomic DNA sequence (see above). The program mfold (http://www.bioinfo.rpi.edu/applications/mfold/old/dna/) was used to confirm that the template showed no secondary structures at the melting temperature of primers. Expression levels of the housekeeping gene 18S-RNA (GenBank accession no. AF308735) were used to control for differences in loading and cDNA synthesis efficiency between samples (primer 14, CGGAGGTTCGAAGACGATCA, primer 15, TCGCTAGTTGGCATCGTTTATG, generating a product of 62 bp).
Real-time PCRs were carried out using an iCycler (Bio-Rad Laboratories, Hercules, CA). Reactions were 25 µl and included 1 x SYBR Green PCR master mix (Applied Biosystems, Cortaboeuf, France), primers (400 or 200 nM for analyses of rtMR or 18S RNA, respectively), and cDNA (20 or 0.4 ng RNA equivalent for analyses of rtMR or 18S RNA, respectively). Cycling conditions were as follows: 10 min at 95 C, the 40 cycles of 15 sec at 95 C, and 40 sec at 55 C, followed by melt curve analysis. Fluorescence at 490 nm was determined during the annealing step. All reactions were run in triplicate. Controls without DNA template were included to verify the absence of cDNA contamination. To identify possible genomic contamination, further controls were included in which the template was the product of reverse transcription controls omitting reverse transcriptase. No amplification above background levels was observed in controls. Product melt curves confirmed that each PCR product had one peak. The software of the iCycler (Bio-Rad) was used to determine the threshold cycle (CT). For calibration, a cDNA pool was prepared from equal aliquots of all samples. To create standard curves, 80, 20, 5, 1.25, and 0.31 ng cDNA (RNA equivalent) of the cDNA pool were used in analyses of rtMR, whereas 5000, 1250, 312, 78, and 19.5 pg cDNA (RNA equivalent) were used in assays of 18S RNA. The efficiency of the PCR was calculated using the formula, E = 10[1/slope], and was as follows: ErtMR = 1.86 and E18S = 2.01. rtMR mRNA expression levels relative to 18S RNA abundance were calculated with the equation: (0.4/20) x E18S[CT(18S)]/ErtMR[CT(rtMR)]. The homogeneity of variance in the data set was confirmed by the Fmax test. ANOVA, followed by the Tukey-Kramer multiple comparison test, was used to assess whether levels of rtMR mRNA expression differed significantly among tissues.
Expression vector constructs
To obtain the construct pCMrtMRa, the rtMRa cDNAs of E1 and G1 were merged, using an ApaI site 1053 bp downstream of the initiation codon and the resulting cDNA integrated into the expression vector pCMV5. In brief, the insert was excised from E1 (Fig. 1
) with the restriction endonucleases EcoRI and HindIII and introduced into pCMV5 to give an intermediary construct. The 5' extremity of the rtMRa cDNA was amplified from G1 (Fig. 1
) by a PCR that introduced at the same time a consensus sequence (28) at the level of the initiation codon [PfuTurbo DNA polymerase (Stratagene), primer 14, GACCATGGAGACCAAAAGATACCCAAG, primer 15, GTCCTGCTGGCTTCTTCGTC]. Using appropriate enzymes, the truncated 5' end of the insert of the intermediary pCMV5 construct was removed and the PCR-generated cDNA inserted, yielding pCMrtMRa. To compare rtMRa and rtMRb, their cDNAs were subcloned into the expression vector pcDNA3 (Invitrogen), yielding the constructs pcDNrtMRa and pcDNrtMRb. The rtMRa and rtMRb cDNAs were obtained in earlier steps (construction of pCMrtMRa; RT-PCR on trout intestine, see above). All constructs were sequenced to assure correctness.
Cell culture and transactivation assays
COS-7 cells were grown in DMEM (41966, Invitrogen, Carlsbad, CA) supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, and 10% denatured fetal calf serum in a humidified atmosphere with 5% CO2. Four hours before transfection and throughout the rest of the experiment, cells were maintained in DMEM nutrient mixture F-12 Ham (D-2906, Sigma) supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, 3.7 g/liter NaHCO3, and 2.5% denatured fetal calf serum that had previously been desteroided by dextran/charcoal treatment. Cells were transiently transfected by the calcium precipitation method using a commercial system (Promega). The phosphate solution, prepared for a 6-well tray, contained 5 µg of the receptor expression vector (pCMrtMRa, pcrtMRa, or pcrtMRb), 10 µg pFC31Luc (which contains the mouse mammary tumor virus promoter upstream of the luciferase gene), and 2 µg pSVß (Clontech, Palo Alto, CA) containing the gene coding for the ß-galactosidase enzyme. In certain experiments, the reporter plasmid pTAT-tkLuc that contains the tyrosine kinase promotor upstream of the luciferase gene was used instead of pFC31Luc, or the construct phMR that contains the human MR cDNA (29) was used as the receptor expression vector. Twelve hours after transfection, the medium was renewed and steroids (aldosterone, DOC, cortisol, corticosterone, 11-deoxycortisol, cortisone, and 17
,20ß, 21-trihydroxy-4-pregnen-3-one) added from 1000-fold concentrated stock solutions in ethanol. In some experiments, cells were treated with the antihormones spironolactone, progesterone, and RU486, alone or together with steroids. After a 36-h incubation, cell extracts were analyzed for luciferase (Promega) ß-galactosidase (30) activities.
