help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0150
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
146/10/4399    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dufresne, A. M.
Right arrow Articles by Smith, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dufresne, A. M.
Right arrow Articles by Smith, R. J.
Endocrinology Vol. 146, No. 10 4399-4409
Copyright © 2005 by The Endocrine Society

The Adapter Protein GRB10 Is an Endogenous Negative Regulator of Insulin-Like Growth Factor Signaling

Aimee M. Dufresne and Robert J. Smith

Endocrinology Division and the Hallett Center for Diabetes and Endocrinology, Rhode Island Hospital, Brown Medical School, Providence, Rhode Island 02903

Address all correspondence and requests for reprints to: Robert J. Smith, M.D., The Hallett Center for Diabetes and Endocrinology, Rhode Island Hospital, One Hoppin Street, Suite 200, Providence, Rhode Island 02903. E-mail: rsmith4{at}lifespan.org.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The growth factor IGF-I is critical for normal human somatic growth and development. Growth factor receptor-bound protein (Grb)10 is a protein that interacts with the IGF-I receptor and may thus regulate IGF-I-stimulated growth. However, the role of endogenous Grb10 in regulating IGF-I action is not known. The objective of this study was to determine the function of endogenous Grb10 in IGF signaling responses. Using small interfering RNA, we demonstrate that knockdown of Grb10 enhances IGF-I-mediated phosphorylation of insulin receptor substrate proteins, Akt/protein kinase B, and ERK1/2 and leads to a corresponding increase in DNA synthesis. Although IGF-I receptor autophosphorylation normally correlates with receptor signaling, we demonstrate a decrease in IGF-I-stimulated receptor phosphorylation in Grb10 knockdown cells. Pretreatment of cells with the protein-tyrosine phosphatase inhibitor pervanadate partially reverses this effect of Grb10 knockdown on receptor phosphorylation, indicating that endogenous Grb10 may block phosphatase access to the activated IGF-I receptor. Marked small interfering RNA knockdown of Grb10 does not result in increased or decreased expression of the related proteins Grb7 or Grb14. As further evidence for Grb10 functional specificity, the recently identified Grb10 interacting GYF proteins are shown to interact specifically with Grb10 and not with Grb7 or Grb14, using yeast two-hybrid assays. We conclude that Grb10 functions as a specific endogenous suppressor of IGF-I-stimulated cell signaling and DNA synthesis. Modulation of the Grb10-IGF-I receptor pathway may represent a mechanism that regulates IGF-I-responsive cell and tissue growth.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SIGNALING THROUGH THE IGF-I receptor tyrosine kinase regulates normal growth and development both at the tissue and organismal levels (1). IGF-I receptor activation in response to IGF-I or IGF-II triggers mitogenic as well as antiapoptotic responses. Under some circumstances, the IGF-I receptor also participates in cellular differentiation, regulation of cell size, transformation, and motility (2). Augmented signaling through the IGF-I receptor is linked to overgrowth in disorders such as pituitary giantism and acromegaly (3). Increased IGF-I receptor signaling also contributes to tumor growth in prostate, breast, and other IGF-I responsive cancers (1). Conversely, insufficient IGF-I-mediated signaling is associated with dwarfism in humans (4, 5).

Hormone binding to the IGF-I receptor stimulates receptor autophosphorylation on tyrosine residues and recruitment of signaling mediators such as the insulin receptor substrate (IRS) proteins and Shc to the activated receptor. IGF-I receptor-mediated phosphorylation of these molecules activates signaling through the MAPK and phosphatidylinositol 3 kinase pathways, which orchestrate the downstream biological effects of IGF-I and IGF-II (1). After ligand binding, the activated IGF-I receptor interacts not only with the IRS and Shc tyrosine kinase substrates but also with the protein designated growth factor receptor-bound protein (Grb)10, which belongs to a family of adapter molecules including Grb7 and Grb14 (6, 7, 8, 9, 10). The members of this protein family contain C-terminal src-homology 2 (SH2) and between pleckstrin-homology and SH2 (BPS) domains involved in binding to receptor tyrosine kinases such as the insulin receptor and the IGF-I receptor. Grb7, Grb10, and Grb14 also have one or more N-terminal proline-rich motifs that may link other proteins to tyrosine kinase receptors. There is evidence that Grb10 can regulate insulin receptor and IGF-I receptor signaling through its interaction with the intracellular portion of these receptors as well as additional nonreceptor proteins (11). Previously in our laboratory, the N terminus of murine Grb10 was shown by yeast two-hybrid cloning to interact with two novel proline motif binding proteins, designated Grb10-interacting GYF (GIGYF) protein 1 and GIGYF2. Studies on GIGYF1 have shown that it becomes linked to activated IGF-I receptors via the Grb10 adapter and, when overexpressed, can augment IGF-I signaling (12).

Conflicting reports have been published on whether Grb10 serves as a positive or negative regulator of insulin and IGF-I signaling (13). Recently two groups published findings on Grb10 that are based on disruption of Grb10 expression as opposed to overexpression, which was used in many previous investigations. In one study, small interfering (si)RNA knockdown of Grb10 in HeLa cells overexpressing insulin receptors suggested that endogenous Grb10 inhibits insulin signaling (14). Another group demonstrated that disruption of Grb10 in mice causes embryonic and placental overgrowth plus increased glycogen deposition in the liver (15). Whereas this result strongly implicates endogenous Grb10 as a powerful growth inhibitor, the knockout mouse data do not provide insight into the mechanism underlying the observed overgrowth and do not identify the receptor(s) responsible for this phenotype. Additionally, in the knockout mice, it is difficult to distinguish between effects of potential Grb10-mediated developmental changes and those resulting from altered signaling in intact tissues.

Because the IGF-I pathway is important for embryonic and postnatal growth (1), studying the effects of endogenous Grb10 on IGF-I signaling is critical for understanding the mechanism underlying the overgrowth of Grb10 knockout mice and, ultimately, the normal physiological functions of Grb10. As an approach to defining the role of Grb10 in IGF-I signaling at a molecular level, we report in this study the effects of siRNA knockdown of Grb10 levels in NIH-3T3 cells. We demonstrate that decreasing Grb10 below normal endogenous levels results in augmented IGF-I activation of IRS proteins, Akt/PKB [also called protein kinase B (PKB)], and ERK1/2, with an associated increase in IGF-I-mediated DNA synthesis. Thus, endogenous Grb10 serves as a significant inhibitor of postreceptor IGF-I signaling responses. In contrast to its inhibition of tyrosine phosphorylation of IGF-I receptor substrates, we demonstrate that endogenous Grb10 preserves IGF-I receptor tyrosine phosphorylation by inhibiting the effects of protein tyrosine phosphatases on activated receptors. Despite these effects of Grb10 on IGF-I-mediated responses, knockdown of endogenous Grb10 does not result in adaptive changes in expression of Grb7 or Grb14. We provide yeast two-hybrid assay results demonstrating that GIGYF proteins interact specifically with Grb10, compared with other Grb7 family members, suggesting a mechanism by which Grb10 may exert distinct influences on cellular function.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Grb10 siRNA constructs
The pSilencer 2.0-U6 and 2.1-U6 hygro vectors were obtained from Ambion (Austin, TX). Four separate Grb10-targeting oligos were designed and verified by BLAST search to lack sequence homology to genes other than Grb10. The oligos were annealed and ligated into the BamHI and HindIII sites of pSilencer 2.0-U6 according to the manufacturer’s protocol. Plasmids encoding the hairpin inserts were propagated in DH5{alpha} cells (Invitrogen, Carlsbad, CA), and correct inserts were confirmed by bidirectional sequencing. Each of the siRNA constructs was cotransfected into NIH-3T3 cells together with the puromycin resistance vector pBABE-Puro (provided by Dr. Danielle Guardavaccaro, New York University, New York, NY) because the original vector (pSilencer 2.0-U6) used for screening of Grb10 siRNA constructs did not carry an antibiotic resistance marker. Cells were selected in puromycin and screened for Grb10 knockdown by immunoblotting. The Grb10 siRNA construct providing maximum knockdown targeted nt 1094–1114 as designated in mouse Grb10{alpha} (AAGTCACTGTGTGGATGACAA) (16). The oligos (sense 5'-GATCCCGTCACTGTGTGGATGACAATTCAAGAGATTGTCATCCACACAGTGACTTTTTTGGAAA-3' and antisense 5'-AGCTTTTCCAAAAAAGTCACTGTGTGGATGACAATCTCTTGAATTGTCATCCACACAGTGACGG-3') used to generate this pSilencer 2.0 construct were then annealed and ligated into the BamHI and HindIII sites of pSilencer 2.1-U6 hygro according to the manufacturer’s instructions and used for generation of stable cell lines.

