Endocrinology, doi:10.1210/en.2005-0254
Endocrinology Vol. 146, No. 10 4250-4256
Copyright © 2005 by The Endocrine Society
Adiponectin Gene Is Expressed in Multiple Tissues in the Chicken: Food Deprivation Influences Adiponectin Messenger Ribonucleic Acid Expression
Sreenivasa Maddineni,
Shana Metzger,
Olga Ocón,
Gilbert Hendricks, III and
Ramesh Ramachandran
Department of Poultry Science, The Pennsylvania State University, University Park, Pennsylvania 16802
Address all correspondence and requests for reprints to: Dr. Ramesh Ramachandran, Department of Poultry Science, The Pennsylvania State University, University Park, Pennsylvania 16802. E-mail: rameshr{at}psu.edu.
 |
Abstract
|
|---|
Adiponectin is a cytokine hormone originally found to be secreted exclusively by white adipose tissue. However, recent evidences suggest that adiponectin is also produced in brown adipose tissue and skeletal muscle. The present study investigated the expression of adiponectin mRNA in various tissues in the chicken. We also studied the effect of food deprivation on adiponectin gene expression in adipose tissue, liver, anterior pituitary gland, and diencephalon in the chicken. The open reading frame of chicken adiponectin cDNA consists of 735 nucleotides that were 6568% homologous to various mammalian adiponectin cDNAs. The deduced amino acid sequence of chicken adiponectin contains 22 glycine-X-Y repeats (in which X and Y represent any amino acid) at the N-terminal end as found in the mammalian adiponectin. By RT-PCR and Northern analysis, we detected chicken adiponectin mRNA transcript in adipose tissue, liver, anterior pituitary gland, diencephalon, skeletal muscle, liver, kidney, ovary, and spleen but not in blood. Adiponectin mRNA expression in various tissues was quantitated using real-time quantitative PCR and found to be the highest in adipose tissue, followed by liver, anterior pituitary, diencephalon, kidney, and skeletal muscle. We also found that adiponectin mRNA quantity was significantly decreased after a 48-h food deprivation in adipose tissue, liver, and anterior pituitary gland but not in diencephalon. Our results provide novel evidence that, unlike mammals, adiponectin gene is expressed in several tissues in the chicken and that its expression is influenced by food deprivation.
 |
Introduction
|
|---|
ADIPONECTIN (also called Acrp30, apM1, GBP28, or adipoQ) is a 30-kDa adipocytokine hormone exclusively secreted from the adipose tissue in several mammalian species (1, 2, 3, 4). It is a 244-amino-acid protein belonging to a family of proteins that contain sequences homologous to the C1q globular domain (5, 6). Adiponectin consists of a N-terminal collagenous domain and C-terminal globular domain (7, 8). It circulates as a trimer, hexamer, heavy molecular weight forms, and also as small proteolytic cleavage products in mouse and human plasma (9, 10). Adiponectin exerts its action by binding to two specific receptors, adipoR1 and adipoR2 (11). AdipoR1 is expressed ubiquitously, with the most abundant expression occurring in the mouse skeletal muscle, whereas adipoR2 is predominantly expressed in the mouse liver (11). Expression of adipoR1 and adipoR2 has been reported in human and rat pancreatic ß-cells (12) as well.
Adiponectin has been found to have a profound effect on glucose utilization, insulin sensitivity, lipid synthesis, and energy homeostasis in several mammalian species. Deletion of the adiponectin gene induces insulin resistance in mice fed with high-fat/high-sugar diet (13). Adiponectin treatment or overexpression of the adiponectin gene protects overfed rats from gaining weight and from developing cardiovascular diseases by suppressing glucose production and enhancing lipid oxidation (13, 14). Overfeeding and obesity decreases blood adiponectin concentrations, whereas calorie restriction results in increased adiponectin levels and insulin sensitization in rats (15). Overexpression of adiponectin also significantly decreases free fatty acids and triglycerides in genetically obese mice (16). In addition, adiponectin acts in the brain to bring about increased energy expenditure throughout the body, resulting in significant body weight reduction in mice (17). Adiponectin has been found to antagonize the incorporation of glucose carbon into lipid in the cultured porcine adipocytes (18). Adiponectin stimulates glucose utilization and fatty-acid oxidation by phosphorylating and activating 5'-AMP-activated protein kinase (14). Such activation also results in increased muscle fatty acid oxidation through inhibition of acetyl-Coenzyme A carboxylase and activation of malonyl-Coenzyme A decarboxylase (19). Furthermore, transgenic overexpression of adiponectin in rats significantly decreased gluconeogenesis and lipogenesis by inhibiting gene expressions of phosphoenolpyruvate carboxykinase and sterol regulatory element-binding protein 1c in the liver (20).