In addition to solvent-controls (receiving ethanol instead of hormone), further control treatments consisted of cells that had been transfected omitting the receptor expression vector (replaced by empty vector). In the absence of receptor cDNA, only marginal luciferase activity was detectable in cells treated with solvent carrier, 106 M aldosterone, 106 M cortisol, 105 M progesterone, or 105 M spironolactone (data not shown). Except where stated otherwise, experiments were repeated at least three times independently, with triplicate cell cultures per treatment. Luciferase activity was corrected for well-specific transfection efficiency (as determined by ß-galactosidase activity) and then expressed as the percentage of the luciferase activity observed in cells treated with 106 M aldosterone. EC50s were determined by least square regression after log-logit transformation (31). Comparisons among treatments in experiments with antagonists were carried out by ANOVA followed by Dunnetts test. The Fmax test was used to test the homogeneity of variance.
| Results |
|---|
|
|
|---|
|
|
|
,20ß,21-trihydroxy-4-pregnen-3-one (20ß-S) (Fig. 5
|
|
|
First, experiments were conducted with an alternative reporter construct in which the tyrosine kinase promotor controls luciferase expression (pTAT-tkLuc). This resulted in a very similar response pattern (data not shown), confirming that the original observation was not promoter specific (34). Second, when the cDNA of the hMR was transfected into COS-7 cells together with pFC31Luc, spironolactone had no agonist activity with the hMR (data not shown) and progesterone up to 106 M behaved as expected (Fig. 7C
). This demonstrates that the agonist activity of spironolactone and progesterone on the rtMRa (Fig. 7A
) reflects the properties of the rtMRa and is not due to the experimental system. However, at a high concentration of 105 M, progesterone was able to maximally increase transactivation by the hMR when given alone and failed to antagonize aldosterone (Fig. 7C
). This suggests that progesterone, at high concentrations, interacts with unknown factor(s) in the cellular system affecting the level of reporter activity in the presence of rtMRa or hMR.
Pattern of tissue distribution of rtMR
We investigated the mRNA expression levels of the trout MRs among tissues using quantitative real-time RT-PCR. Because of the high degree of nucleotide identity between rtMRa and rtMRb (<98.5%), these primers do not distinguish between the two forms. rtMR expression was found in all of the trout tissues investigated (brain, eye, gut, liver, kidney, gills, spleen, head kidney, ovary, heart, muscle, skin) (Fig. 8
). Expression in brain was significantly higher than that in other tissues (Fig. 8
).
|
| Discussion |
|---|
|
|
|---|
99% for both nucleotide and amino acid sequences), rtMRa and rtMRb most probably represent allelic variants of the same gene. Alternatively, they might represent paralogs, possibly reflecting the tetraploid ancestry of salmonids (35).
The rtMR mRNA (sum of rtMRa and rtMRb) could be detected measured by real-time RT-PCR in all tissues studied, with highest expression levels in brain and a less pronounced expression in the remaining tissues (Fig. 7
). This expression pattern differs from the distribution of hMR mRNA, analyzed in Northern blots (5). Among human tissues, kidney showed the highest hMR mRNA expression, followed by brain (5). The hMR message was further detectable in gut, pituitary, and heart but not found in liver and muscle (5). The unspectacular level of rtMR expression in tissues involved in teleost osmoregulation, such as gills and intestine, is unusual for a receptor suspected to be involved in regulating ion homeostasis. However, it is conceivable that rtMR in the gill and intestine is restricted to certain cell types specifically involved in ion transport. The rtMR might adopt distinct roles in tissues not involved in osmoregulation, and the high expression levels in the brain are reminiscent of the expression pattern of the hMR (5). At present, the function of the rtMR remains unresolved, and further research, particularly concerning the cell-type-specific expression of rtMR and trout GRs, is necessary to unravel the physiological role of the rtMR.