Stable transfection of NIH-3T3 cells
NIH-3T3 cells were obtained from American Type Culture Collection (Manassas, VA) and maintained in DMEM (Life Technologies, Inc., Grand Island, NY) containing 4 mM L-glutamine, 4.5 g/liter glucose, and 1.5 g/liter sodium bicarbonate and supplemented with 10% bovine calf serum (Life Technologies). At 50–60% confluence, NIH-3T3 cells were transfected with pSilencer hygro/siRNA constructs using Fugene6 (Roche, Indianapolis, IN), according to the manufacturer’s protocol. After 48 h, cells were transferred to media containing 200 µg/ml hygromycin B to select for transfected cells. After 2 wk of hygromycin selection, surviving cells were maintained as a transfected pool, and a portion of these cells was plated for isolation of stable clones. Established stable lines were maintained in complete medium for NIH-3T3 cells (described above) supplemented with 100 µg/ml hygromycin B.

Immunoprecipitation and immunoblotting
Transfected NIH-3T3 cells expressing pSilencer hygro/control siRNA (lacking sequence homology with known mouse genes) or pSilencer hygro/Grb10 siRNA constructs were incubated overnight in serum-free DMEM-H (4.5 g/liter glucose) containing 0.5% BSA and 25 mM HEPES. Where indicated, cells were pretreated with 1 µM pervanadate for 15 min. Pervanadate stock solution (0.5 mM) was prepared by combining 0.5 mM sodium orthovanadate with hydrogen peroxide at a final concentration of 2.7 mM and incubating for 5 min at room temperature before excess hydrogen peroxide was removed by adding 260 U/ml catalase. Cells were incubated with 10–7 M IGF-I (GroPep, Adelaide, Australia) unless otherwise noted, for the indicated duration at 37 C before harvest. After treatment with pervanadate and/or IGF-I, cells were washed with ice-cold buffer [137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 0.1 mM Na2VO4, 20 mM Tris-HCl (pH 7.6)] and lysed in the same buffer supplemented with 1% Nonidet P-40, 10% glycerol, 2 mM EDTA, 10 mM NaF, 10 mM sodium pyrophosphate, 2 mM Na2VO4, 2 mM phenylmethylsulfonyl fluoride, and 8 µg/ml leupeptin. Cell lysates were clarified by centrifugation, and protein concentration was determined by protein assay (Bio-Rad Laboratories, Hercules, CA). Cell lysates were used for immunoprecipitation or 50–60 µg of protein per sample were analyzed directly by SDS-PAGE.

Samples used for IGF-I receptor, IRS, Grb10, Grb7, Grb14, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) analyses were run on 7.5% gels, whereas 10 or 12.5% gels were used for ERK1, ERK2, and Akt/PKB experiments. Immunoprecipitation and/or blotting was performed using specific antibodies from the following sources: anti-GAPDH (Ambion), anti-Grb7 (Transduction Laboratories, Lexington, KY), anti-Grb14 (Chemicon, Temecula, CA), anti-IRS1 (Upstate Biotechnology, Lake Placid, NY), anti-IRS-2 (Upstate Biotechnology), anti-Erk1 (Transduction Laboratories), and anti-Akt/PKB (Cell Signaling Technology, Beverly, MA). The polyclonal anti-IGF-I receptor antibody used to measure IGF-I receptor content was kindly provided by Dr. Kenneth Siddle (Cambridge University, Cambridge, UK). Grb10 content was assessed using a polyclonal anti-Grb10 SH2 domain antibody produced in our laboratory (6). Tyrosine phosphorylation of the IGF-I receptor and IRS proteins was measured using antibodies specific for phosphotyrosine (PY20; Transduction Laboratories; or 4G10; Upstate Biotechnology) or phospho-IGF-I receptor (pY1158; BioSource, Camarillo, CA), as indicated in the figure legends. Phosphorylation of ERK1 and ERK2 was measured using anti-ACTIVE MAPK antibody (Promega, Madison, WI), and phosphorylated Akt/PKB was measured using antiphospho-Akt/PKB (Thr308) or (Ser473) (Cell Signaling Technology). Specific protein bands were identified using chemiluminescence (PerkinElmer, Boston, MA) and quantified on a densitometer.

[3H]Thymidine incorporation
Transfected cells were plated at 2.5 x 104 cells/well in 24-well plates and incubated for 24 h. Complete medium for NIH-3T3 cells (described above) supplemented with 100 µg/ml hygromycin B was replaced by serum-free medium (described above), and after 26 h, the cells were placed in fresh depletion medium with or without IGF-I at 10–7 M and incubated for 13–15 h. [3H]Thymidine (1 µCi/well) was added for 2 h, and at the end of this pulse, precipitated cell extracts were obtained by 5 min incubation with 5% trichloroacetic acid, washed with methanol, and dissolved in 0.3 N NaOH. [3H]Thymidine content of the resulting lysates was determined by liquid scintillation counting.

Yeast strains and plasmids
The Saccharomyces cerevisiae yeast strain EGY48 (p8opLacZ), the vectors pGilda and pB42AD, and control plasmids were obtained from the MATCHMAKER LEXA two-hybrid system (Clontech, Palo Alto, CA). Fragments of GIGYF1 (clone e49) and GIGYF2 (clone ta11), obtained from mouse embryonic and TA-1 mouse fat cell libraries by yeast two-hybrid cloning with Grb10 as described previously (12) were subcloned into pGilda to produce in-frame fusions with the LexA DNA binding domain. The N-terminal portion of murine Grb14 was amplified from a full-length cDNA, provided by Dr. Pam Maher (Scripps Research Institute, La Jolla, CA) using the sense primer 5'-CCGGAATTCATGACCACGTCCCTGCAAG-3' and the antisense primer 5'-CCGGAGCTCCTAGTCCAGCTGTTGTCGTCCAC-3'. The PCR product was subcloned into the EcoRI and BamHI sites of pB42AD to produce an in-frame fusion with the Escherichia coli B42 activation domain. pB42AD and pGilda carry the inducible GAL1 promoter, allowing for transcriptional repression in the presence of glucose and activation by galactose.

Yeast protein interaction assays
Yeast previously transformed with the p8opLacZ plasmid were cotransformed with the indicated constructs using the small-scale lithium acetate procedure described by Clontech. The desired transformants were identified by plating on standard dropout (SD) medium containing glucose to suppress activation domain fusion protein expression but lacking uracil, tryptophan, and histidine to maintain selective pressure on each plasmid introduced.

Colonies representing four independent clones were selected for each transformant type and resuspended in 20 µl water. Suspended cells were dropped onto plates containing SD medium, 2 g/dl galactose, and 80 mg/liter X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) but lacking uracil, tryptophan, histidine, and leucine. Control plates contained 2 g/dl glucose in place of galactose. Plates were incubated overnight at 30 C. Liquid assays were performed using o-nitrophenyl ß-D-galactopyranoside as the ß-galactosidase substrate, according to the Clontech protocol. Yeast transformants were cultured overnight in SD medium containing glucose but lacking uracil, tryptophan, and histidine. Activation domain fusion protein induction was induced by culturing cells in SD medium containing galactose but lacking uracil, tryptophan, and histidine. LacZ reporter activation was evaluated by reading the OD420 after cell lysis and incubation with the substrate.

To confirm fusion protein expression, yeast cells cotransformed with the plasmids of interest were grown to saturation in SD medium containing glucose but lacking uracil, tryptophan, and histidine. Cells then were washed and grown for 20 h in SD induction medium containing galactose and raffinose but lacking uracil, tryptophan, and histidine. Yeast protein extracts were prepared using the urea/sodium dodecyl sulfate method described by Clontech. Fusion protein expression was confirmed by immunoblotting with anti-hemagglutinin (HA) or anti-LexA antibodies (Clontech) recognizing the activation domain and DNA binding domain fusion proteins, respectively.

Statistical analysis
Unless otherwise noted in the figure legend, data were analyzed in the SAS system (SAS Institute, Cary, NC) using mixed ANOVAs with group (control vs. Grb10 knockdown) and replicate as fixed factors and cell line as a random factor. Mann-Whitney rank sum and two-tailed t tests were performed using SigmaStat (Systat Software, Richmond, CA). Graphs represent arithmetic means ± SE, normalized to controls as indicated for each figure.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Endogenous Grb10 knockdown increases postreceptor IGF-I signaling
Prior studies on the impact of Grb10 on IGF-I responses have relied on overexpression techniques, which do not provide reliable insight into the actions of normal cellular levels of Grb10. To investigate the function of endogenous Grb10, a sequence spanning residues 1094–1114 as designated in mouse Grb10{alpha} (16) was targeted using siRNA. In this region, there is 100% sequence identity in all full-length mouse and human Grb10 isoforms (17), such that a single siRNA construct should decrease the levels of all full-length forms of Grb10 mRNA. Hairpin-encoding oligonucleotides corresponding to this Grb10 target sequence or a control siRNA were cloned into the pSilencer 2.1-U6 hygro vector and stably transfected into NIH-3T3 cells, and multiple individual clones or a stable pool of transfected cells was analyzed.

Stable expression of the pSilencer/Grb10 siRNA construct in NIH-3T3 cells resulted in a marked (~80%) decrease in Grb10 protein levels (Fig. 1Go, A and B). This was confirmed by examining multiple clones as well as a pool of cells stably transfected with Grb10 siRNA. Conversely, expression of the pSilencer 2.1-U6 hygro control vector did not alter Grb10 expression levels relative to wild-type NIH-3T3 cells (data not shown). Three prominent protein bands were detected by immunoblotting with anti-Grb10 antibody, as previously observed in other cell types (9, 16), and all three bands were inhibited to a similar extent by Grb10 siRNA expression. The faint residual protein band evident at Mr 69 in Fig. 1AGo is thought to represent a comigrating, cross-reactive protein, based on immunoblots using other Grb10 antibody preparations (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 1. siRNA-mediated knockdown of Grb10 protein levels. Cells were stably transfected with the pSilencer hygro vector containing either a control insert (encoding a hairpin siRNA, which lacks sequence homology with any other murine gene) or the Grb10 siRNA construct shown to exhibit the most potent knockdown effect in transient transfection experiments. A, Cell lysates obtained from independent stable clones or pools of transfected cells were used for immunoblotting with anti-Grb10 antibody. The membrane was consecutively probed with anti-GAPDH antibody to confirm even loading. The approximate molecular weight of each protein band is indicated. The cell line used to generate each sample is noted in parentheses above each lane. A single exposure is shown for all samples, which were analyzed on the same immunoblot for comparison. The selected exposure provides information on the relative amounts of protein present in each lane because the darkest bands are not overexposed to a level outside the linear range of the image detection system. B, Quantitative densitometric analysis of the uppermost Grb10 band from two independent stable clones and a stably transfected pool of cells, with each result normalized for GAPDH content. Relative units were determined by normalizing each individual value to a mean control value of 100 within each experiment. Data plotted are arithmetic means ± SE. Mixed ANOVA showed that the level of Grb10 was higher in controls than Grb10 knockdown cell lines (*, P < 0.001). This quantification includes data from all three control and all three Grb10 knockdown cell lines, each measured in two independent experiments. C, Cell lysates were used for immunoblotting with anti-Grb7 or anti-Grb14 antibodies. Membranes were consecutively probed with anti-GAPDH antibody to confirm even loading. The cell line used to generate each sample is noted in parentheses above each lane.

 
To determine whether inhibition of Grb10 expression results in compensatory elevation in the expression level of another Grb7 adapter family member (Grb7 or Grb14), immunoblotting was performed using antibodies specific for each of these proteins. As shown in Fig. 1CGo, Grb10 siRNA expression and the resulting marked decrease in Grb10 protein abundance do not significantly influence the protein level of either Grb7 or Grb14. Although one Grb10-deficient cell line (clone F10–2) expressed a relatively low level of both Grb7 and Grb14, this is assumed to represent a clonal property and not an effect of the Grb10 siRNA construct because the other Grb10 knockdown cell lines did not show the same effect. Furthermore, some of the variation observed between cell lines for content of Grb7, Grb14, and GAPDH may be due to the analysis of lysates from three independent harvests (including G12–1 and F10–2; C10–3 and C11–5; and stable pool B cell lines) on a single immunoblot.

After documentation of the effectiveness of Grb10 knockdown, IGF-I-mediated signaling responses were compared in NIH-3T3 cells expressing control or Grb10 siRNA constructs. NIH-3T3 cells have been shown to contain approximately 9 x 103 IGF-I receptors per cell, whereas insulin receptor content in these cells is not detectable by equilibrium insulin binding assays (18). Because NIH-3T3 cells are expected to signal through the IGF-I receptor and not the insulin receptor in response to IGF-I or high-dose insulin, 10–7 M IGF-I was used to achieve maximal IGF-I receptor activation. In response to IGF-I, the level of IRS phosphorylation is approximately 187% higher in Grb10 knockdown cells than control cells (P < 0.01) (Fig. 2Go, A and B). This elevated level of IRS phosphorylation was observed in the basal state and at IGF-I doses as low as 10–10 M in two independent Grb10 knockdown cell lines (supplemental Fig. 1 published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org). There was a statistically significant increase in IRS phosphorylation in Grb10-deficient cells in the basal state as determined by a two-tailed t test comparison (P < 0.05, data not included). As shown in Fig. 2CGo, IRS phosphorylation appeared to be elevated at multiple time points, beginning as early as 1 min, and extending to 60 min. Although this result was less clear based on band intensity in a repeat experiment using different cell lines, the slight upward mobility shift in IRS bands in Grb10 knockdown lanes at 2, 5, and 60 min suggests an increased level of IRS phosphorylation in these samples (supplemental Fig. 2). Both IRS2 and IRS1 are expressed in NIH-3T3 cells, as shown in Fig. 2AGo and supplemental Fig. 3, respectively. Because these two IRS proteins are not resolved on phosphotyrosine immunoblotting, sequential immunoprecipitation and blotting were performed to analyze the relative contribution of IRS1 and IRS2 to the observed increase in IRS phosphorylation. As shown in Fig. 3AGo and supplemental Fig. 4, IRS1 phosphorylation was higher in the Grb10 knockdown cell line than in the control after a 5-min IGF-I stimulation, and this result was confirmed in a total of four independent experiments. IRS2 produced a weaker signal than IRS1 in these experiments, and increased IRS2 phosphorylation was observed only in Grb10 knockdown cells in one of three experiments (Fig. 3AGo and supplemental Fig. 4). In some experiments, an elevation of IRS1 and IRS2 phosphorylation was observed in the basal state for Grb10 knockdown cells in comparison with controls. This difference was statistically significant for IRS1 (P < 0.05, as determined by the Mann-Whitney rank sum test; data not shown) but not for IRS2.



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 2. IRS phosphorylation in control and Grb10-deficient cells. Control and Grb10 knockdown cells were treated with IGF-I for the length of time indicated, and cell lysates were used for immunoprecipitation and/or immunoblotting. A, Phosphorylation of IRS was assessed in three control and three Grb10-deficient cell lines using PY20 (antiphosphotyrosine antibody). B, IGF-I-stimulated IRS phosphorylation was quantified by densitometry using three control and three Grb10 knockdown cell lines in replicate 1. Two controls (G12–1 and C10–3) and two Grb10 knockdown cell lines (F10–2 and C11–5) were each measured for replicate 2, and one control (G12–1) and one Grb10 knockdown cell line (C11–5) were measured for replicate 3. Relative units were determined by normalizing each individual value to a mean control value of 100 within each experiment. Data plotted are arithmetic means ± SE. Mixed ANOVA showed that IRS phosphorylation was higher in Grb10 knockdown cell lines than controls (*, P < 0.01). C, IRS phosphorylation was assessed in one control (clone G12–1) and one Grb10 knockdown cell line (clone C11–5) using PY20 (antiphosphotyrosine) antibody.

 


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 3. IRS1 and IRS2 phosphorylation in control and Grb10 knockdown cells. A, Pools of cells stably expressing either a control or Grb10 siRNA construct were treated with IGF-I for 0 or 5 min. Cell lysates (500 µg) were used for immunoprecipitation with IRS1 antibody (top panel) or IRS2 antibody (bottom panel) and blotted with PY20 (antiphosphotyrosine) antibody. B, IGF-I-stimulated IRS1 and IRS2 phosphorylation in stable pools of cells transfected with a control or Grb10 siRNA construct, was quantified by densitometry. Samples obtained in four independent experiments for IRS1 and three experiments for IRS2 were analyzed as described in A. Relative units were determined by normalizing each individual value to a control value of 100 within each experiment. Data plotted are arithmetic means ± SE. Black bars represent control values and white bars represent Grb10 knockdown values. The Mann-Whitney rank sum test showed a significant increase in IRS1 phosphorylation in Grb10 knockdown cells in comparison to controls (*, P < 0.05) but no significant difference in IRS2 phosphorylation between knockdown and control cell lines (P > 0.05).

 
To examine the effects of Grb10 knockdown on a signaling pathway immediately consequent to IRS activation, the level of activated Akt/PKB was determined by immunoblotting with phospho-specific Akt/PKB antibodies. Grb10 knockdown resulted in enhanced IGF-I-mediated Akt/PKB phosphorylation at Thr308 relative to control cells (93% increase, P < 0.05) (Fig. 4Go, A and B). Immunoblotting with an antibody recognizing total Akt/PKB confirmed an increase in Akt/PKB activation in the absence of a change in Akt/PKB content (Fig. 4AGo, lower panel). As shown in Fig. 4CGo and supplemental Fig. 5, the increase in Akt/PKB (Thr308) phosphorylation was observed at 5, 10, 20, and 30 min after IGF-I treatment. The time points at which a Grb10 knockdown-specific effect was detected varied slightly among different cell lines and experiments. The 30-min time point, at which the most reproducible effect was observed, was used for quantification. In addition to phosphorylation at Thr308, Akt/PKB phosphorylation at Ser473 was evaluated. In contrast to Thr308, which showed enhanced phosphorylation in Grb10-deficient cells after IGF-I stimulation, the level of Ser473 phosphorylation was approximately equal in Grb10 knockdown and control cells after 5 or 30 min IGF-I treatment (Fig. 4DGo). The slight elevation of Ser473 phosphorylation in Grb10-deficient cells in the basal state was not observed in subsequent experiments.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 4. Phosphorylation of Akt/PKB in control and Grb10-deficient cells. Control and Grb10 knockdown cells were treated with IGF-I for the length of time indicated and cell lysates were used for immunoblotting. A, Activated Akt/PKB was detected in three control and three Grb10-deficient cell lines using phospho-Akt/PKB (Thr308) antibody. B, IGF-I-stimulated Akt/PKB (Thr308) phosphorylation from three control and three Grb10 knockdown cell lines, each analyzed in two independent experiments, was quantified by densitometry. Relative units were determined by normalizing each individual value to a mean control value of 100 within each experiment. Data plotted are arithmetic means ± SE. Mixed ANOVA showed that Akt/PKB phosphorylation was higher in Grb10 knockdown cell lines than controls (*, P < 0.05). C, Akt/PKB phosphorylation was assessed in one control (clone C10–3) and one Grb10 knockdown cell line (clone F10–2) using anti-phospho-Akt/PKB (Thr 308) antibody. D, Akt/PKB phosphorylation was assessed in pools of cells stably expressing either a control or Grb10 siRNA construct using anti-phospho-Akt/PKB (Ser 473) antibody. This result is representative of that obtained in three independent experiments.

 
As an alternative postreceptor signaling pathway that may be linked to receptor activation through IRS-dependent or IRS-independent mechanisms (19), ERK1 and ERK2 activation was assessed with phospho-specific antibodies. As shown in Fig. 5Go, IGF-I stimulation of ERK1 and ERK2 is increased after Grb10 knockdown. At the 5-min time point after IGF-I stimulation, there was a 357% increase in ERK1 phosphorylation (P < 0.01 vs. control) and a 392% increase in ERK2 phosphorylation (P < 0.05 vs. control) without changes in total ERK1/2 abundance. As with Akt/PKB (Thr308), the time course results for ERK1/2 activation varied slightly among different cell lines and experiments (e.g. see supplemental Fig. 6). However, inclusion of the data from all experiments at the 5-min time point, without exclusion of data from experiments with a later peak IGF-I effect, demonstrated a highly significant increase in ERK1/2 phosphorylation as a consequence of Grb10 knockdown.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 5. ERK1/2 phosphorylation in control and Grb10-deficient cells. Control and Grb10 knockdown cells were treated with IGF-I for the length of time indicated, and cell lysates were used for immunoblotting. A, Phosphorylated ERK1 and ERK2 were detected in three control and three Grb10-deficient cell lines using anti-ACTIVE MAPK antibody. B, IGF-I-stimulated ERK1 and ERK2 phosphorylation was quantified by densitometry. For ERK1, data from three control and three Grb10 knockdown cell lines were obtained for replicate 1. Two controls (G12–1 and stable pool B control) and two Grb10 knockdown cell lines (C11–5 and stable pool B) were analyzed for replicate 2, and one control (C10–3) and one Grb10 knockdown (C11–5) cell line were analyzed for replicate 3. For ERK2, data from three control and three Grb10 knockdown cell lines were obtained for replicate 1. Two controls (G12–1 and C10–3) and two Grb10 knockdown cell lines (C11–5 and F10–2) were analyzed for replicate 2, and one control (G12–1) and one Grb10 knockdown (C11–5) cell line were analyzed for replicate 3. Relative units were determined by normalizing each individual value to a mean control value of 100 within each experiment. Data plotted are arithmetic means ± SE. Black bars represent control values, and white bars represent Grb10 knockdown values. Mixed ANOVA showed that ERK1 phosphorylation was higher in Grb10 knockdown cell lines than controls (*, P < 0.01). Mixed ANOVA showed that ERK2 phosphorylation was higher in Grb10- deficient cell lines than controls (**, P < 0.05). C, ERK1 and ERK2 phosphorylation was assessed in one control (clone G12–1) and one Grb10 knockdown cell line (clone C11–5) using anti-ACTIVE MAPK antibody.

 
Grb10 knockdown results in augmented IGF-I-mediated DNA synthesis
Because an important action of IGF-I is the stimulation of mitogenesis, the effect of Grb10 knockdown on DNA synthesis was measured using [3H]thymidine incorporation. In control cells, stimulation with IGF-I in the absence of serum or other growth factors resulted in a significant (P < 0.05) but small (~6%) increase in [3H]thymidine incorporation above the basal (unstimulated) level (Fig. 6Go). Decreased levels of Grb10 in the siRNA knockdown cells resulted in an approximately 4-fold higher level of IGF-I-stimulated [3H]thymidine incorporation than in control cells.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 6. DNA synthesis in Grb10 knockdown and control cells. Control and Grb10 knockdown cells were incubated with or without IGF-I for 15–17 h. During the last 2 h of the incubation, cells were pulsed with [3H]thymidine. trichloroacetic acid-precipitable cpm were determined by scintillation counting in stably transfected pools of control and Grb10 knockdown cells in four independent experiments normalized as percent of control. Data are means [expressed as percent above basal (unstimulated) level] ± SE, subjected to a Mann-Whitney rank sum test for comparison between control cells incubated with or without IGF-I for 2 h (*, P < 0.05) or subjected to a two-tailed t test for comparison between control and Grb10 knockdown samples (**, P < 0.05).

 
IGF-I-stimulated receptor phosphorylation is decreased after Grb10 knockdown
IGF-I-mediated increases in IRS, Akt/PKB, and ERK1/2 phosphorylation as well as augmented DNA synthesis responses are initiated by phosphorylation events at the level of the activated IGF-I receptor tyrosine kinase. Therefore, IGF-I receptor phosphorylation was compared in control and Grb10 knockdown cells. As anticipated, a significant increase in IGF-I receptor phosphorylation was observed in control cells after IGF-I treatment (Fig. 7Go). In contrast to postreceptor signaling responses, Grb10 knockdown cells exhibited approximately 50% lower IGF-I-stimulated receptor phosphorylation levels than control cells (P < 0.0001), despite similar receptor content in control and knockdown cells. As shown in supplemental Fig. 1, this result was observed at multiple doses of IGF-I, and using antiphosphotyrosine antibodies such as PY20 and 4G10, which detect overall levels of tyrosine phosphorylation and are not site specific for the IGF-I receptor. The relatively low level of IGF-I receptor phosphorylation in Grb10-deficient cells was also observed at multiple time points, including 1 min and extending to 60 min (Fig. 7CGo and supplemental Fig. 7).



View larger version (46K):
[in this window]
[in a new window]
 
FIG. 7. IGF-I receptor (IGF-IR) phosphorylation (PY) in control and Grb10 knockdown cells. Control and Grb10 knockdown cells were treated with IGF-I for the length of time indicated, and cell lysates were used for immunoblotting. A, Phosphorylation of the IGF-I receptor was assessed in three control and three Grb10 knockdown cell lines using a phospho-specific IGF-I receptor antibody. B, IGF-I-stimulated IGF-I receptor phosphorylation from three control and three Grb10 knockdown cell lines, each measured in two independent experiments, was quantified by densitometry. Relative units were determined by normalizing each individual value to a mean control value of 100 within each experiment. Data plotted are arithmetic means ± SE. Mixed ANOVA showed that IGF-I receptor phosphorylation was lower in Grb10 knockdown cell lines than controls (*, P < 0.0001). C, IGF-I receptor phosphorylation was assessed in one control (clone G12–1) and one Grb10 knockdown cell line (clone C11–5) using a phospho-specific IGF-I receptor antibody.

 
To investigate the mechanism responsible for decreased IGF-I receptor tyrosine phosphorylation after Grb10 knockdown, cells were pretreated for 15 min with 1 µM pervanadate, a phosphate analog and general inhibitor of protein tyrosine phosphatases (20). In the basal state (i.e. in the absence of IGF-I), there was little or no detectable IGF-I receptor phosphorylation without or with pervanadate treatment (Fig. 8AGo and supplemental Fig. 8, lanes 1–4). In cells treated with IGF-I in the absence of pervanadate, Grb10 knockdown resulted in a 47% decrease in IGF-I receptor phosphorylation, compared with control cells (Fig. 8AGo and supplemental Fig. 8, lanes 5 and 6, and Fig. 8BGo, left bar). By contrast, Grb10 knockdown resulted in only a 25% decrease in IGF-I receptor phosphorylation in cells pretreated with pervanadate (Fig. 8AGo and supplemental Fig. 8, lanes 7 and 8, and Fig 8BGo, right bar). Thus, phosphatase inhibition by pervanadate pretreatment reversed the effect of Grb10 knockdown on IGF-I-stimulated receptor phosphorylation by approximately 50% (P < 0.01).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 8. Effect of pervanadate pretreatment in control and Grb10 knockdown cells. Cells were incubated with or without the phosphatase inhibitor pervanadate for 15 min before treatment for 0 or 5 min with IGF-I. Cell lysates were analyzed by immunoblotting. A, Phosphorylation of the IGF-I receptor was assessed in one control (G12–1) and one Grb10 knockdown cell line (F10–2) using phospho-specific IGF-I receptor antibody. B, IGF-I receptor phosphorylation (after treatment with pervanadate or IGF-I as indicated) was quantified by densitometry. Two controls (C10–3 and G12–1) and two Grb10 knockdown cell lines (C11–5 and F10–2) were measured for replicate 1, with one control and one Grb10 knockdown cell line harvested in each of two independent experiments. One control (C10–3) and one Grb10 knockdown cell line (C11–5) were measured for replicate 2. Relative units were determined by comparing the mean values obtained for IGF-I receptor phosphorylation in Grb10 knockdown cell lines (represented by black bars) treated with IGF-I and with or without pervanadate to the control value (normalized to 100 for each experiment and represented by the dotted line). Data plotted are arithmetic means ± SE, subjected to a two-tailed t test for comparison between control and Grb10 knockdown samples (*, P < 0.01).

 
The Grb10 N-terminal region binds specifically to the nonreceptor proteins GIGYF1 and GIGYF2
Grb10 exhibits the structure of an adapter molecule, and it was previously shown that the N-terminal region of Grb10 interacts with the GYF domain-containing proteins GIGYF1 and GIGYF2. Using an epitope-tagged fragment of GIGYF1, there is evidence that Grb10 forms a triple complex involving the IGF-I receptor, Grb10, and GIGYF1, and the Grb10- interacting portion of GIGYF1 modulates IGF-I signaling responses (12). Thus, the GIGYF proteins may regulate the effect of Grb10 on IGF-I signaling. Although Grb7 and Grb14 also bind to insulin and/or IGF-I receptors, at least when studied as overexpressed proteins (21, 22, 23), they do not undergo compensatory up-regulation when Grb10 levels are lowered by siRNA (see Fig. 1CGo and Ref.19). We therefore examined the specificity of Grb10 adapter functions by comparing the interactions of Grb10, Grb7, and Grb14 with GIGYF1 and GIGYF2.

A yeast two-hybrid method was used to evaluate the interaction of GIGYF1 and GIGYF2 with the individual Grb7 family proteins. For this purpose, S. cerevisiae carrying Leu2 and LacZ reporter genes were cotransformed with LexA fusion constructs expressing the GYF-containing region of GIGYF1 or GIGYF2 and the N-terminal proline-rich region of Grb10, Grb7, or Grb14 as a fusion with the E. coli peptide B42, which serves as a transcriptional activator in yeast (24). Fusion protein interactions first were examined using in vivo X-gal plate assays. As shown in Fig. 9AGo, Grb10 interacted strongly with both GIGYF1 and GIGYF2, whereas Grb7 and Grb14 interacted weakly with GIGYF1 and not with GIGYF2.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 9. Interactions of Grb7, 10, and 14 with GIGYF1 and GIGYF2 assessed using the yeast two-hybrid system. A, Results from in vivo plate assay, with each row containing samples from four independent clones. Yeast were cotransformed with constructs encoding GIGYF1 and Grb7, Grb10, or Grb14 (rows 1–3, respectively) or GIGYF2 and Grb7, Grb10, or Grb14 (rows 4–6, respectively) and plated on selective X-gal plates. The presence of dark color indicates LacZ reporter activation. B, Results from ß-galactosidase liquid (spectrophotometric) assays, normalized against the mean value obtained for positive control samples. Graph represents means ± SE obtained from three independent clones for each type of yeast transformant, assayed in duplicate or triplicate. Results for different transformants were compared using the two-tailed t test for significance. A Bonferroni correction was applied and the alpha level lowered to 0.0085 for each t test to adjust for multiple comparisons. *, P < 0.01, based on the comparison of Grb7/GIGYF1 and Grb14/GIGYF1 to Grb10/GIGYF1; **, P < 0.01, based on the comparison of Grb7/GIGYF2 and Grb14/GIGYF2 to Grb10/GIGYF2. C, Fusion protein expression in EGY48p8opLacZ yeast cells transformed with Grb10, Grb7, Grb14, or GIGYF1 or GIGYF2 constructs. Results are representative of those obtained for three independent clones.

 
Liquid-phase spectrophotometric ß-galactosidase assays were used to provide a more quantitative comparison of these interactions. Based on average ß-galactosidase units obtained with three independent clones for each type of transformant in liquid assays, Grb10 binding to GIGYF1 was approximately 30- and 15-fold higher than the interaction of GIGYF1 with Grb7 and Grb14, respectively (Fig. 9BGo). The data in Fig. 9BGo are presented as percentages of the mean obtained for positive control samples consisting of yeast cotransformants expressing murine p53 and Simian virus 40 large T antigen, which have been shown to strongly interact (25). ß-Galactosidase units calculated for both Grb7 and Grb14 binding to GIGYF2 were lower than observed with negative controls expressing a fusion of the LexA DNA binding domain with human lamin C, thus indicating an absence of binding. To determine whether differences in fusion protein expression might explain the decreased GIGYF protein binding to Grb7 and Grb14, HA-tagged Grb10/7/14 sequences and LexA/GIGYF fusion proteins were quantified by immunoblotting with HA or LexA antibodies, respectively. This confirmed similar levels of expression of the Grb10, 7, and 14 constructs (Fig. 9CGo, left panel). The modestly increased interaction of Grb10 with GIGYF1 vs. GIGYF2 (Fig. 9BGo) occurred despite a lower level of GIGYF1 expression (Fig. 9CGo, right panel), suggesting the possibility of a higher-affinity interaction of Grb10 with GIGYF1.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Two lines of evidence implicate Grb10 as a critical mediator of normal somatic growth. First, Grb10 knockout mice are approximately 30% larger at birth than wild-type littermates, suggesting that Grb10 acts as a growth inhibitor (15). The observed phenotype is not associated with overfeeding and obesity but appears to reflect a fundamental alteration in somatic growth during embryonic development. Second, gene dosage effects of Grb10 have been linked to some cases of Russell-Silver syndrome, involving prenatal and postnatal growth restriction (17, 26, 27). In addition, a Grb10 P95S N-terminal region substitution mutation has been identified in two patients with Russell-Silver syndrome (27).

The importance of IGF-I in somatic growth regulation is well established (1), and the role of Grb10 in this process is increasingly evident. However, whereas Grb10 is known to interact with the IGF-I receptor and influence IGF-I-mediated mitogenesis (7, 13, 28, 29), the role of endogenous levels of Grb10 in IGF-I signaling has not been determined. Several studies using overexpression of full-length Grb10 or Grb10 constructs assumed to function in a dominant-negative manner have suggested that Grb10 stimulates insulin signaling and metabolic responses (30) as well as IGF-I-induced mitogenesis (7, 28). By contrast, overexpression of Grb10 has also been shown to inhibit insulin signaling (14, 31, 32, 33) and IGF-I-mediated growth (13, 29). All of these studies are limited by their dependence on experimental approaches using Grb10 or Grb10 fragment overexpression. When Grb10 is overexpressed, the dynamics of its interaction with other Grb10 molecules, receptors, and downstream signaling molecules may be altered, and thus, physiologically relevant mechanisms governing the interplay between these components may not be evident.

In the current study, siRNA was used to inhibit Grb10 expression and demonstrate that interference with endogenous mGrb10 expression increases IGF-I-stimulated IRS, Akt/PKB (Thr308), and ERK1/2 activation (Figs. 2–5GoGoGoGo) as well as DNA synthesis (Fig. 6Go). It is likely that these signaling responses are mediated almost entirely by the IGF-I receptor as opposed to the insulin receptor in the context of NIH-3T3 cells, which, based on receptor content, are expected to be IGF-I but not insulin responsive (18). We have shown that the receptor proximal event of IRS phosphorylation is influenced by Grb10 knockdown at IGF-I doses as low as 10–10 M (supplemental Fig. 1), further supporting the notion that the IGF-I-induced signaling events observed in these cells are mediated by IGF-I receptors and not insulin receptors. In some but not all experiments, differences were also observed between Grb10-deficient and control cells in the basal state for IRS phosphorylation and other signaling responses. When detected, this effect is thought to be mediated by a low level of IGF-I receptor activation in response to autocrine stimulation by IGF-I or, more likely, IGF-II, which is expected to be produced by mouse embryo fibroblasts (34).

Events downstream of IRS activation are also affected by Grb10 knockdown. In the case of Akt/PKB, the level of IGF-I-stimulated phosphorylation at Thr308 is enhanced in Grb10-deficient cells in comparison with controls, at time points later than 1 min (Fig. 4CGo). This suggests that the rate of dephosphorylation but not the rate of initial phosphorylation may be altered by the removal of Grb10. In contrast to the enhanced phosphorylation at Thr308 observed in Grb10-deficient cells, phosphorylation at Ser473 is not altered by Grb10 knockdown (Fig. 4DGo). Phosphorylation at both of these sites is required for maximal Akt/PKB activation (35, 36). Gao et al. (37) suggested that whereas phosphorylation of Akt/PKB at Thr308 and Ser473 may be coordinately regulated, there may be uncoupled dephosphorylation of these sites. It has been proposed that protein phosphatase 2A (PP2A) and pleckstrin homology domain leucine-rich repeat protein phosphatase dephosphorylate Akt/PKB at Thr308 and Ser473, respectively (37). This raises the possibility that Grb10 specifically impacts the function of PP2A, or its ability to act on Akt/PKB, perhaps by affecting the subcellular localization of Akt/PKB. Jahn et al. (38) showed that Grb10 interacts with Akt/PKB and suggested that Grb10 may facilitate the translocation of Akt/PKB to the plasma membrane. Disruption of the coordinated trafficking of Grb10 and Akt/PKB to the plasma membrane or another subcellular compartment by the removal of Grb10 could impact the accessibility of Akt/PKB for site-specific dephosphorylation by PP2A. Further study will be required to elucidate the mechanistic links between Grb10 and Akt/PKB (Thr308) phosphorylation status.

In contrast to increased postreceptor signaling, the results show that IGF-I receptor tyrosine phosphorylation in Grb10 knockdown cells is lower than that in control cells. This effect is partially reversed by pervanadate pretreatment (Figs. 7Go and 8Go), indicating that the low level of receptor phosphorylation observed in Grb10-deficient cells is attributable, at least in part, to protein tyrosine phosphatase-mediated IGF-I receptor dephosphorylation. IGF-I time-course experiments show that the level of IGF-I receptor phosphorylation is lower in Grb10 knockdown cells as early as 1 min after IGF-I treatment (Fig. 7CGo). This does not, however, exclude protein tyrosine phosphatase (PTP) activity as a potential mechanism for the decrease in receptor phosphorylation because PTP activity has been demonstrated after 30 sec of insulin treatment (39). The findings presented in the current study not only are the first to demonstrate that endogenous Grb10 suppresses IGF-I-induced signaling and DNA synthesis but also represent the first evidence that Grb10 may block access of PTPs to the activated IGF-I receptor.

The data presented here on the role of Grb10 in IGF-I signaling to Akt/PKB and ERK1/2 correlate well with recently reported findings by Langlais et al. (14) on the effect of Grb10 on insulin signaling. Endogenous Grb10 has now been shown to negatively regulate signaling through both of these pathways downstream of the insulin and IGF-I receptors. Our data indicate that Grb10 may function in providing a tonic suppression of IGF-I-mediated DNA synthesis and may help to explain the mechanism underlying the overgrowth of Grb10-deficient mice. In future studies, it will be informative to investigate the effect of Grb10 on other downstream biological effects of Akt/PKB and ERK1/2 activation, including apoptosis and cell migration.

Although this is the first report on the effects of endogenous Grb10 on IRS phosphorylation, our data are consistent with the results obtained by Wick et al. (33), demonstrating that Grb10 hinders insulin signaling through phosphatidylinositol 3 kinase by directly blocking the interaction between IRS1/IRS2 and the insulin receptor. Based on these published findings, it was anticipated that increased phosphorylation of both IRS1 and IRS2 would be observed in Grb10-deficient cells in response to IGF-I treatment due to enhanced access of both molecules to the activated receptor in the absence of Grb10. Whereas our data show an increase in IRS1 phosphorylation in Grb10 knockdown cells, a similar elevation of IRS2 phosphorylation was observed in only one experiment (Fig. 3AGo and supplemental Fig. 4). Additional experiments will be required to determine whether Grb10 alters the phosphorylation status of IRS1 alone or both IRS1 and IRS2. Because an increase in overall IRS phosphorylation is observed in Grb10 knockdown cells, it is possible that the absence of Grb10 enhances the ability of the IGF-I receptor tyrosine kinase to access IRS and perhaps Shc as well as other signaling mediators. Whereas this mechanism may explain overall up-regulation of signaling through IRS and Shc, our observation of lower IGF-I receptor phosphorylation levels in Grb10-deficient cells raised the possibility that the absence of Grb10 may also increase protein tyrosine phosphatase access to the activated IGF-I receptor, which could be expected to down-modulate receptor signaling. A previous study has shown, however, that Grb14 overexpression blocks the interaction of PTP-1B with the insulin receptor, shielding it from dephosphorylation and at the same time inhibits Akt/PKB and ERK1/2 activation (21). Furthermore, in Grb14-deficient mice, insulin receptor tyrosine phosphorylation in the liver is decreased, and insulin activation of IRS and Akt/PKB is augmented (39). Primary hepatocytes isolated from these mice exhibit decreased insulin receptor tyrosine phosphorylation, which is restored after pretreatment with the PTP inhibitor pervanadate. These data on Grb14 and the insulin receptor correlate with our findings regarding Grb10 and the IGF-I receptor signaling pathway.

The binding of either Grb10 or Grb14 to an activated receptor tyrosine kinase inhibits signaling through tyrosine kinase substrates, such as IRS and Shc. However, it will be important in future studies to determine whether the preservation of receptor phosphorylation by hindering phosphatase access may serve to maintain the receptors in a latent active state. Because both PTP-1B (40) and SH2-containing phosphatase-2 (SHP-2) (41) have been shown to dephosphorylate the IGF-I receptor, it also will be of interest to determine which of these phosphatases may compete with Grb10 for access to the IGF-I receptor. Overall, it is of significant interest that in the case of both the insulin and IGF-I receptors, a decrease in receptor phosphorylation due to removal of Grb10 or Grb14, presumably due to increased phosphatase access to phosphorylated receptors, is coupled with enhanced downstream signaling. It is conceivable that this results from increased access of IRS and Shc to activated receptors, which are still present in the absence of endogenous Grb10 or Grb14, despite the apparent increase in receptor dephosphorylation in the absence of these adapter molecules. Enhanced access of IRS and Shc to phosphorylated IGF-I receptors presumably leads to efficient activation of these molecules and stimulation of downstream signaling responses.

Whereas endogenous Grb10 and Grb14 both appear to inhibit receptor tyrosine kinase signaling, the phenotypes of Grb10 and Grb14 knockout mice are distinct (15, 39), indicating that the two molecules have unique functional properties despite their structural similarities. Additionally, as shown in the current study (Fig. 1CGo) and the one by Langlais et al. (14), knockdown of Grb10 using siRNA does not result in a compensatory increase in Grb7 or Grb14 expression, further supporting the notion of separate roles for these proteins. The mechanism accounting for the distinct functions of the individual Grb7 family members has not been fully elucidated. Because the interaction of Grb10 with the recently described GIGYF proteins may alter the effects of Grb10 on IGF-I signaling (12), we examined whether association with GIGYF1 and GIGYF2 is a property specific for Grb10 or whether the GIGYF proteins also bind Grb7 or Grb14. Yeast two-hybrid interaction studies demonstrated markedly preferential binding of both GIGYF1 and GIGYF2 to Grb10, compared with Grb7 and Grb14. In future studies, it will be important to further define the biological functions of GIGYF1 and GIGYF2 and also determine their roles in mediating Grb7 protein family functional specificity. Absence of GIGYF1/2 binding to Grb7 and Grb14 may exclude these proteins from certain multiprotein signaling complexes, alter their subcellular localization or allow for their interaction with additional regulatory molecules not bound by Grb10.

In summary, our data indicate that endogenous Grb10 functions as a negative regulator of signaling affecting not only proximal signaling events but also downstream biological responses to IGF-I. Because both Grb10 and IGF-I are now clearly implicated as critical mediators of somatic growth and the mechanisms linking these two components is increasingly clear, it is possible that Grb10 may represent an important therapeutic target in the treatment of growth disorders and IGF-I-responsive tumors.


    Acknowledgments
 
We thank Jason Machan, Ph.D., for his outstanding assistance with statistical analysis.


    Footnotes
 
This work was supported by National Institutes of Health Grants DK43038 and DK50411 (to R.J.S.). A.M.D. was supported by a Graduate Assistance in Areas of National Need (GAANN) training grant from the Department of Education (P200A030100).

First Published Online July 21, 2005

Abbreviations: Akt/PKB, Protein kinase B; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GIGYF, Grb10-interacting GYF protein; Grb, growth factor receptor-bound protein; HA, hemagglutinin; IRS, insulin receptor substrate; PP2A, protein phosphatase 2A; PTP, protein tyrosine phosphatase; SD, standard dropout; SH2, src homology 2; si, small interfering.

Received February 4, 2005.

Accepted for publication July 11, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. LeRoith D, Roberts Jr CT 2003 The insulin-like growth factor system and cancer. Cancer Lett. 195:127–137
  2. Baserga R 2000 The contradictions of the insulin-like growth factor 1 receptor. Oncogene. 19:5574–5581
  3. Muller AF, Van Der Lely AJ 2004 Pharmacological therapy for acromegaly: a critical review. Drugs 64:1817–1838[CrossRef][Medline]
  4. Laron Z 2004 Laron syndrome (primary growth hormone resistance or insensitivity): the personal experience, 1958–2003. J Clin Endocrinol Metab. 89:1031–1044
  5. Abuzzahab MJ, Schneider A, Goddard A, Grigorescu F, Lautier C, Keller E, Kiess W, Klammt J, Kratzsch J, Osgood D, Pfaffle R, Raile K, Seidel B, Smith RJ, Chernausek SD 2003 IGF-I receptor mutations resulting in intrauterine and postnatal growth retardation. N Engl J Med. 349:2211–2222
  6. Hansen H, Svensson U, Zhu J, Laviola L, Giorgino F, Wolf G, Smith RJ, Riedel H 1996 Interaction between the Grb10 SH2 domain and the insulin receptor carboxyl terminus. J Biol Chem. 271:8882–8886
  7. O’Neill TJ, Rose DW, Pillay TS, Hotta K, Olefsky JM, Gustafson TA 1996 Interaction of a GRB-IR splice variant (a human GRB10 homolog) with the insulin and insulin-like growth factor I receptors. Evidence for a role in mitogenic signaling. J Biol Chem. 271:22506–22513
  8. Morrione A, Valentinis B, Li S, Ooi JY, Margolis B, Baserga R 1996 Grb10: a new substrate of the insulin-like growth factor I receptor. Cancer Res. 56:3165–3167
  9. Laviola L, Giorgino F, Chow JC, Baquero JA, Hansen H, Ooi J, Zhu J, Riedel H, Smith RJ 1997 The adapter protein Grb10 associates preferentially with the insulin receptor as compared with the IGF-I receptor in mouse fibroblasts. J Clin Invest. 99:830–837
  10. Frantz JD, Giorgetti-Peraldi S, Ottinger EA, Shoelson SE 1997 Human GRB-IRß/GRB10. Splice variants of an insulin and growth factor receptor-binding protein with PH and SH2 domains. J Biol Chem. 272:2659–2667
  11. Han DC, Shen TL, Guan JL 2001 The Grb7 family proteins: structure, interactions with other signaling molecules and potential cellular functions. Oncogene. 20:6315–6321
  12. Giovannone B, Lee E, Laviola L, Giorgino F, Cleveland KA, Smith RJ 2003 Two novel proteins that are linked to insulin-like growth factor (IGF-I) receptors by the Grb10 adapter and modulate IGF-I signaling. J Biol Chem. 278:31564–31573
  13. Morrione A 2003 Grb10 adapter protein as regulator of insulin-like growth factor receptor signaling. J Cell Physiol. 197:307–311
  14. Langlais P, Dong LQ, Ramos FJ, Hu D, Li Y, Quon MJ, Liu F 2004 Negative regulation of insulin-stimulated mitogen-activated protein kinase signaling by Grb10. Mol Endocrinol. 18:350–358
  15. Charalambous M, Smith FM, Bennett WR, Crew TE, Mackenzie F, Ward A 2003 Disruption of the imprinted Grb10 gene leads to disproportionate overgrowth by an Igf2-independent mechanism. Proc Natl Acad Sci USA. 100:8292–8297
  16. Ooi J, Yajnik V, Immanuel D, Gordon M, Moskow JJ, Buchberg AM, Margolis B 1995 The cloning of Grb10 reveals a new family of SH2 domain proteins. Oncogene. 10:1621–1630
  17. Lim MA, Riedel H, Liu F 2004 Grb10: more than a simple adaptor protein. Front Biosci. 9:387–403
  18. Faria TN, Blakesley VA, Kato H, Stannard B, LeRoith D, Roberts Jr CT 1994 Role of the carboxyl-terminal domains of the insulin and insulin-like growth factor I receptors in receptor function. J Biol Chem 269:13922–13928[Abstract/Free Full Text]
  19. Rozakis-Adcock M, McGlade J, Mbamalu G, Pelicci G, Daly R, Li W, Batzer A, Thomas S, Brugge J, Pelicci PG, et al 1992 Association of the Shc and Grb2/Sem5 SH2-containing proteins is implicated in activation of the Ras pathway by tyrosine kinases. Nature 360:689–692[CrossRef][Medline]
  20. Huyer G, Liu S, Kelly J, Moffat J, Payette P, Kennedy B, Tsaprailis G, Gresser MJ, Ramachandran C 1997 Mechanism of inhibition of protein-tyrosine phosphatases by vanadate and pervanadate. J Biol Chem. 272:843–851
  21. Bereziat V, Kasus-Jacobi A, Perdereau D, Cariou B, Girard J, Burnol AF 2002 Inhibition of insulin receptor catalytic activity by the molecular adapter Grb14. J Biol Chem. 277:4845–4852
  22. Kasus-Jacobi A, Perdereau D, Auzan C, Clauser E, Van Obberghen E, Mauvais-Jarvis F, Girard J, Burnol AF 1998 Identification of the rat adapter Grb14 as an inhibitor of insulin actions. J Biol Chem. 273:26026–26035
  23. Kasus-Jacobi A, Bereziat V, Perdereau D, Girard J, Burnol AF 2000 Evidence for an interaction between the insulin receptor and Grb7. A role for two of its binding domains, PIR and SH2. Oncogene. 19:2052–2059
  24. Ma J, Ptashne M 1987 A new class of yeast transcriptional activators. Cell 51:113–119[CrossRef][Medline]
  25. Li B, Fields S 1993 Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system. FASEB J. 7:957–963
  26. Miyoshi N, Kuroiwa Y, Kohda T, Shitara H, Yonekawa H, Kawabe T, Hasegawa H, Barton SC, Surani MA, Kaneko-Ishino T, Ishino F 1998 Identification of the Meg1/Grb10 imprinted gene on mouse proximal chromosome 11, a candidate for the Silver-Russell syndrome gene. Proc Natl Acad Sci USA. 95:1102–1107
  27. Yoshihashi H, Maeyama K, Kosaki R, Ogata T, Tsukahara M, Goto Y, Hata J, Matsuo N, Smith RJ, Kosaki K 2000 Imprinting of human GRB10 and its mutations in two patients with Russell-Silver syndrome. Am J Hum Genet. 67:476–482
  28. Wang J, Dai H, Yousaf N, Moussaif M, Deng Y, Boufelliga A, Swamy OR, Leone ME, Riedel H 1999 Grb10, a positive, stimulatory signaling adapter in platelet-derived growth factor BB-, insulin-like growth factor I-, and insulin-mediated mitogenesis. Mol Cell Biol. 19:6217–6228
  29. Morrione A, Valentinis B, Resnicoff M, Xu S, Baserga R 1997 The role of mGrb10{alpha} in insulin-like growth factor I-mediated growth. J Biol Chem. 272:26382–26387
  30. Deng Y, Bhattacharya S, Swamy OR, Tandon R, Wang Y, Janda R, Riedel H 2003 Growth factor receptor-binding protein 10 (Grb10) as a partner of phosphatidylinositol 3-kinase in metabolic insulin action. J Biol Chem. 278:39311–39322
  31. Liu F, Roth RA 1995 Grb-IR: a SH2-domain-containing protein that binds to the insulin receptor and inhibits its function. Proc Natl Acad Sci USA. 92:10287–10291
  32. Wick MJ, Dong LQ, Hu D, Langlais P, Liu F 2001 Insulin receptor-mediated p62dok tyrosine phosphorylation at residues 362 and 398 plays distinct roles for binding GTPase-activating protein and Nck and is essential for inhibiting insulin-stimulated activation of Ras and Akt. J Biol Chem. 276:42843–42850
  33. Wick KR, Werner ED, Langlais P, Ramos FJ, Dong LQ, Shoelson SE, Liu F 2003 Grb10 inhibits insulin-stimulated insulin receptor substrate (IRS)-phosphatidylinositol 3-kinase/Akt signaling pathway by disrupting the association of IRS-1/IRS-2 with the insulin receptor. J Biol Chem. 278:8460–8467
  34. Butler AA, LeRoith D 2001 Minireview: tissue-specific versus generalized gene targeting of the igf1 and igf1r genes and their roles in insulin-like growth factor physiology. Endocrinology 142:1685–1688[Abstract/Free Full Text]
  35. Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA 1996 Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J. 15:6541–6551
  36. Bayascas JR, Alessi DR 2005 Regulation of Akt/PKB Ser473 phosphorylation. Mol Cell 18:143–145[CrossRef][Medline]
  37. Gao T, Furnari F, Newton AC 2005 PHLPP: a phosphatase that directly dephosphorylates Akt, promotes apoptosis, and suppresses tumor growth. Mol Cell 18:13–24[CrossRef][Medline]
  38. Jahn T, Seipel P, Urschel S, Peschel C, Duyster J 2002 Role for the adaptor protein Grb10 in the activation of Akt. Mol Cell Biol. 22:979–991
  39. Cooney GJ, Lyons RJ, Crew AJ, Jensen TE, Molero JC, Mitchell CJ, Biden TJ, Ormandy CJ, James DE, Daly RJ 2004 Improved glucose homeostasis and enhanced insulin signalling in Grb14-deficient mice. EMBO J. 23:582–593
  40. Buckley DA, Cheng A, Kiely PA, Tremblay ML, O’Connor R 2002 Regulation of insulin-like growth factor type I (IGF-I) receptor kinase activity by protein tyrosine phosphatase 1B (PTP-1B) and enhanced IGF-I-mediated suppression of apoptosis and motility in PTP-1B-deficient fibroblasts. Mol Cell Biol. 22:1998–2010
  41. Maile LA, Clemmons DR 2002 Regulation of insulin-like growth factor I receptor dephosphorylation by SHPS-1 and the tyrosine phosphatase SHP-2. J Biol Chem. 277:8955–8960



This article has been cited by other articles:


Home page
Cancer Res.Home page
I. O-Sullivan, A. Chopra, J. Carr, T. S. Kim, and E. P. Cohen
Immunity to Growth Factor Receptor-Bound Protein 10, a Signal Transduction Molecule, Inhibits the Growth of Breast Cancer in Mice
Cancer Res., April 1, 2008; 68(7): 2463 - 2470.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. Wang, B. Balas, C. Y. Christ-Roberts, R. Y. Kim, F. J. Ramos, C. K. Kikani, C. Li, C. Deng, S. Reyna, N. Musi, et al.
Peripheral Disruption of the Grb10 Gene Enhances Insulin Signaling and Sensitivity In Vivo
Mol. Cell. Biol., September 15, 2007; 27(18): 6497 - 6505.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. M. Smith, L. J. Holt, A. S. Garfield, M. Charalambous, F. Koumanov, M. Perry, R. Bazzani, S. A. Sheardown, B. D. Hegarty, R. J. Lyons, et al.
Mice with a Disruption of the Imprinted Grb10 Gene Exhibit Altered Body Composition, Glucose Homeostasis, and Insulin Signaling during Postnatal Life
Mol. Cell. Biol., August 15, 2007; 27(16): 5871 - 5886.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
F. J. Ramos, P. R. Langlais, D. Hu, L. Q. Dong, and F. Liu
Grb10 mediates insulin-stimulated degradation of the insulin receptor: a mechanism of negative regulation
Am J Physiol Endocrinol Metab, June 1, 2006; 290(6): E1262 - E1266.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)