Whereas adiponectin has been well characterized in mammalian species, nonmammalian adiponectin has not been described in the past. Adiponectin is likely to play a dominant role in carbohydrate and lipid metabolism in avian species because chickens maintain a very high blood glucose concentration (21). In addition, a majority of the lipids in the chicken are synthesized in the liver but not in the adipose tissue as in mammals (22). We report characterization of chicken adiponectin cDNA that was cloned from a pituitary cDNA library. We provide novel evidence that, unlike in mammals, adiponectin gene is expressed in the chicken liver, diencephalon, anterior pituitary gland, kidney, ovary, spleen, and skeletal muscle besides adipose tissue. We also tested the hypothesis that fasting would affect adiponectin mRNA expression in adipose tissue, liver, pituitary gland, and diencephalon in the chicken.
 |
Materials and Methods
|
|---|
Animals
Sexually mature egg-laying 35-wk-old hens (Hyline W36 strain) housed in cages were provided water and standard layer feed ad libitum unless otherwise indicated. All animal procedures were performed in accordance with the Institutional Animal Care and Use Committee approved protocol. Chickens were fasted for 48 h to determine the effect of fasting on adiponectin gene expression in various tissues. Water was provided ad libitum during fasting.
Cloning of chicken adiponectin cDNA
Adiponectin cDNA was cloned from a chicken pituitary cDNA library developed in our laboratory using anterior pituitary glands collected from 85-wk-old recycled egg-laying chickens (Hyline W36 strain). For creating the pituitary cDNA library, total RNA from the pituitary gland was extracted using RNeasy kit (Qiagen, Valencia, CA). Both quality and quantity of total RNA was determined using a spectrophotometer (Amersham Biosciences, Newark, NJ). After deoxyribonuclease I (DNAse-I) treatment, total RNA was reverse transcribed to obtain the first-strand cDNA using Powerscript reverse transcriptase using Smart IV oligonucleotide and CDS III/3' PCR primer set (Creator Smart cDNA Library Construction kit; Clontech, Palo Alto, CA). The resultant single-stranded cDNA was amplified using 5' PCR primer and CDS III/3' primer (Clontech) in a PTC-200 DNA engine (MJ Research, Reno, NV) using initial denaturation at 95 C for 1 min, followed by 35 cycles of 95 C for 15 sec and 68 C for 6 min. After proteinase K inactivation of DNA polymerase activity, the cDNAs were digested with SfiI, size fractionated using CHROMA SPIN-400 column and cloned into pDNR-LIB (Clontech) plasmid, and transformed into Electromax competent cells (Invitrogen, Carlsbad, CA). The transformed cells were grown in LB agar media containing chloramphenicol. The resulting library was tittered and amplified. Using the amplified library, plasmids were purified using a Maxiprep kit (Marligen Biosciences, Ijamsville, MD). A PCR-based library screening was done to detect and amplify adiponectin cDNA using primers designed from a chicken adiponectin cDNA sequence (GenBank accession no. AY523637). A 735-bp PCR product was amplified using 300 nM of the forward and reverse primers (forward, ATGAGGGGCTCAGTAGGCTTCCTCCTTT; reverse, CTAACGGTCATCTGTGTCTGGGTACAGGAGGAA), 300 nM dNTP mixture (Invitrogen), and 2.5 U of Deep VentR polymerase (New England Biolabs, Beverly, MA). The mixture was subjected to PCR using a thermocycle of 95 C for 2 min, 35 cycles of 95 C for 30 sec, 55 C for 10 sec, 68 C for 1 min, with a final extension at 68 C for 5 min. The 735-bp PCR product was gel purified and subcloned into pGEM-T Easy vector (Promega, Austin, TX), and both sense and antisense strands were sequenced (Davis Sequencing, Davis, CA) using Sp6 and T7 primers.
RT-PCR
Adipose tissue, diencephalon, blood, anterior pituitary gland, liver, skeletal muscle, spleen, ovary, and kidney were harvested from sexually mature 35-wk-old female chickens. Total RNA from each tissue was extracted using Trizol (Invitrogen) and/or by using RNeasy kit (Qiagen). After DNAse-I (Qiagen) treatment, first-strand cDNA was synthesized by reverse transcribing 1 µg of total RNA using d(T)30A/G/CA/G/C/T primer, and 2U Powerscript reverse transcriptase (Clontech). Approximately 50 ng of single-stranded cDNA was used as template to amplify a 350-bp product [nucleotides 250599 of chicken adiponectin cDNA (Fig. 1
)] using the following primers: forward, ACAGGTGCAGAAGGACCGAGAGGATT; reverse, AAGACAGAGCCGCTTGCTTGGTCAAC. A touch-down PCR was performed using the following program: 94 C for 1 min, 30 cycles of 94 C for 5 sec, and 7268 C for 3 min. Annealing and primer extension were done at 72, 70, and 68 C during 15, 610, and 1130 cycles, respectively. The PCR products were subjected to agarose gel electrophoresis and ethidium bromide staining for visualization. For negative control, RT reactions using 1 µg of total RNA from each tissue with no reverse transcriptase (No-RT control) were used as template in place of single-stranded cDNA.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 1. Nucleotide sequence of the chicken adiponectin cDNA open reading frame and the deduced amino acid sequence. The chicken adiponectin cDNA contains 735 bp that translates into 244-amino-acid protein. Box represents a portion of the N-terminal end containing 22 glycine-X-Y repeats (in which X and Y represent any amino acid) that are commonly found in the collagenous domain of mammalian adiponectin. Glycine residues within the box are italicized. ***, The stop codon.