Apart from cortisone and 20ß-S, all corticosteroids tested (aldosterone, DOC, cortisol, 11-deoxycortisol, corticosterone, and dexamethasone) enhanced transcriptional activity of the rtMR in vitro. Remarkably, however, the mineralocorticoids aldosterone and DOC stimulated rtMR transactivation at 10-fold lower concentrations (EC50 of
1 x 1010 M) than the most active glucocorticoid, cortisol. The rtMRs preference of mineralocorticoids over glucocorticoids is reminiscent of the hMR, which, in transactivation assays, is approximately 100-fold more sensitive to DOC and aldosterone than cortisol (9). Surprisingly, the mammalian antimineralocorticoids, spironolactone and progesterone, acted as rtMR agonists. The reason for this is unclear.
Among the corticosteroids tested, cortisol is the main product of the teleost interrenal. In unstressed individuals, plasma concentrations of cortisol are less than 5 ng/ml (<14 nM), whereas 10- to 100-fold increases have been reported after stressful experiences (36). 11-Deoxycortisol, DOC, and corticosterone occur as circulating hormones in teleosts at concentrations similar to resting levels of cortisol (14, 37, 38). In rainbow trout, published plasma levels during spermiation and oocyte maturation are 1452 nM for 11-deoxycortisol and 6.19.4 nM for DOC, whereas no corticosterone was found (38). Evidence for aldosterone in teleosts is unconvincing and controversial (13), and in most teleosts aldosterone is not produced by interrenal tissue in vitro (39, 40). In accordance with this, recent studies failed to provide evidence for aldosterone synthetase in teleosts (15, 41).
Cortisol, the proposed main gluco- and mineralocorticoid in teleosts, is an obvious candidate ligand for the rtMR. Cortisol has been shown to bind with high affinity to the rtMRs ligand-binding domain (23). In the present study, cortisol enhanced transcriptional activity of the rtMRa and rtMRb (EC50
1 x 109 M) at lower concentrations than those required to increase transactivation by the rtGR1 (EC50
1 x 107 M) or rtGR2 (EC50
1 x 108 M) when expressed in COS-7 cells (22). Similarly, the recently described MR homolog from H. burtoni was markedly more sensitive to cortisol (EC50
2 x 1011 M) than the two hbGRs (24). This suggests the rtMR could function as a high-affinity cortisol receptor, paralleling the role of the mammalian MR in nonclassical mineralocorticoid target tissues, such as the brain, in which it is a high-affinity (type 1) glucocorticoid receptor (42).
However, in the view of our finding that the mineralocorticoid DOC is the most potent agonist of the rtMR, the question arises whether this hormone could constitute a further physiological ligand of the rtMR. In mammals, the interaction of aldosterone with the MR in classical mineralocorticoid target tissues requires factors preventing the more abundant ligand cortisol accessing this receptor. In the plasma corticosteroid binding globulin tightly binds cortisol, 11-deoxycortisol, and DOC but not aldosterone (43), and in the mineralocorticoid target cells, the enzyme 11HSD2 metabolizes glucocorticoids to inactive products, conferring mineralocorticoid specificity (11, 12). In teleosts, evidence for corticosteroid binding globulin is lacking (41), but recently a trout 11ßHSD resembling the mammalian 11ßHSD2 in sequence and activity, converting cortisol to cortisone, has been cloned (25). An important function of this enzyme in fish is the biosynthesis of the active androgen, 11-ketotestosterone (44), and it was suggested that trout 11HSD might also protect gonadal tissues against adverse effects of cortisol (25). A further role of trout 11HSD might be to prevent cortisol occupancy of the rtMR, particularly in stressed fish enabling less abundant 11-deoxycorticosteroids, such as DOC, to access the receptor. Interestingly, transactivation activity of the rtMR was stimulated by two 11-deoxycorticosteroids, the most potent agonist DOC (EC50 1.1 x 1010 M) and the moderately potent compound 11-deoxycortisol (EC50 3.7 x 109 M). These corticosteroids are specific rtMR agonists in that they are inactive (DOC), or only marginally active (11-deoxycortisol), on the rtGR1 and rtGR2 (22). DOC and 11-deoxycortisol are produced by teleost adrenal and ovary tissue from exogenous precursors in vitro (40, 45) and occur as circulating hormones in teleosts (37, 38).
In this study, DOC effected half-maximal transcriptional activation at approximately 1 x 1010 M and full activation at 10-fold higher concentrations. DOC plasma levels measured in mature adult trout (
510 nM; see above) and hence compare well to the concentration range over which the rtMR becomes transcriptionally active. Although scanty, several studies have suggested physiological effects of DOC in teleost fish. DOC induces the in vitro maturation of Heteropneustes fossilis oocytes (46) and has effects on the histology of the thymus in Oryzias latipes (47). Circulating plasma levels of DOC in tilapia increase dramatically (38-fold) during the adaptation to warm water temperatures, which coincides with the initiation of reproductive processes (48). On the basis of our results, a possible role of 11-deoxycortisol as a physiological ligand of the rtMR cannot be excluded but appears less probable in the view of the lesser activity of this steroid. Evidence for physiological effects of 11-deoxycortisol are scarcer than for DOC. A potential role of 11-deoxycortisol in the induction of oocyte maturation in sturgeon has been suggested (49).