|
|
Northern hybridization analysis
Total RNA was extracted from the diencephalon, blood, pituitary gland, liver, skeletal muscle, and adipose tissue using Trizol (Invitrogen) and/or by using RNeasy kit (Qiagen) and treated with DNAse-I. Total RNA (1 µg) from each tissue was electrophoresed, transferred to nylon membrane (Amersham Biosciences), and UV cross-linked. A 350-bp chicken adiponectin partial cDNA was amplified by PCR (corresponding to nucleotides 250599 in Fig. 1
). T7 polymerase promoter sequences were added to the antisense strand of this product by PCR. A digoxigenin-labeled riboprobe was prepared by in vitro transcription using T7 polymerase and used in Northern hybridization. The membranes were hybridized with the riboprobe overnight at 68 C. After high-stringency washes at 68 C, the membranes were incubated with anti-digoxigenin antibody conjugated to alkaline phosphatase (Roche Biochemicals, Indianapolis, IN), and the hybridization signal was detected using ECF chemifluorescent substrate (Amersham Biosciences). Hybridization signal was detected using Storm 860 imager (Molecular Dynamics, Piscataway, NJ).
Adiponectin mRNA quantitation in various tissues by real-time quantitative PCR
Total RNA was extracted from adipose tissue, diencephalon, pituitary gland, skeletal muscle, liver, and kidney as described above. Total RNA (1 µg) was reverse transcribed using d(T)30A/G/CA/G/C/T, 2U Powerscript reverse transcriptase (Clontech) in a 20-µl reaction. Both adiponectin mRNA and chicken ß-actin mRNA were quantitated using 2 µl of the RT reaction (equivalent of 100 ng of single-stranded cDNA) as template in the real-time quantitative PCR. An 86-bp product for chicken adiponectin corresponding to nucleotides 204289 (Fig. 1
) was amplified using the following primers: forward, GCCAGGTCTACAAGGTGTCA; reverse, CCATGTGTCCTGGAAATCCT. Similarly, a 123-bp product of chicken ß-actin corresponding to nucleotides 10261148 (GenBank accession no. L08165) was amplified using the following primer set: forward, CTGGCACCTAGCACAATGAA; reverse, CTGCTTGCTGATCCACATCT. The real-time quantitative PCR consisted of 1x Platinum SYBR Green qPCR Super Mix-UDG (Invitrogen) and 300 nM of forward and reverse primers. The reactions were performed in the DNA engine Opticon II (MJ Research) with the following settings: 50 C for 2 min, 95 C for 2 min, followed by 45 cycles of 95 C for 15 sec, 55 C for 30 sec, and 72 C for 30 sec. At the end of amplification, a melting curve analysis was done by heating the PCR products to 6595 C and held for 15 sec at increments of 0.2 C, and the fluorescence was detected to confirm the presence of a single amplification product. Each sample from fed and fasted chickens was run in duplicate to obtain average CT values for adiponectin mRNA and ß-actin mRNA. For negative controls, No-RT controls were used as template in place of single-stranded cDNA in the real-time quantitative PCR. The log-linear threshold values (CT) during the exponential phase of the PCR for adiponectin mRNA were subtracted from that of ß-actin mRNA. Adiponectin mRNA quantity was expressed as a proportion of ß-actin mRNA quantity following the 2
CT method for converting log-linear CT values to linear term (23). The relative amount of adiponectin mRNA in various tissues were then compared.
Effect of fasting on adiponectin mRNA expression
Chickens were either fed ad libitum or fasted (n = 6) for 48 h and killed by decapitation. Liver, adipose tissue from the abdominal fat pad, and anterior pituitary gland were collected from experimental chickens, frozen in liquid nitrogen, and stored at 80 C until analyzed. Brains from the fed and fasted chickens were removed from the cranium, incised coronally at the level of midbrain, frozen on powdered dry ice, and stored at 80 C. Using a cryostat (Richard-Allen Scientific, Kalamazoo, MI), brain tissue sections (16 µm) in the coronal plane were made covering the entire diencephalon. Total RNA from the diencephalon tissue sections, liver, and adipose tissue was extracted using Trizol (Invitrogen). Total RNA from the anterior pituitary gland was extracted using RNeasy kit (Qiagen). DNAse-I treated total RNA (1 µg) from each tissue was reverse transcribed as described above. A real-time quantitative RT-PCR analysis was done to quantitate adiponectin mRNA and ß-actin mRNA in all of the above tissues using SYBR Green dye as described above. The amount of adiponectin mRNA was expressed as a proportion to ß-actin mRNA and compared between fed and fasted chickens.
Statistical analyses and software used
Relative adiponectin mRNA quantity to ß-actin mRNA quantity was first converted from log-linear to linear term and then compared using General Linear Models Procedure of SAS (SAS Institute, Cary, NC). Adiponectin mRNA quantity in the adipose tissue, liver, anterior pituitary gland, and diencephalon between fed and fasted chickens was compared using multiple Students t test. A probability level of P < 0.05 was considered statistically significant. For DNA sequence analysis and for PCR primer designing, Vector NTI suite 9.1 (Invitrogen) was used.
 |
Results
|
|---|
Cloning of chicken adiponectin cDNA
Using a pituitary cDNA library, we cloned the full-length chicken adiponectin cDNA. The nucleotide sequence of chicken adiponectin cDNA open reading frame is provided in Figure 1
. The open reading frame of chicken adiponectin was found to be 735 bp that will yield a protein of 244 amino acids. The chicken adiponectin cDNA is 6568% homologous to pig, human, mouse, or dog adiponectin cDNA, whereas the deduced protein sequences was 5161% similar to mammalian adiponectin (Table 1
). The deduced amino acid sequence of chicken adiponectin cDNA revealed a series of 22 Gly-X-Y repeat at the N-terminal end, in which X and Y denote any amino acids. Distal to the Gly-X-Y repeats, the amino acid sequences were found to show a slightly higher degree of homology (72.1%) to the globular domain of human adiponectin protein (24). Multiple cysteine residues found in the deduced chicken adiponectin protein may aid in the formation of multimeric forms of adiponectin, as reported with mammalian adiponectin (24).
RT-PCR
A 350-bp product corresponding to nucleotides 250599 in Figure 1
was amplified from the single-stranded cDNA reverse transcribed from total RNA extracted from adipose tissue, blood, pituitary gland, diencephalon, skeletal muscle, liver, kidney, ovary, and spleen (Fig. 2
). A basic local alignment search tool (BLAST) search of the 350-bp chicken adiponectin product revealed significant homology only to mammalian adiponectin and to chicken adiponectin (GenBank accession nos. AY523637 and CD215245) and showed no homology to any other chicken genes. Adiponectin transcript could not be amplified from the blood total RNA (Fig. 2
), suggesting that blood cells do not express adiponectin gene. No-RT control samples also did not amplify any product, suggesting that genomic DNA did not contribute to amplification of the adiponectin product (data not shown).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2. RT-PCR analysis of adiponectin gene expression in various tissues in the chicken. Total RNA extracted from each tissue was DNAse-I digested and reverse transcribed. Approximately 100 ng of cDNA was used as template to amplify a 350-bp product of chicken adiponectin (nucleotides 250599 in Fig. 1 ). Each lane represents one-half of the PCR products from the following tissues: 1, molecular weight marker; 2, adipose tissue; 3, blood; 4, anterior pituitary gland; 5, diencephalon; 6, skeletal muscle; 7, liver; 8, kidney; 9, ovary; 10, spleen.
|
|
Tissue expression of chicken adiponectin cDNA
Northern blot analysis revealed a single adiponectin mRNA signal (
3.6 kb) in adipose tissue, anterior pituitary gland, liver, diencephalon, skeletal muscle, and kidney but not in the total RNA extracted from blood (Fig. 3
).

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 3. Northern blot analysis of adiponectin mRNA expression in various tissues in the chicken. Approximately 500 ng of total RNA from each tissue was probed on the Northern blot using a digoxigenin-labeled adiponectin riboprobe (corresponding to nucleotides 250599 in Fig. 1 ). After stringency washes, the hybridization signal was detected by alkaline phosphatase-conjugated anti-digoxigenin antibody and ECF chemifluorescent reagent. A, Methylene blue-stained RNA molecular weight standard. B, Northern blot of the following tissues: 1, adipose tissue; 2, anterior pituitary; 3, liver; 4, diencephalon; 5, kidney; 6, skeletal muscle; 7, blood.
|
|
Relative quantity of adiponectin mRNA in different tissues
Adipose tissue was found to contain the highest amount of adiponectin mRNA, followed by liver, pituitary gland, diencephalon, kidney, and skeletal muscle (Fig. 4
). Melting curve analyses showed the presence of a single PCR product for adiponectin and ß-actin products, confirming the specificity of the reaction (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4. Adiponectin mRNA quantity relative to ß-actin mRNA quantity in various tissues in sexually mature female chicken. Total RNA from each tissue was DNAse-I treated and reverse transcribed. Approximately 50 ng of cDNA was used in real-time quantitative PCR using SYBR Green as the dye to quantitate adiponectin mRNA or ß-actin mRNA in separate reactions. Each reaction was run in duplicate, and threshold (CT) values for adiponectin mRNA were subtracted from that of ß-actin mRNA and converted from log-linear to linear term. The data represent mean ± SEM values from three chickens for each tissue. Data with different letters above each bar represent significant difference at P < 0.05
|
|
Effect of fasting on adiponectin mRNA quantity
Fasting for 48 h resulted in a significant decrease (P < 0.05) in the adioponectin mRNA quantity in the adipose tissue, liver, and anterior pituitary gland compared with ad libitum fed chickens (Fig. 5
). A decrease in the diencephlaon adiponectin mRNA quantity was not statistically significant (P = 0.08).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 5. Effect of fasting on adiponectin mRNA expression in the chicken adipose tissue, liver, anterior pituitary gland, and diencephalon. Chickens were fed ad libitum or fasted for 48 h (n = 6) and killed by decapitation. Total RNA was extracted from each tissue and DNAse-I treated. After RT, approximately 200 ng of cDNA was used in real-time quantitative PCR using SYBR Green as the dye to quantitate adiponectin mRNA or ß-actin mRNA in separate reactions from fed and fasted chickens. Each reaction was run in duplicate, and the threshold (CT) values for adiponectin mRNA were subtracted from that of ß-actin mRNA, averaged, and converted from log-linear to linear term. Data (mean ± SE) with different letters above each bar represent significant difference at P < 0.05 between fed and the fasted state.
|
|
 |
Discussion
|
|---|
This is the first report to demonstrate adiponectin gene expression in several tissues including adipose tissue and skeletal muscle in any species. We found that the chicken adiponectin gene is expressed in adipose tissue, skeletal muscle, diencephalon, anterior pituitary gland, liver, ovary, and kidney but not in the blood cells. In support of our findings, a chicken skeletal muscle Expressed Sequence Tagged (EST) library contains a partial sequence that is similar to monkey adiponectin cDNA (GenBank accession no. CD215245). In addition, adiponectin expression has been detected recently in the human and swine skeletal muscle (25, 26). Adiponectin gene expression was inducible in human skeletal muscle cells in vitro by cell culture supernatants of HEK293 cells transfected with human adiponectin cDNA (27). A brown adipocyte cell line, T37i, was found to express adiponectin mRNA (28). Furthermore, adiponectin mRNA was found recently to be expressed in cultured murine osteoblasts and adiponectin protein secreted into the culture medium (29). The significance of adiponectin gene expression in multiple tissues in the chicken is not known at this time. We find that expression of adiponectin gene in multiple tissues in the chicken is unique and warrants additional investigation. Adiponectin produced in these tissues may supplement circulating adiponectin levels in the blood. Furthermore, adiponectin in these tissues may possibly influence carbohydrate and lipid metabolism in a paracrine or autocrine mechanism. Leptin, another adipocyte-derived hormone, is produced by multiple tissues, such as human placenta, stomach, skeletal muscle, ovary, hypothalamus, and pituitary gland (30, 31).
We determined the relative expression of adiponectin mRNA in various tissues using real-time quantitative RT-PCR and found that adipose tissue was the principal organ in which adiponectin gene is maximally expressed in the chicken as in mammals. Therefore, it is logical to expect adiponectin secretion occurring primarily from adipose tissue in the chicken. The quantities of adiponectin mRNA in other tissues was highest in the liver, followed by the anterior pituitary gland, diencephalon, kidney, and skeletal muscle. Liver is the primary site of lipid biosynthesis (22) in avian species, unlike mammals, in which fat synthesis occurs in white adipose tissue. Adiponectin expressed in the chicken liver may play a regulatory role in lipid metabolism, glucose utilization, and gluconeogenesis. In this regard, intraperitoneal adiponectin administration in mice has been found to decrease both gluconeogenic enzyme gene expression and endogenous glucose production (32).
We found that the chicken pituitary gland and diencephalon expressed greater amounts of adiponectin mRNA next to adipose tissue and liver. Other adipocyte-derived proteins, such as leptin, resistin, and adiponutrin, are expressed in both hypothalamus and anterior pituitary gland in mice (33, 34). Phenotypic identities of diencephalonic neurons or anterior pituitary gland cells that express adiponectin gene in the chicken are not known at this time. In the anterior pituitary gland, adiponectin gene may possibly be coexpressed in GH-secreting cells, based on the finding that plasma GH concentrations are inversely related to adiponectin concentrations in mice (35) and in humans (36). In addition, folliculo-stellate cells in the anterior pituitary gland may possibly express adiponectin mRNA because these cell types have been found to express several other cytokines (37). In the chicken diencephalon, adiponectin gene is possibly expressed in hypothalamic neurons that control secretion of several hormones from the pituitary gland, including GH. It is also likely that adiponectin gene expression in the chicken diencephalon may affect energy homeostasis based on the report that intracerebroventricular administration of adiponectin in mice decreased body weight by stimulating energy expenditure (17).
In the present study, food deprivation resulted in a significant decline in adiponectin mRNA quantity in adipose tissue, liver, and anterior pituitary gland, indicating that adiponectin gene expression is closely linked to energy balance in these tissues. In support of our findings, acute food deprivation decreased adiponectin gene expression in the white adipose tissue of rats (38). Similarly, subcutaneous and epididymal adipose tissue adiponectin mRNA quantity was decreased in response to fasting (39). Fasting decreases gene expression of other adipocyte proteins such as leptin (40), resistin (41), and adiponutrin (42) in the adipose tissue. Anterior pituitary gland expression of other adipose-specific cytokines was found to be affected by food restriction (34). It is likely that fasting would stimulate conservation of energy and therefore attempt to down-regulate expression of adiponectin, a hormone known to promote energy expenditure. It is also possible that a decrease in adiponectin gene expression need not necessarily mean a decrease in adiponectin protein concentration in either the adipose tissue or blood circulation. Such a discordant gene expression and protein expression data have been reported previously for leptin (43). We attempted to detect and quantitate adiponectin protein in the chicken adipose tissue and blood plasma by using an antihuman adiponectin antibody (44) without success. This is possibly due to poor homology (57%) of chicken adiponectin to human adiponectin. To address this question, we are currently making an antibody to a recombinant chicken adiponectin to detect and quantitate adiponectin in blood or in other tissues.
Adiponectin has been reported to act through two receptors (adipoR1 and adipoR2) in the mammalian species (11). We have cloned the chicken homolog of adipoR1 and adipoR2 cDNAs and found them to be expressed in blood cells, diencephalon, anterior pituitary gland, liver, skeletal muscle, spleen, and ovary (Ramachandran R., and S. Metzger, unpublished observation).
In summary, we have characterized chicken adiponectin cDNA sequence and described its unique expression in several tissues in the chicken. We also found that acute fasting significantly decreased adiponectin gene expression in adipose tissue, liver, and anterior pituitary gland. Additional studies are necessary to characterize the role of adiponectin on carbohydrate and lipid metabolism in the chicken.
 |
Acknowledgments
|
|---|
We thank Mr. Gene Krout for animal maintenance and Ms. Susan Kress for help in tissue collection.
 |
Footnotes
|
|---|
Chicken adiponectin cDNA sequence data have been submitted to the GenBank database under accession no. AY838798.
This work was supported in part by a grant from the Pennsylvania Department of Agriculture (to R.R.).
First Published Online June 23, 2005
Abbreviations: DNAse-I, Deoxyribonuclease I; No-RT control, RT reactions where reverse transcriptase was omitted.
Received March 3, 2005.
Accepted for publication June 14, 2005.
 |
References
|
|---|
- Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF 1995 A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem. 270:2674626749
- Maeda K, Okubo K, Shimomura I, Funahashi T, Matsuzawa Y, Matsubara K 1996 cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (adipose most abundant gene transcript 1). Biochem Biophys Res Commun. 221:286289
- Hu E, Liang P, Spiegelman BM 1996 AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem. 271:1069710703
- Nakano Y, Tobe T, Choi-Miura NH, Mazda T, Tomita M 1996 Isolation and characterization of GBP28, a novel gelatin-binding protein purified from human plasma. J Biochem (Tokyo). 120:803812
- Kishore U, Reid KB 1999 Modular organization of proteins containing C1q-like globular domain. Immunopharmacology 42:1521[CrossRef][Medline]
- Kishore U, Reid KB 2000 C1q: structure, function, and receptors. Immunopharmacology 49:159170[CrossRef][Medline]
- Pajvani UB, Du X, Combs TP, Berg AH, Rajala MW, Schulthess T, Engel J, Brownlee M, Scherer PE 2003 Structure-function studies of the adipocyte-secreted hormone Acrp30/adiponectin. Implications fpr metabolic regulation and bioactivity. J Biol Chem. 278:90739085
- Tsao TS, Lodish HF, Fruebis J 2002 ACRP30, a new hormone controlling fat and glucose metabolism. Eur J Pharmacol. 440:213221
- Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, Bihain BE, Lodish HF 2001 Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci USA. 98:20052010
- Kishida K, Nagaretani H, Kondo H, Kobayashi H, Tanaka S, Maeda N, Nagasawa A, Hibuse T, Ohashi K, Kumada M, Nishizawa H, Okamoto Y, Ouchi N, Maeda K, Kihara S, Funahashi T, Matsuzawa Y 2003 Disturbed secretion of mutant adiponectin associated with the metabolic syndrome. Biochem Biophys Res Commun. 306:286292
- Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T 2003 Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423:762769[CrossRef][Medline]
- Kharroubi I, Rasschaert J, Eizirik DL, Cnop M 2003 Expression of adiponectin receptors in pancreatic ß cells. Biochem Biophys Res Commun. 312:11181122
- Maeda N, Shimomura I, Kishida K, Nishizawa H, Matsuda M, Nagaretani H, Furuyama N, Kondo H, Takahashi M, Arita Y, Komuro R, Ouchi N, Kihara S, Tochino Y, Okutomi K, Horie M, Takeda S, Aoyama T, Funahashi T, Matsuzawa Y 2002 Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat Med. 8:731737
- Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB, Kadowaki T 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med. 8:12881295
- Zhu M, Miura J, Lu LX, Bernier M, DeCabo R, Lane MA, Roth GS, Ingram DK 2004 Circulating adiponectin levels increase in rats on caloric restriction: the potential for insulin sensitization. Exp Gerontol. 39:10491059
- Yamauchi T, Kamon J, Waki H, Imai Y, Shimozawa N, Hioki K, Uchida S, Ito Y, Takakuwa K, Matsui J, Takata M, Eto K, Terauchi Y, Komeda K, Tsunoda M, Murakami K, Ohnishi Y, Naitoh T, Yamamura K, Ueyama Y, Froguel P, Kimura S, Nagai R, Kadowaki T 2003 Globular adiponectin protected ob/ob mice from diabetes and ApoE-deficient mice from atherosclerosis. J Biol Chem. 278:24612468
- Qi Y, Takahashi N, Hileman SM, Patel HR, Berg AH, Pajvani UB, Scherer PE, Ahima RS 2004 Adiponectin acts in the brain to decrease body weight. Nat Med. 10:524529
- Jacobi SK, Ajuwon KM, Weber TE, Kuske JL, Dyer CJ, Spurlock ME 2004 Cloning and expression of porcine adiponectin, and its relationship to adiposity, lipogenesis and the acute phase response. J Endocrinol. 182:133144
- Tomas E, Tsao TS, Saha AK, Murrey HE, Zhang Cc C, Itani SI, Lodish HF, Ruderman NB 2002 Enhanced muscle fat oxidation and glucose transport by ACRP30 globular domain: acetyl-CoA carboxylase inhibition and AMP-activated protein kinase activation. Proc Natl Acad Sci USA. 99:1630916313
- Shklyaev S, Aslanidi G, Tennant M, Prima V, Kohlbrenner E, Kroutov V, Campbell-Thompson M, Crawford J, Shek EW, Scarpace PJ, Zolotukhin S 2003 Sustained peripheral expression of transgene adiponectin offsets the development of diet-induced obesity in rats. Proc Natl Acad Sci USA. 100:1421714222
- Brady LJ, Romsos DR, Brady PS, Bergen WG, Leveille GA 1978 The effects of fasting on body composition, glucose turnover, enzymes and metabolites in the chicken. J Nutr. 108:648657
- Leveille GA, Romsos DR, Yeh Y, OHea EK 1975 Lipid biosynthesis in the chick. A consideration of site of synthesis, influence of diet and possible regulatory mechanisms. Poult Sci. 54:10751093
- Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-

C(T)) method. Methods 25:402408[CrossRef][Medline]
- Tsao TS, Tomas E, Murrey HE, Hug C, Lee DH, Ruderman NB, Heuser JE, Lodish HF 2003 Role of disulfide bonds in Acrp30/adiponectin structure and signaling specificity. Different oligomers activate different signal transduction pathways. J Biol Chem. 278:5081050817
- Punyadeera C, Zorenc AH, Koopman R, McAinch AJ, Smit E, Manders R, Keizer HA, Cameron-Smith D, van Loon LJ 2005 The effects of exercise and adipose tissue lipolysis on plasma adiponectin concentration and adiponectin receptor expression in human skeletal muscle. Eur J Endocrinol. 152:427436
- Ding ST, Liu BH, Ko YH 2004 Cloning and expression of porcine adiponectin and adiponectin receptor 1 and 2 genes in pigs. J Anim Sci. 82:31623174
- Staiger H, Kausch C, Guirguis A, Weisser M, Maerker E, Stumvoll M, Lammers R, Machicao F, Haring HU 2003 Induction of adiponectin gene expression in human myotubes by an adiponectin-containing HEK293 cell culture supernatant. Diabetologia. 46:956960
- Viengchareun S, Zennaro MC, Pascual-Le Tallec L, Lombes M 2002 Brown adipocytes are novel sites of expression and regulation of adiponectin and resistin. FEBS Lett. 532:345350
- Berner HS, Lyngstadaas SP, Spahr A, Monjo M, Thommesen L, Drevon CA, Syversen U, Reseland JE 2004 Adiponectin and its receptors are expressed in bone-forming cells. Bone 35:842849[Medline]
- Ahima RS, Flier JS 2000 Leptin. Annu Rev Physiol. 62:413437
- Morash B, Li A, Murphy PR, Wilkinson M, Ur E 1999 Leptin gene expression in the brain and pituitary gland. Endocrinology 140:59955998[Abstract/Free Full Text]
- Combs TP, Berg AH, Obici S, Scherer PE, Rossetti L 2001 Endogenous glucose production is inhibited by the adipose-derived protein Acrp30. J Clin Invest. 108:18751881
- Morash BA, Willkinson D, Ur E, Wilkinson M 2002 Resistin expression and regulation in mouse pituitary. FEBS Lett. 526:2630
- Wiesner G, Morash BA, Ur E, Wilkinson M 2004 Food restriction regulates adipose-specific cytokines in pituitary gland but not in hypothalamus. J Endocrinol. 180:R1R6
- Berryman DE, List EO, Coschigano KT, Behar K, Kim JK, Kopchick JJ 2004 Comparing adiposity profiles in three mouse models with altered GH signaling. Growth Horm IGF Res. 14:309318
- Lam KS, Xu A, Tan KC, Wong LC, Tiu SC, Tam S 2004 Serum adiponectin is reduced in acromegaly and normalized after correction of growth hormone excess. J Clin Endocrinol Metab. 89:54485453
- Inoue K, Couch EF, Takano K, Ogawa S 1999 The structure and function of folliculo-stellate cells in the anterior pituitary gland. Arch Histol Cytol. 62:205218
- Zhang Y, Matheny M, Zolotukhin S, Tumer N, Scarpace PJ 2002 Regulation of adiponectin and leptin gene expression in white and brown adipose tissues: influence of ß3-adrenergic agonists, retinoic acid, leptin and fasting. Biochim Biophys Acta. 1584:115122
- Bertile F, Raclot T 2004 Differences in mRNA expression of adipocyte-derived factors in response to fasting, refeeding and leptin. Biochim Biophys Acta. 1683:101109
- Amstalden M, Garcia MR, Williams SW, Stanko RL, Nizielski SE, Morrison CD, Keisler DH, Williams GL 2000 Leptin gene expression, circulating leptin, and luteinizing hormone pulsatility are acutely responsive to short-term fasting in prepubertal heifers: relationships to circulating insulin and insulin-like growth factor I(1). Biol Reprod. 63:127133
- Morash BA, Ur E, Wiesner G, Roy J, Wilkinson M 2004 Pituitary resistin gene expression: effects of age, gender and obesity. Neuroendocrinology 79:149156[CrossRef][Medline]
- Baulande S, Lasnier F, Lucas M, Pairault J 2001 Adiponutrin, a transmembrane protein corresponding to a novel dietary- and obesity-linked mRNA specifically expressed in the adipose lineage. J Biol Chem. 276:3333633344
- Ranganathan S, Maffei M, Kern PA 1998 Adipose tissue ob mRNA expression in humans: discordance with plasma leptin and relationship with adipose TNF
expression. J Lipid Res. 39:724730
- Ouchi N, Kihara S, Arita Y, Okamoto Y, Maeda K, Kuriyama H, Hotta K, Nishida M, Takahashi M, Muraguchi M, Ohmoto Y, Nakamura T, Yamashita S, Funahashi T, Matsuzawa Y 2000 Adiponectin, an adipocyte-derived plasma protein, inhibits endothelial NF-
B signaling through a cAMP-dependent pathway. Circulation 102:12961301[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
G. L. Hendricks III, J. A. Hadley, S. M. Krzysik-Walker, K. S. Prabhu, R. Vasilatos-Younken, and R. Ramachandran
Unique Profile of Chicken Adiponectin, a Predominantly Heavy Molecular Weight Multimer, and Relationship to Visceral Adiposity
Endocrinology,
July 1, 2009;
150(7):
3092 - 3100.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. D. Hoyda, W. K. Samson, and A. V. Ferguson
Adiponectin Depolarizes Parvocellular Paraventricular Nucleus Neurons Controlling Neuroendocrine and Autonomic Function
Endocrinology,
February 1, 2009;
150(2):
832 - 840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. M Ocon-Grove, S. M Krzysik-Walker, S. R Maddineni, G. L Hendricks III, and R. Ramachandran
Adiponectin and its receptors are expressed in the chicken testis: influence of sexual maturation on testicular ADIPOR1 and ADIPOR2 mRNA abundance
Reproduction,
November 1, 2008;
136(5):
627 - 638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Raccurt, F. Baudimont, J. Tirard, B. Rey, E. Moureaux, A. Geloen, and C. Duchamp
Growing in Antarctica, a challenge for white adipose tissue development in Adelie penguin chicks (Pygoscelis adeliae)
Am J Physiol Regulatory Integrative Comp Physiol,
November 1, 2008;
295(5):
R1671 - R1679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Krzysik-Walker, O. M. Ocon-Grove, S. R. Maddineni, G. L. Hendricks III, and R. Ramachandran
Is Visfatin an Adipokine or Myokine? Evidence for Greater Visfatin Expression in Skeletal Muscle than Visceral Fat in Chickens
Endocrinology,
April 1, 2008;
149(4):
1543 - 1550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. K. Gabler and M. E. Spurlock
Integrating the immune system with the regulation of growth and efficiency
J Anim Sci,
April 1, 2008;
86(14_suppl):
E64 - E74.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. D. Hoyda, M. Fry, R. S. Ahima, and A. V. Ferguson
Adiponectin selectively inhibits oxytocin neurons of the paraventricular nucleus of the hypothalamus
J. Physiol.,
December 15, 2007;
585(3):
805 - 816.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Chabrolle, L. Tosca, and J. Dupont
Regulation of adiponectin and its receptors in rat ovary by human chorionic gonadotrophin treatment and potential involvement of adiponectin in granulosa cell steroidogenesis
Reproduction,
April 1, 2007;
133(4):
719 - 731.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Rodriguez-Pacheco, A. J. Martinez-Fuentes, S. Tovar, L. Pinilla, M. Tena-Sempere, C. Dieguez, J. P. Castano, and M. M. Malagon
Regulation of Pituitary Cell Function by Adiponectin
Endocrinology,
January 1, 2007;
148(1):
401 - 410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Jacobi, N. K. Gabler, K. M. Ajuwon, J. E. Davis, and M. E. Spurlock
Adipocytes, myofibers, and cytokine biology: New horizons in the regulation of growth and body composition
J Anim Sci,
April 1, 2006;
84(13_suppl):
E140 - E.
[Abstract]
[Full Text]
[PDF]
|
 |
|