In conclusion, the rtMR differs from the rtGRs in its the transactivational properties, indicating it is likely to be functionally distinct. Relating the agonist potential of different corticosteroids to their circulatory concentrations in trout suggests that, in addition to the major circulating teleost corticosteroid cortisol, the most potent agonist DOC, and possibly other11-deoxycorticosteroids, could act as physiological ligand(s) of the rtMR. The recent discovery of a trout 11HSD suggests that one role of this enzyme might be to inactivate cortisol, a hormone that reaches high concentrations after stressful stimuli. Action of 11HSD could provide a potential mechanism of preventing cortisol accessing the rtMR, thereby enabling the less abundant DOC to act as a ligand of the rtMR.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online October 14, 2004
Abbreviations: CT, Cycle threshold; DOC, 11-deoxycorticosterone; frMR, pufferfish (Fugu rupribes) MR; GR, glucocorticoid receptor; hbGR1, hbGR2, Haplochromis burtoni GRs; hbMR, H. burtoni MR; hGR, human GR; hMR, human MR; 11HSD, 11ß-hydroxysteroid dehydrogenase; 11HSD2, 11HSD type 2; MR, mineralocorticoid receptor; ORF, open reading frame; RACE, rapid amplification of cDNA ends; rtMR, rainbow trout MR homolog; 20ß-S, 17
,20ß,21-trihydroxy-4-pregnen-3-one.
Received February 2, 2004.
Accepted for publication October 4, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. M. Rodela, M. D. McDonald, P. J. Walsh, and K. M. Gilmour The regulatory role of glucocorticoid and mineralocorticoid receptors in pulsatile urea excretion of the gulf toadfish, Opsanus beta J. Exp. Biol., June 15, 2009; 212(12): 1849 - 1858. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Becker, A. Sturm, J. E. Bron, K. Schirmer, and N. R. Bury The A/B Domain of the Teleost Glucocorticoid Receptors Influences Partial Nuclear Localization in the Absence of Hormone Endocrinology, September 1, 2008; 149(9): 4567 - 4576. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Alsop and M. M. Vijayan Development of the corticosteroid stress axis and receptor expression in zebrafish Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R711 - R719. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Bury, M. J. Chung, A. Sturm, P. A. Walker, and C. Hogstrand Cortisol stimulates the zinc signaling pathway and expression of metallothioneins and ZnT1 in rainbow trout gill epithelial cells Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2008; 294(2): R623 - R629. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Aluru and M. M. Vijayan Hepatic transcriptome response to glucocorticoid receptor activation in rainbow trout Physiol Genomics, November 14, 2007; 31(3): 483 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Ortlund, J. T. Bridgham, M. R. Redinbo, and J. W. Thornton Crystal Structure of an Ancient Protein: Evolution by Conformational Epistasis Science, September 14, 2007; 317(5844): 1544 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kiilerich, K. Kristiansen, and S. S Madsen Cortisol regulation of ion transporter mRNA in Atlantic salmon gill and the effect of salinity on the signaling pathway J. Endocrinol., August 1, 2007; 194(2): 417 - 427. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Bridgham, S. M. Carroll, and J. W. Thornton Evolution of hormone-receptor complexity by molecular exploitation. Science, April 7, 2006; 312(5770): 97 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Milla, B. Jalabert, H. Rime, P. Prunet, and J. Bobe Hydration of rainbow trout oocyte during meiotic maturation and in vitro regulation by 17,20{beta}-dihydroxy-4-pregnen-3-one and cortisol J. Exp. Biol., March 15, 2006; 209(6): 1147 - 1156. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Pascual-Le Tallec and M. Lombes The Mineralocorticoid Receptor: A Journey Exploring Its Diversity and Specificity of Action Mol. Endocrinol., September 1, 2005; 19(9): 2211 - 2221. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. DiBattista, H. Anisman, M. Whitehead, and K. M. Gilmour The effects of cortisol administration on social status and brain monoaminergic activity in rainbow trout Oncorhynchus mykiss J. Exp. Biol., July 15, 2005; 208(14): 2707 - 2718. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Veillette and G. Young Tissue culture of sockeye salmon intestine: functional response of Na+-K+-ATPase to cortisol Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1598 - R1605. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Gilmour Mineralocorticoid Receptors and Hormones: Fishing for Answers Endocrinology, January 1, 2005; 146(1): 44 - 46. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |