help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2005-0467
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russo, V. C.
Right arrow Articles by Werther, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russo, V. C.
Right arrow Articles by Werther, G. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
Medline Plus Health Information
*Neuroblastoma
Endocrinology Vol. 146, No. 10 4445-4455
Copyright © 2005 by The Endocrine Society

Insulin-Like Growth Factor Binding Protein-2 Binding to Extracellular Matrix Plays a Critical Role in Neuroblastoma Cell Proliferation, Migration, and Invasion

V. C. Russo1, B. S. Schütt1, E. Andaloro, S. I. Ymer, A. Hoeflich, M. B. Ranke, L. A. Bach and G. A. Werther

Murdoch Childrens Research Institute (V.C.R., B.S.S., E.A., S.I.Y., G.A.W.), Centre for Hormone Research and Department of Paediatrics (V.C.R., B.S.S., E.A., S.I.Y., G.A.W.), University of Melbourne, Parkville 3052, Victoria, Australia; University Children’s Hospital (B.S.S., M.B.R.), 72076 Tübingen, Germany; Institute of Animal Breeding (A.H.), Ludwig-Maximilian University, D-81377 Munich, Germany; and Department of Medicine (L.A.B.), University of Melbourne, Austin Health, Heidelberg 3084, Victoria, Australia

Address all correspondence and requests for reprints to: Vincenzo C. Russo, Ph.D., Centre for Hormone Research, Murdoch Childrens Research Institute, University of Melbourne, Parkville 3052, Victoria, Australia. E-mail: vince.russo{at}mcri.edu.au.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IGF binding proteins (IGFBPs) modulate IGF cellular bioavailability and may directly regulate tumor growth and invasion. We have previously shown that IGFBP-2 binds and localizes IGF-I to the pericellular matrix and have provided some evidence suggesting that the heparin binding domain (HBD) or the arginine-glycine-aspartic acid (RGD) integrin binding motif may be involved in these interactions. However, the precise mechanisms involved remain to be elucidated. We therefore mutated the HBD or RGD sequence of IGFBP-2 and investigated consequent effects on extracellular matrix (ECM) binding, IGF-induced proliferation, and migration of neuroblastoma cells. IGFBP-2 and its arginine-glycine-glutamic acid (RGE) mutant similarly bound ECM components, whereas binding of mutant HBD-IGFBP-2 to each of the ECM substrates was markedly reduced by 70–80% (P < 0.05). IGF-I (100 ng/ml) increased incorporation of 3H-thymidine in neuroblastoma SK-N-SHEP cells by approximately 30%, an effect blunted by exogenously added native or either mutant IGFBP-2. Overexpression of IGFBP-2 and its RGE mutant potently promoted SHEP cell proliferation (5-fold), whereas SHEP cell proliferation was negligible when HBD-IGFBP-2 was overexpressed. Addition or overexpression of IGFBP-2 and its RGE mutant potently (P < 0.05) enhanced SHEP cell migration/invasion through the ECM. However, overexpression of the HBD-IGFBP-2 mutant potently inhibited (50–60%) SHEP cell invasion through ECM. Thus, IGFBP-2, which binds to the ECM, enhances proliferation and metastatic behavior of neuroblastoma cells, functions that directly or indirectly use the HBD but not the integrin binding sequence. Our novel findings thus point to a key role for the HBD of IGFBP-2 in the control and regulation of neuroblastoma growth and invasion.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
IGFBPs REGULATE IGF bioavailability in the pericellular space and thereby affect activation of the IGF-I receptor and its downstream cognate cellular responses such as proliferation. Local abundance of IGFBPs is regulated in a developmentally specific and tissue-specific manner, both via transcriptional and posttranslational mechanisms such as proteolysis (1, 2). One mechanism for regulating the biological activity of IGFBPs is their differential localization to the cell surface or extracellular matrix (ECM) (1, 2).

IGFBP-2, the most abundant IGFBP in the nervous system, is highly expressed in multiple tissues throughout fetal and postnatal development, suggesting a key role for IGFBP-2 in these physiological processes. IGFBP-2 may inhibit the metabolic and proliferative actions of IGFs (2, 3, 4, 5) or potentiate IGF-dependent mitogenic responses (6), depending on the physiological state or experimental conditions. Some of the effects of IGFBP-2 may be IGF independent (2, 5, 7, 8), but the mechanisms involved remain unclear. Microarray analysis has shown that IGFBP-2 is also frequently a highly expressed gene in neoplasms of the nervous system (9, 10, 11), and its expression levels correlate with tumor aggressiveness (6, 12, 13, 14).

We have shown in vivo that IGFBP-2 is bound to cell membrane proteoglycans (PGs) in the IGF-rich olfactory bulb rat brain during postnatal remodeling (15). IGFBP-2 binds to PGs or glycosaminoglycans in vitro (15), most likely via its heparin binding domain (HBD) (XBBXBX) (16).

Furthermore, IGFBP-2 is also often found to be cell membrane associated in tumors (2, 5, 8, 17), suggesting that pericellular localization of IGFBP-2 might be important for potentiation of IGF-mediated protumorigenic actions.

HBDs are also found in IGFBP-3,-5, and-6 (2). The HBDs of IGFBP-3 and IGFBP-5 are involved in cell surface association (2) and interaction with vitronectin (18), whereas O-glycosylation inhibits cell surface association of IGFBP-6 (19).

Human IGFBP-2 possesses a potential integrin-binding arginine-glycine-aspartic acid (RGD) sequence (2, 20), but early data suggested that this is not functional (2, 15, 21). Recent studies have shown that IGFBP-2 interacts with the {alpha}Vß3-integrin but that this is RGD independent (5). In contrast, cell surface association of IGFBP-2 to sarcoma cells was partially inhibited by RGD peptides and competed by anti-{alpha}5ß1 integrin antibodies (8), suggesting that IGFBP-2 may interact with integrin receptors directly or indirectly.

We postulated that IGFBP-2 binding to proteoglycans or integrins may play a key role in the ability of IGFBP-2 to associate with cell surfaces and so modulate cell function, either directly or indirectly, by affecting IGF availability at the cell surface.

We therefore mutated the HBD and RGD sequences of IGFBP-2 to determine their roles in binding to ECM components and mediation or modulation of effects on neuroblastoma proliferation and invasion.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
Human-IGF-I was from Kabi Pharmacia Upjohn, Peptide Hormones Sweden (Uppsala, Sweden). 125I-IGF-I (~2000 Ci/mmol) was bought from Amersham (North Ryde, New South Wales, Australia). The full-length human IGFBP-2 cDNA was kindly provided by Dr. David Clemmons (University of North Carolina, Chapel Hill, NC). Aggrecan, fibronectin, and heparin were kindly supplied by Dr. Amanda Fosang (Arthritis Research Unit, Murdoch Childrens Research Institute (MCRI), Royal Children’s Hospital, Parkville, Victoria, Australia). Human vitronectin was purchased from Promega (Annadale, New South Wales, Australia). Bovine collagen type IV and mouse laminin were a gift from Dr. Shireen Lamande (Cell and Matrix Research Unit, MCRI, Royal Children’s Hospital).

Cell culture
The human neuroblastoma SK-N-SHEP (SHEP) cell line was supplied by Dr. Eva Feldman (Department of Neurology, University of Michigan, Ann Arbor, MI). SHEP cells express very low amounts of IGF-I, IGF-II, and IGF-I receptors and do not express IGFBP-2 (22, 23). SHEP cells were grown in DMEM/10% fetal calf serum (FCS) (Trace Biosciences, Castle Hill, New South Wales, Australia) or as indicated.

IGFBP-2 mutagenesis
The HBD at 179PKKLRP184 was mutated to 179PNNLAP184 by PCR-based mutagenesis. A mutagenic cassette was generated by combining the external primers 5'-589GAAGGAGGCCTGGTGGAGAACC610-3' (forward, A) and 5'-1015CCGGGAAGCTGATCCAGGGAG995-3' (reverse, D) with the internal mutagenic primers 5'-758GCCTGGAGGAGCCCAACAACCTGGCACCACCCCCTGCCAG797-3' (forward, B) and 5'-797CTGGCAGGGGGTGGTGCCAGGTTGTTGGGCTCCTCCAGGC758-3' (reverse, C). The overlapping PCR products A–C and B–D were hybridized, extended, and the mutated cDNA amplified using A and D primers.

The 265RGD267 was mutated to 265RGE267 by using a forward primer 5'-787ACCATCCGGGGGGAACCCGAGTG809-3' (introducing the point mutation) and a reverse primer 5'-CAACCGGTstopCTACTGCATCCGCTGGGTGTG-3' (introducing a stop codon and an AgeI (ACCGGT) restriction site) generating, an 88-bp PCR product (reverse mutagenic megaprimer). The reverse mutagenic megaprimer was then used in combination with the forward primer 5'-CTCGAG1ATGCTGCCGAGAGTCGGCTGC21-3' (introducing a start codon and a XhoI restriction site) to amplify mutated [arginine-glycine-glutamic acid (RGE)] full-length IGFBP-2 cDNA. The mutated full-length IGFBP-2 cDNA was then subcloned into the XhoI and AgeI restriction sites of the pcDNA3.1/V5-HisA mammalian expression vector (Invitrogen, Karlruhe, Germany) to express an untagged RG267D/E-IGFBP-2 (pcDNA3.1-RGE267 IGFBP-2). DNA sequencing of the full-length IGFBP-2 mutated clones was performed to verify that the required mutations were present in the HBD and RGD motifs and that no other alterations were introduced in the IGFBP-2 cDNA clones.

Stable transfection of native and mutant IGFBP-2 in SHEP cells
Native [wild type (WT)] and mutant HBD human (h)IGFBP-2 cDNAs were subcloned into the HindIII/BglII digested mammalian expression plasmid pCMV-int (4).

The pCMV-int-WTIGFBP-2 or pCMV-int-HBDIGFBP-2 and pSV2-Neo (the latter used to confer resistance to the selecting agent neomycin = G418 at 300 µg/ml) or the pcDNA3.1-RGE267 IGFBP-2 construct were then transfected into SK-N-SHEP cells, using the profection calcium phosphate mammalian transfection kit (Promega), according to the manufacturer’s specifications. Stable WT, HBD, and RGE IGFBP-2 transfectant clones were isolated after G418 selection.

IGFBP-2 in conditioned medium was determined by Western ligand blotting (WLB) using 125I-IGF-I (24) and immunoblotting (15). IGFBP-2 levels were quantified by the IGFBP-2 ELISA (DY674, R&D Systems, Minneapolis, MN) or an in-house IGFBP-2 RIA (25). An average 15–20 clones were isolated for each of the transfectants. The isolated clones for the HBD or RGE-IGFBP-2 mutant were matched as closely as possible to those expressing similar level of WT-IGFBP-2.

Native or mutant IGFBP-2 was purified by IGF-I affinity chromatography as previously described by Ho and Baxter (26). Fractions were analyzed by WLB (125I-IGF-I) and immunoblotting and quantified by the R&D IGFBP-2 ELISA or RIA as above.

Native and mutant IGFBP-2 binding affinities for IGF-I/II
To determine whether the mutations of IGFBP-2 affected IGF binding affinity, native, HBD ,and RGD-IGFBP-2 (all 2.5 ng) were incubated with either 125I-IGF-I or -II (15,000 cpm) in the presence of increasing concentrations of unlabeled IGF-I or -II (0.0025–0.15 nM). Binding was for 2 h at room temperature in 100 µl of ligand binding buffer (LBB) [LBB: 50 mM sodium phosphate (pH 7.4), 0.1 M NaCl, 0.05% (wt/vol) NaN3, 0.2% fatty acid-free BSA (Sigma, Steinheim, Germany), and 0.1% (vol/vol) Triton X-100]. Bound and free 125I-IGF-I or -II was separated by adding 0.1 ml ice-cold antibody solution [1:4000 polyclonal anti-IGFBP-2 antibody, 0.05 mg/ml rabbit IgG (Sigma) in LBB] for 16 h at 4 C followed by precipitation for 1 h at 4 C with 500 µl of an antirabbit IgG antibody solution [1:300 sheep antirabbit IgG (Sigma) in 4% polyethylene glycol (PEG 6000)]. Antibody complexes were precipitated by centrifugation (4 C, 3500 x g, 15 min) and washed once with 1 ml ice-cold water. Bound radioactivity in precipitates was quantified in a {gamma}-counter. Each point was measured in quadruplicate in each of two experiments. The Sigma Plot 8.0 graphic program (Jandel Scientific, San Rafael, CA) was used to calculate binding affinities using a one binding site hyperbolic fit.

Native and mutant-IGFBP-2 binding to ECM components
Components of the ECM including proteoglycans, collagen, fibronectin, laminin, and vitronectin play a key role in modulation of growth and migration of many cell types, including cancer cells. We therefore examined IGFBP-2 interactions with a range of widely expressed matrix components, also known to interact with other IGFBP (15, 18, 27, 28, 29, 30, 31, 32), to determine whether this interactions involves the HBD. A solid phase binding assay (15), in microtiter immunoassay 96-well plates (Immunolon-4; Dynatech Laboratories Inc., Chantilly, VA), was used to determine whether the mutations introduced into IGFBP-2 affects its binding to aggrecan, heparin, laminin, fibronectin, collagen type IV (all coated at 500 ng/200 µl) (15, 27), or vitronectin (coated at 300 ng per 200 µl) (18). ECM-coated wells (16 h at 37 C) were then extensively washed with solid-phase binding buffer (SBB) [16 mM Tris/HCl (pH 7.2), 125 mM NaCl, 2 mM CaCl2, 2 mM MgCl2, 1 mg/ml BSA, and 0.02% Tween 20] and then blocked with 1% BSA in SBB for 1 h at 37 C (15). ECM-coated wells were then incubated with 10 ng of wild-type IGFBP-2 or its mutants for 1 h at 37 C (15). After removal of unbound IGFBP-2 with SBB, wells were then incubated as follows:

ECM solid-phase IGFBP-2 binding assay using125I-IGF-I (15).
Wells containing ECM-bound IGFBP-2 or control were then incubated for 16 h at 4 C with 125I-IGF-I (1.5 x 104 to 3 x 104 cpm) in the presence [nonspecific binding (NS)] or absence (total binding) of an excess of unlabeled IGF-I (1 µg/ml). All wells were then washed four times with SBB, and bound radioactivity was measured in a {gamma}-counter. In the absence of native or mutant IGFBP-2, 125I-IGF-I binding to all of the coated substrates was undetectable (data not shown). Each point was measured in triplicate in each of three experiments. NS was less than 1.5% of the added radioactivity for all these conditions.

ECM solid-phase IGFBP-2 binding assay using ELISA.
Wells containing ECM-bound IGFBP-2 (WT or HBD) were incubated with biotinylated goat anti-hIGFBP-2 (100 ng/ml, no. 840576, R&D) for 1.5 h at 37 C, followed by extensive washing with SBB, addition of streptavidin-horseradish peroxidase (no. 890803, R&D), extensive washing with SBB, and detection substrate (no. DY999, R&D). Absorbance (OD) at 450 nm (samples in triplicate, two experiments) was determined by a conventional ELISA plate reader (Multiskan Ascent; Labsystem, Helsinki, Finland). The biotinylated goat anti-hIGFBP-2 no. 840576 equally recognizes WT and mutants hIGFBP-2.

SHEP cell proliferation after addition of native or mutant IGFBP-2
Cell proliferation by 3H-thymidine incorporation.
SHEP cells (3.0 x 104) were seeded in 96-well plates and cultured in 200 µl DMEM/10% FCS. After 12 h, cells were washed and media changed to 200 µl serum-free media (SFM) containing 1 µCi 3H-thymidine with or without IGF-I (100 ng/ml) and/or affinity-purified WT, HBD or RGE-IGFBP-2 (800 ng/ml). After 36 h, cells were harvested and DNA was immobilized onto a nitrocellulose filter/membrane by the Harvester 96 (Tomtec, Hamden, CT). Radioactivity incorporated into DNA was counted with a ß-counter (MicroBeta 1450; Wallac, Milton Keynes, UK). Experiments were performed three times with samples run in quadruplicate.

Cell proliferation by naphthalene blue black (NBB) assay.
Alternatively SHEP cells cultured in SFM as above were preincubated for up to 8 h in the presence of 800 ng/ml of either WT IGFBP-2 or its HBD mutant before addition of IGF-I (100 ng/ml). After 36 h cells were then washed in PBS, fixed for 15 min in 10% formalin/9% acetic acid/0.1 M Na-acetate, washed again in PBS, and stained for 30 min with NBB solution (0.1% NBB, 9% acetic acid 0.1 M sodium acetate) (33, 34). Cells were then washed in PBS and cellular stain was extracted with 0.05 M NaOH. Sample absorbance (620/492 nm) was determined by microtiter plate reader. Assays were performed three times and samples were run in triplicate.

Overexpression of native or mutant IGFBP-2 on SHEP cell proliferation
Two clones for each of the SHEP cells overexpressing similar level (931.8 ± 75.4 ng/ml at 72 h; 1193.0 ± 136.6 ng/ml at 96 h) of WT, HBD, or RGE-IGFBP-2 were grown in DMEM/10% FCS and treated as follows: SHEP cells (4.5 x 104 cells) were seeded in triplicate in T-25 flasks and maintained in DMEM/10% FCS for up to 4 d without a media change. Cells were then trypsinized, stained with Trypan blue, and counted using a hemocytometer (Neubauer chamber). Experiments were performed three times with samples run in triplicate.

Overexpression of native or HBD-IGFBP-2 on IGF-induced SHEP cell proliferation
SHEP cell clones expressing comparable amounts of WT-IGFBP-2 (clone C7; see Fig. 5AGo) or HBD-IGFBP-2 (clone C1; see Fig. 5AGo) and empty vector control (see Fig. 5AGo) were grown in DMEM/10% FCS to reach 60% cell confluency before switching to SFM culture for up to 96 h in the presence or absence of 100 ng/ml of IGF-I (single dose at time 0). At intervals of 24 h, cells were washed in PBS and NBB proliferation assay was performed as described above (33, 34). All experiments in Fig. 5CGo were performed by simultaneous plating of cells in serum-free media (SF) and SF plus IGF-I (IGF) so that the matched serum-free wells were the control for IGF-I treatment, allowing determination of the effect of IGF-I, compared with serum-free control. Assays were performed three times and samples were run in triplicate.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 5. A–D, Overexpression of IGFBP-2 and its mutants differentially modulates proliferation of SHEP cells. A, Conditioned medium from two clones for each of the SHEP cells overexpressing similar level of WT, HBD, or RGE-IGFBP-2 was analyzed by Coomassie (top panel), immunoblotting with anti-IGFBP-2 (middle panel), and WLB (lower panel) as described in Materials and Methods. A representative set is shown. B, To assess the effects of overexpression of IGFBP-2 or its mutants on SHEP cell proliferation, SHEP cell clones expressing comparable amounts of IGFBP-2 or its mutants were isolated and grown in complete medium. C, To assess the effects of overexpression of IGFBP-2 or its HBD mutant on SHEP cell proliferation, SHEP cell clones expressing comparable amounts of IGFBP-2 or its HBD mutant were isolated and grown in serum-free medium (SF) in the presence or absence of IGF-I (100 ng/ml). D, Data for SHEP cell clones, as at 24 h time point (C), are here shown as percent increase for WT, HBD mutant, and empty vector (pCMV) relative to simultaneous serum-free-treated controls. Each point (A–D) was measured in triplicate in each of three experiments (*, P < 0.05; **, P < 0.01;***, P < 0.001; ns, not significant). Cell number was determined by hemacytometer (B) or NBB (C and D) as described in Materials and Methods. Each point was measured in triplicate in each of three experiments. Pooled data are shown (B–D).

 
Cell migration and invasion assays
Cell migration/motility was measured using Falcon cell culture polyethyleneterephthalate (PET) inserts with a pore size of 8 µm in a 24-well format (no. 353097; Falcon, Le Pont de Claix, France). Cells were detached with 5 mM EDTA in PBS over 30 min at 37 C, harvested by centrifugation (200 x g, room temperature, 5 min), washed three times with SFM containing 1.5% BSA. Cells (50 x 104 per 500 µl) were then seeded in SFM/1.5% BSA in the top chamber of the cell culture inserts, whereas the bottom chamber was filled with 750 µl of the SFM/1.5% BSA supplemented with 0.1% FCS as chemoattractant. Cells were then incubated for 22 h under normal growth conditions. For cell invasion (migration through an ECM-coated membrane), cells were prepared as above but were seeded onto an ECM-coated, 8-µm, pore-sized Matri-Gel invasion chambers (no. 354480, Falcon) and cultured for up to 22 h.

To determine the number of cells migrating (uncoated membrane) or invading (ECM-coated membrane) through the membrane, nonmigrating or noninvading cells were removed by wiping the top of the membrane with a PBS-wetted cotton-wool tip. Membranes were then stained using a Hemacolor staining kit (Merck, Darmstadt, Germany). After washing with water, cells migrating or invading through the membrane were manually counted by using magnified (x200) digital pictures of the insert/membranes (four fields for each membrane). Experiments were performed at least three times with samples run in duplicates, and four individual fields were counted for each sample. An invasion index was calculated as the number of cells invading through the membrane (cells penetrating the deeper ECM coating) divided by the number of cells migrating through the membrane.

Statistical analysis
The Sigma Plot 8.0 graphic program (Jandel Scientific) was used to calculate IGFBP binding affinities for IGF-I and -II, using a one binding site hyperbolic fit. Each point was measured in quadruplicate in each of two experiments.

The PRISM program (GraphPad Inc., San Diego, CA) was used to perform one-way ANOVA and Bonferroni post hoc analysis. All experiments were performed at least three times with samples run in duplicate-quadruplicate, as indicated each time, and results plotted as mean ± SEM.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Mutagenesis has no effect on the affinity of IGFBP-2 for IGFs
IGFBP-2 associates with cell surface proteoglycans (15) or integrin receptors (5, 8), but the specific roles of the HBD or RGD sequences of IGFBP-2 in these interactions have not been specifically addressed. To examine these possibilities, HBD, 179PKKLRP184, was mutated to 179PNNLAP184 and the 265RGD267 domain was mutated to 265RGE267. The IGF binding affinities of the mutants were similar to those of native IGFBP-2 (Table 1Go). These results suggested that neither substitution of the basic amino acids in the HBD domain nor ablation of the RGD motif significantly altered the affinity of IGFBP-2 for IGF-I or IGF-II.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Effect of mutagenesis on the affinity of IGFBP-2 for the IGFs

 
The HBD mediates binding of IGFBP-2 to aggrecan
We used our previously described solid-phase binding assay (15) to determine whether the introduced mutations would affect IGFBP-2 binding to aggrecan. Preliminary experiments established the time, dose dependence, and optimal amount of coating substrate (data not shown). As we have previously demonstrated (15) for rat IGFBP-2, native hIGFBP-2 and its RGE mutant, both at 10 ng/well, efficiently bound aggrecan to a similar extent, whereas the HBD-hIGFBP-2 mutant showed a marked 75% reduction in binding under the same conditions (P < 0.001, Fig. 1AGo). This reduction in binding was confirmed by the ELISA binding assay in Fig. 1BGo, showing that the HBD-IGFBP-2 mutant, compared with WT-IGFBP-2, only negligibly interacts with aggrecan.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 1. A, B, and C, The HBD mediates binding of IGFBP-2 to aggrecan. Ninety-six-well plates were coated with 500 ng/well of aggrecan, saturated with 1% BSA, followed by incubation with native (WT), HBD, or RGE-IGFBP-2 (10 ng/well) (A) for 2 h at 37 C. Bound IGFBP-2 was detected by 125I-IGF-I (1.5 x 104 cpm). Nonspecific binding (NSB) was determined in the presence of an excess of unlabeled IGF-I (1 µg/ml). TB, Total binding. In the absence of native or mutant IGFBP-2, 125I-IGF-I binding to aggrecan was undetectable (data not shown). B, WT or HBD-IGFBP-2 (10 ng/well) for 2 h at 37 C, as in A. Bound IGFBP-2 was detected by a biotinylated goat anti-hIGFBP-2 as described in Materials and Methods. C, Binding of native and RGE-IGFBP-2, detected as in A, was decreased in the presence of increasing ionic strength (125–500 mM NaCl). The binding assay was as described in Materials and Methods. Each point was measured in triplicate in each of three experiments (***, P < 0.001). Pooled data are shown.

 
Binding of native and RGE-IGFBP-2 was decreased by the presence of increasing ionic strength (125–500 mM NaCl, Fig. 1CGo). These results indicate that the 179PKKLRP184 motif mediates most of the IGFBP-2 binding to aggrecan and suggest that ionic interactions are involved.

IGFBP-2 associates with ECM components via its HBD
ECM components, including laminin, fibronectin, vitronectin, collagen type IV, and proteoglycans, are involved in development of neoplastic processes in the nervous system. Increasing evidence suggests that IGFBP-2 interacts with components of the ECM (15, 17, 18, 27). We therefore investigated whether the interaction of IGFBP-2 with matrix components involves the HBD or RGD sequences.

Native IGFBP-2 bound to a variable extent to heparin, vitronectin, laminin, fibronectin, and collagen type IV (Fig. 2Go). These interactions appear to be mostly mediated by HBD because the HBD-IGFBP-2 mutant showed markedly reduced (60–80%) binding to all of these substrates (Fig. 3Go, A–E). However, binding of the RGE-IGFBP-2 mutant to heparin and the ECM components was comparable with that of native IGFBP-2 (Fig. 3Go, A–E). These results show that the HBD motif, and not the RGD sequence, in IGFBP-2 is involved in interactions with components of the ECM.



View larger version (10K):
[in this window]
[in a new window]
  		FIG. 2. IGFBP-2 binds to ECM components. Native (WT) IGFBP-2 (10 ng/ml) binds to wells coated with 500 ng aggrecan, heparin, laminin, fibronectin, and collagen type IV and 300 ng vitronectin. The binding assay was as described in Materials and Methods. Each point was measured in triplicate in each of three experiments. Pooled data are shown.

 


View larger version (27K):
[in this window]
[in a new window]
  		FIG. 3. A–E, IGFBP-2 binds to ECM components via its HBD. Native (WT), HBD, and RGE-IGFBP-2 (10 ng/ml) bind to wells coated with 500 ng heparin (A), collagen type IV (B), fibronectin (D), laminin (E), and 300 ng vitronectin (C). The binding assay was as described in Materials and Methods. Each point was measured in triplicate in each of three experiments (*, P < 0.05; ***, P < 0.001). Pooled data are shown.

 
Exogenous IGFBP-2 and its mutants inhibit the mitogenic activity of IGF-I in SHEP cells
IGFBPs control IGF action at the cellular level by either restricting access to their receptors and thus inhibiting any mitogenic response or facilitating IGF-I receptor binding and consequently potentiating mitogenic stimuli (2). We therefore aimed to determine the effects of IGFBP-2 and its mutants on IGF-I-mediated proliferation.

In SFM, IGF-I alone (100 ng/ml) significantly stimulated proliferation of SHEP cells (**, P < 0.01, Fig. 4AGo). However, this effect was abrogated by the presence of native or mutant IGFBP-2 (each at 800 ng/ml). Addition of either native or mutant IGFBP-2 alone to wild-type SHEP cells did not alter basal growth of these cells (Fig. 4AGo). Similarly (Fig. 4BGo), in SFM, preincubation of SHEP cells for 8 h with either WT or HBD IGFBP-2 (each at 800 ng/ml) prior to addition of IGF-I (100 ng/ml) also resulted in inhibition of IGF-induced cell proliferation (1, P < 0.05, Fig. 4BGo). These data demonstrate that exogenous IGFBP-2 and its mutants, which bind IGF-I with similar affinity, equally inhibit IGF-I actions and that this inhibition does not require the presence of a functional HBD or RGD domain.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 4. A and B, Exogenous IGFBP-2 and its mutants inhibit the mitogenic activity of IGF-I in SHEP cells. Thymidine incorporation assay (A) or NBB proliferation assay (B) were performed as described in Materials and Methods. IGFBP-2 was either preincubated (P) with SHEP cells before IGF-I addition or simultaneously (S) added with IGF-I. Each point was measured in triplicate in each of three experiments (*, P < 0.05; ** , P < 0.01; ns = not significant). Pooled data are shown.

 
Overexpression of IGFBP-2 and its mutants differentially modulates proliferation of SHEP cells in complete medium
We have previously demonstrated that overexpression of IGFBP-2 in vivo negatively regulates postnatal growth, including brain growth, in rodents (4). On the other hand, IGFBP-2 overexpression may either inhibit or enhance proliferation in various tumor cell lines (2, 6, 14, 35). We therefore aimed to assess the effects of overexpression of IGFBP-2 or its mutants on SHEP cell proliferation.

SHEP cell clones expressing comparable amounts of IGFBP-2 (Fig. 5AGo) or its mutants were isolated and grown in DMEM/10% FCS. SHEP cells overexpressing native or RGE-IGFBP-2 showed an 8-fold increase in cell number over the 4 d of culture, compared with a 3- to 4-fold increase in the SHEP control cells (Fig. 5BGo). Conversely overexpression of HBD-IGFBP-2 did not affect the growth of SHEP cells, which was comparable with that observed in SHEP control cells. Thus, an intact HBD is required for overexpression of IGFBP-2 to enhance neuroblastoma cells growth in complete medium.

Overexpression of IGFBP-2 and its HBD mutant differentially modulates IGF-induced SHEP cell proliferation in the absence of serum
SHEP cell clones expressing comparable amounts of WT-IGFBP-2 or HBD-IGFBP-2 and empty vector control cells (Fig. 5AGo) were cultured in SFM in the presence or absence of IGF-I (100 ng/ml, single dose). In SFM and in the absence of IGF-I, the cell number in the WT-IGFBP-2 overexpressing SHEP cells (Fig. 5CGo, left panel, WT) was variably maintained over the 4 d (~15% decrease). However, under the same conditions (SF), cell number decreases in the control cells (empty vector, pCMV) by approximately 40% (Fig. 5CGo, middle panel, pCMV)] and more dramatically (~60%) in the HBD-IGFBP-2 overexpressing SHEP cells (Fig. 5CGo, right panel, HBD). Addition of a single dose of IGF elicited proliferation of SHEP cells transfected with either the WT-IGFBP-2 (~50%, 24 h, P < 0.001) or empty vector control cells (~20%, 24 h, P < 0.05) when compared with the cell number observed in SFM and absence of IGF-I at the same time point (Fig. 5CGo, left and middle panel). No response to IGF-I was seen at 24 h in HBD-IGFBP-2 overexpressing SHEP cells, with cell number dramatically declining (~60%) over the 72 h, similar to that seen in absence of IGF-I (Fig. 5CGo, right panel). Because the HBD-IGFBP-2 poorly binds to ECM, these data suggest that IGFBP-2 interactions with ECM are the key to both enhanced cell survival, in serum-free media, and potentiation of IGF-I action. Statistically significant differences in cell number increase over serum-free control among the three SHEP cells clones WT, HBD (P < 0.001 vs. the WT), and pCMV (P < 0.05 vs. the WT) at 24 h are also shown in Fig. 5DGo. Data in Fig. 5DGo are expressed as percentage increase in cell number induced by IGF-I over serum-free control at time 0. These data (Fig. 5Go, C and D) thus show that there is a statistically significant stepwise decrease in the IGF effect from WT to empty vector, to HBD mutant, in which there is no measurable IGF-I effect (Fig. 5DGo). The full time course (Fig. 5CGo) dramatically demonstrates that in the HBD mutant expressing SHEP cells (right panel), there is no apparent IGF-I effect on cell number and that the IGF-I effect in control SHEP cells (pCMV) is transient and not maintained (middle panel, no IGFBP-2 present).

IGFBP-2 promotes migration and invasion of SHEP cells via its HBD
We next aimed to determine whether addition or overexpression of IGFBP-2 and its mutants affects metastatic parameters including migration and invasion.

Addition of native or RGE-IGFBP-2 (1.6 µg/ml) to WT SHEP cells significantly (~25%, P < 0.05) enhanced their migration/motility through the uncoated membrane (Fig. 6AGo). In contrast, addition of the HBD-IGFBP-2 mutant did not affect migration/motility of WT SHEP cells (Fig. 6AGo).



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 6. A–C, Addition or overexpression of IGFBP-2 (BP-2) enhances invasion of neuroblastoma cells. Cell invasion was determined as described in Materials and Methods. A, WT or IGFBP-2 mutants (1.6 µg/ml) are added to SHEP cell. B, Microphotography of a representative set of filters is shown. C, Invasion index for each clone is shown. Each point was measured induplicates in each of three experiments (*, P < 0.05; **, P < 0.01). Pooled data are shown. PET, Polyethylene terephthalate.

 
Overexpression of either WT or RGE IGFBP-2 dramatically increased SHEP cell invasion throughout ECM-coated membranes by 2- to 3-fold over that of the SHEP cell controls (native P < 0.01, RGE P < 0.05, Fig. 6Go, B and C). In contrast, invasion of SHEP cell clones expressing the HBD-IGFBP-2 mutant was significantly decreased by approximately 50–70%, compared with that of the control-SHEP cells (Fig. 6Go, B and C). Thus, an intact HBD is required for IGFBP-2 to enhance neuroblastoma cell migration, whether IGFBP-2 is added exogenously or overexpressed.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
IGFBP-2 is one of the most commonly and highly expressed IGFBPs in neoplasms of the nervous system (6, 9, 10, 11, 12, 13, 14) including neuroblastomas (17, 36, 37, 38, 39). IGFBP-2 may inhibit or potentiate IGF actions (2, 4, 5, 6), and some of the effects of IGFBP-2 in tumor cells may also involve IGF-independent mechanisms (2, 5, 7, 8). IGFBP-2 is often found to be cell associated in tumors (2, 5, 8, 17) via interaction involving cell membrane PGs (15) or integrin receptors (5, 8). In the present report, we extended these studies by specifically mutating the HBD and RGD motifs of IGFBP-2 to determine their roles in IGFBP-2 binding to ECM and proliferation, migration, and invasion of neuroblastoma cells. We have demonstrated for the first time that mutation of the HBD but not the RGD motif inhibits binding of IGFBP-2 to a range of ECM components, known to be expressed by neuroblastoma and other cancer cells (40, 41, 42, 43, 44). These results are consistent with those previously reported for IGFBP-3 and/or IGFBP-5 binding to ECM (28, 29, 30, 31, 32, 45, 46, 47). However, the HBDs of these IGFBPs, involved in these interactions, are located in their C-terminal domains, whereas the HBD in IGFBP-2, which we have mutated in this studies, is located in the linker region (48). Furthermore, we have demonstrated for the first time the functional role of the HBD of IGFBP-2, namely in control of neuroblastoma proliferation, migration, and invasion.

IGFBPs are important modulators of IGF actions, with in vitro studies providing evidence for both inhibitory and enhancing effects. Circulating IGFBPs are inhibitory by reducing available free IGFs, and overexpression of IGFBP-2 in vivo negatively regulates postnatal growth, including brain growth, in rodents (4). There is significant evidence that IGFBPs may enhance IGF actions when cell surface associated (2). A number of in vitro studies have demonstrated association of IGFBPs with the ECM or cell surface via glycoproteins (IGFBP-5), collagens, integrins (IGFBP-1, -2) and proteoglycans (IGFBP-2, -3) (2). IGFBPs retain the ability to bind IGF-I in these locations (2, 5, 8, 18, 27), although their affinities may be reduced (15). The presence of these additional nonreceptor IGF-I binding sites for IGFs on the cell surface or in ECM suggests a role for IGFBPs in controlling IGF-I bioavailability in the pericellular space and thereby regulating receptor targeting of IGF-I. Thus, pericellular localization of IGFBP-2 might be important for potentiation of IGF-mediated procarcinogenic actions.

Many studies suggest that IGFBP-2 enhances IGF actions in pathological states, and it has been shown that IGFBP-2 expression correlates with tumor aggressiveness in many cancers, including neoplasia of the nervous system (6, 10, 11, 12, 13, 14, 49, 50, 51, 52)

Because free or pericellular bound IGFBP-2 might differentially affect cell growth, we aimed to determine whether exogenous addition or overexpression of IGFBP-2 would regulate neuroblastoma cell proliferation. Addition of IGFBP-2 (SHEP cells preincubated with exogenous IGFBP-2 prior to IGF-I addition or simultaneous addition of IGFBP-2 and IGF-I to SHEP cells) resulted in inhibition of IGF-stimulated neuroblastoma cell growth. This effect was independent of HBD motif. However, overexpression of IGFBP-2 with a functional HBD (WT or RGE-IGFBP-2) in neuroblastoma cells resulted in dramatically enhanced cell proliferation, whereas overexpression of the HBD-IGFBP-2 mutant, with reduced binding to ECM components, did not result in any growth advantage. This suggests that the growth inhibition of exogenous IGFBP-2 is entirely explained by its sequestration of IGF-I because the mutants have similar IGF-I binding affinity to native IGFBP-2. In contrast, maintenance of cell survival and growth enhancement in the presence of IGF-I occurs only in the presence of an intact HBD domain, suggesting dependence association with pericellular matrix proteins and/or proteoglycans or glycosaminoglycans at the cell surface.

A potential role of the HBD in enhanced cell proliferation is also supported by studies in zebrafish-IGFBP-2 (53) that, unlike mammalian IGFBP-2 (2), lacks the HBD and does not bind to the cell surface. Absence of this structural domain, as in our HBD-IGFBP-2 mutant, was suggested to account for the loss of IGF-I stimulated DNA synthesis and loss of IGF-induced cell proliferation in zebrafish-IGFBP-2 overexpressing Chinese hamster ovary cells (53). Whereas in these (53) and our present studies, reduced mitogenic activity of IGF-I is likely to involve loss of IGFBP-2-mediated targeting of IGF-I to its receptor, the maintenance of cell survival by overexpression of WT-IGFBP-2 in the absence of exogenous IGF-I may represent an IGF-independent effect. An alternative explanation for the different effects observed between addition of exogenous IGFBP-2 and overexpressed IGFBP-2 on cell proliferation may be that localization of IGFBP-2 to the pericellular matrix requires appropriate secretion-related cues. Finally, it is possible that IGFBP-2 exerts specific intracellular effects (54), which are dependent on the presence of an intact HBD domain. Future IGFBP-2 biosynthetic studies should allow this issue to be specifically addressed.

Furthermore, in contrast to the effects on proliferation, addition, or overexpression of native or RGE-IGFBP-2 significantly enhanced invasion of neuroblastoma cells, whereas HBD-IGFBP-2 overexpression strongly inhibited SHEP neuroblastoma cell invasion. These results suggest that a functional HBD in IGFBP-2 is required for modulation of this process. It is well established that components of the ECM and proteoglycans play a key role in migration of many cell types, including cancer cells (44, 55, 56). The ECM is a reservoir of cell binding proteins and growth factors that affect both normal and tumor cell behavior (43, 44, 55, 56, 57, 58, 59, 60). Specifically, a major function for cell surface proteoglycans is modulating cell adhesion and migration (59, 60, 61). These dynamic processes are mediated through interactions between the proteoglycan-glycosaminoglycan chains and ECM components such as laminin, collagen, and fibronectin. It is therefore likely that IGFBP-2 directly or indirectly modulates these events via interactions with cell membrane-associated proteoglycans or ECM components.

Recent work from Pereira et al. (5) shows that IGFBP-2 interacts with the {alpha}Vß3-integrin but that this is RGD independent. Furthermore, Pereira’s report shows that {alpha}Vß3 inhibits IGF-mediated breast cancer cell migration by a mechanism involving IGFBP-2 and that vitronectin can reverse this inhibition (5). Pereira proposes that IGFBP-2 is the negative signal, inhibiting IGF-mediated breast cancer cell migration, displaced by vitronectin. Interestingly, we have here shown that IGFBP-2 binds ECM components including vitronectin, most likely via the HBD domain, because our HBD-IGFBP-2 mutant has reduced binding for vitronectin. Whether a similar disintegrin-like mechanism proposed by the report by Pereira et al. (5) modulates migration of neuroblastoma cells overexpressing wild-type IGFBP-2 but impaired in SHEP cells overexpressing HBD-IGFBP-2 (reduced binding for vitronectin) is not clear. However, we believe it is unlikely that such mechanisms (5) account for our findings of enhanced proliferation in the presence of IGFBP-2 overexpression, compared with the nonexpressing SHEP cells. If the Pereira-proposed mechanism (5) were operating, then we would expect that IGFBP-2 overexpression (leading to its binding to vitronectin in the ECM) would result in no greater IGF-induced proliferation than the SHEP cells control (which does not express IGFBP-2).

The migratory behavior of cells is fundamental to tumor metastasis. One of the major features of metastatic cells is the reorganization of specific membrane components (e.g. integrin receptors, proteoglycans) and activation of specific enzymatic processes (e.g. matrix proteases) that allow cell migration and invasion through the ECM (43, 59, 60, 62). IGFBP-2 appears to be involved in metastatic processes in meningiomas (63), prostate cancer (6, 64), ovarian cancer (65), melanocytic lesions (14), and gliomas (7, 9). IGFBP-2 contributes to glioma progression in part by enhancing matrix metalloprotease-2 gene transcription and tumor cell invasion (9).

Recent work from Song et al. (7) has shown that IGFBP-2 overexpression increased invasion of glioma cells and that invasion inhibitory protein 45 (IIp45) binding to IGFBP-2 antagonizes this effect. It was suggested that the mechanisms of inhibition of IGFBP-2-mediated cell invasion involved interaction of IIp45 with a region of IGFBP-2, the thyroglobulin type-1 motif (66, 67). It is thus possible that, in studies by Song et al. (7), IIp45 induces displacement or prevents interaction of IGFBP-2 with the cell surface or ECM. Our results showed that IGFBP-2 with a mutated HBD has reduced ability to bind ECM components and inhibits migration and invasion of neuroblastoma cells. It is therefore likely that our findings point to the mechanism underlying the observations by Song et al. and others (7, 9) examining the potential role of IGFBP-2 in cell migration and invasion.

We therefore propose that the HBD is involved in a number of key biological functions of IGFBP-2: 1) interaction with components of the peri- and extracellular matrix; 2) pericellular sequestration and targeting of local IGF-I in control of cellular growth; and 3) activation of invasive and metastatic processes.

In conclusion, we have demonstrated in vitro in neuroblastoma cells that IGFBP-2 interacts with components of the ECM via its HBD. Furthermore, IGFBP-2 enhances neuroblastoma cell migration and invasion, a function that directly or indirectly uses the HBD. Because the RGE mutant behaved in a similar fashion to native IGFBP-2 in all assays performed, the RGD sequence is not involved in binding to ECM components, proliferation, or invasion. Our novel findings thus point to a key functions for the HBD of IGFBP-2 in the control and regulation of a number of developmental and disease process of the nervous system including neuroblastoma growth and migration. Our studies therefore significantly contribute to understanding the mechanisms whereby IGFBP-2 may enhance tumor growth and metastasis. This information will provide the potential for rational therapeutic manipulation of the procarcinogenic activities of IGFBP-2 in neuroblastoma and other related malignancies.


   Acknowledgments
 
We thank Dr. Daniel Mikol and Dr. Eva Feldman (Department of Neurology, University of Michigan, Ann Arbor, MI) for their technical advice and support. We also thank Mr. David Cossens and Ms. Femke Heijma, from our laboratories, for their technical assistance.


   Footnotes
 
This work was supported by Grant 209067 from the National Health and Medical Research Council of Australia (to V.C.R., G.A.W., and L.A.B.) and by Grant KFO-128 from the Deutsche Forschungsgemeinschaft (DFG) (to A.H.).

The results of these studies were presented in part at the 12th International Conference of Endocrinology, Lisbon, Portugal, 2004.

First Published Online June 30, 2005

1 V.C.R. and B.S.S. equally contributed to these studies. Back

Abbreviations: ECM, Extracellular matrix; FCS, fetal calf serum; h, human; HBD, heparin binding domain; IGFBP, IGF binding protein; IIp45, invasion inhibitory protein 45; LBB, ligand binding buffer; NBB, naphthalene blue black; NS, nonspecific binding; PG, proteoglycan; RGD, arginine-glycine-aspartic acid; RGE, arginine-glycine-glutamic acid; SBB, solid-phase binding buffer; SFM, serum-free media; SHEP, human neuroblastoma SK-N-SHEP; WLB, Western ligand blotting; WT, wild type.

Received April 20, 2005.

Accepted for publication June 23, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jones JI, Clemmons DR 1995 Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev. 16:3–34
  2. Firth SM, Baxter RC 2002 Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev. 23:824–854
  3. Hoeflich A, Schmidt P, Foll J, Rottmann O, Weber MM, Kolb HJ, Pirchner F, Wolf E 1998 Altered growth of mice divergently selected for body weight is associated with complex changes in the growth hormone/insulin-like growth factor system. Growth Horm IGF Res. 8:113–123
  4. Hoeflich A, Wu M, Mohan S, Foll J, Wanke R, Froehlich T, Arnold GJ, Lahm H, Kolb HJ, Wolf E 1999 Overexpression of insulin-like growth factor-binding protein-2 in transgenic mice reduces postnatal body weight gain. Endocrinology 140:5488–5496[Abstract/Free Full Text]
  5. Pereira JJ, Meyer T, Docherty SE, Reid HH, Marshall J, Thompson EW, Rossjohn J, Price JT 2004 Bimolecular interaction of insulin-like growth factor (IGF) binding protein-2 with {alpha}vß3 negatively modulates IGF-I-mediated migration and tumor growth. Cancer Res. 64:977–984
  6. Moore MG, Wetterau LA, Francis MJ, Peehl DM, Cohen P 2003 Novel stimulatory role for insulin-like growth factor binding protein-2 in prostate cancer cells. Int J Cancer 105:14–19[CrossRef][Medline]
  7. Song SW, Fuller GN, Khan A, Kong S, Shen W, Taylor E, Ramdas L, Lang FF, Zhang W 2003 IIp45, an insulin-like growth factor binding protein 2 (IGFBP-2) binding protein, antagonizes IGFBP-2 stimulation of glioma cell invasion. Proc Natl Acad Sci USA. 100:13970–13975
  8. Schutt BS, Langkamp M, Rauschnabel U, Ranke MB, Elmlinger MW 2004 Integrin-mediated action of insulin-like growth factor binding protein-2 in tumor cells. J Mol Endocrinol. 32:859–868
  9. Wang H, Shen W, Huang H, Huang H, Hu L, Ramdas L, Zhou YH, Liao WS, Fuller GN, Zhang W 2003 Insulin-like growth factor binding protein 2 enhances glioblastoma invasion by activating invasion-enhancing genes. Cancer Res. 63:4315–4321
  10. Zhang W, Wang H, Song SW, Fuller GN 2002 Insulin-like growth factor binding protein 2: gene expression microarrays and the hypothesis-generation paradigm. Brain Pathol. 12:87–94
  11. Sallinen SL, Sallinen PK, Haapasalo HK, Helin HJ, Helen PT, Schraml P, Kallioniemi OP, Kononen J 2000 Identification of differentially expressed genes in human gliomas by DNA microarray and tissue chip techniques. Cancer Res. 60:6617–6622
  12. Nordqvist AC, Peyrard M, Pettersson H, Mathiesen T, Collins VP, Dumanski JP, Schalling M 1997 A high ratio of insulin-like growth factor II/insulin-like growth factor binding protein 2 messenger RNA as a marker for anaplasia in meningiomas. Cancer Res. 57:2611–2614
  13. Elmlinger MW, Deininger MH, Schuett BS, Meyermann R, Duffner F, Grote EH, Ranke MB 2001 In vivo expression of insulin-like growth factor-binding protein-2 in human gliomas increases with the tumor grade. Endocrinology 142:1652–1658[Abstract/Free Full Text]
  14. Wang H, Shen SS, Diwan AH, Zhang W, Fuller GN, Prieto VG 2003 Expression of insulin-like growth factor-binding protein 2 in melanocytic lesions. J Cutan Pathol. 30:599–605
  15. Russo VC, Bach LA, Fosang AJ, Baker NL, Werther GA 1997 Insulin-like growth factor binding protein-2 binds to cell surface proteoglycans in the rat brain olfactory bulb. Endocrinology 138:4858–4867[Abstract/Free Full Text]
  16. Cardin AD, Weintraub HJ 1989 Molecular modeling of protein-glycosaminoglycan interactions. Arteriosclerosis 9:21–32[Abstract/Free Full Text]
  17. Russo VC, Rekaris G, Baker NL, Bach LA, Werther GA 1999 Basic fibroblast growth factor induces proteolysis of secreted and cell membrane-associated insulin-like growth factor binding protein-2 in human neuroblastoma cells. Endocrinology 140:3082–3090[Abstract/Free Full Text]
  18. Kricker JA, Towne CL, Firth SM, Herington AC, Upton Z 2003 Structural and functional evidence for the interaction of insulin-like growth factors (IGFs) and IGF binding proteins with vitronectin. Endocrinology 144:2807–2815[Abstract/Free Full Text]
  19. Marinaro JA, Neumann GM, Russo VC, Leeding KS, Bach LA 2000 O-glycosylation of insulin-like growth factor (IGF) binding protein-6 maintains high IGF-II binding affinity by decreasing binding to glycosaminoglycans and susceptibility to proteolysis. Eur J Biochem. 267:5378–5386
  20. Ruoslahti E, Pierschbacher MD 1987 New perspectives in cell adhesion: RGD and integrins. Science 238:491–497[Abstract/Free Full Text]
  21. Hoeflich A, Reisinger R, Vargas GA, Elmlinger MW, Schuett B, Jehle PM, Renner-Muller I, Lahm H, Russo VC, Wolf E 2002 Mutation of the RGD sequence does not affect plasma membrane association and growth inhibitory effects of elevated IGFBP-2 in vivo. FEBS Lett. 523:63–67
  22. van Golen CM, Castle VP, Feldman EL 2000 IGF-I receptor activation and BCL-2 overexpression prevent early apoptotic events in human neuroblastoma. Cell Death Differ. 7:654–665
  23. Russo VC, Kobayashi K, Najdovska S, Baker NL, Werther GA 2004 Neuronal protection from glucose deprivation via modulation of glucose transport and inhibition of apoptosis: a role for the insulin-like growth factor system. Brain Res. 1009:40–53
  24. Hossenlopp P, Seurin D, Segovia-Quinson B, Hardouin S, Binoux M 1986 Analysis of serum insulin-like growth factor binding proteins using Western blotting: use of the method for titration of the binding proteins and competitive binding studies. Anal Biochem. 154:138–143
  25. Elmlinger MW, Wimmer K, Biemer E, Blum WF, Ranke MB, Dannecker GE 1996 Insulin-like growth factor binding protein 2 is differentially expressed in leukaemic B- and T-cell lines. Growth Regul. 6:152–157
  26. Ho PJ, Baxter RC 1997 Characterization of truncated insulin-like growth factor-binding protein-2 in human milk. Endocrinology 138:3811–3818[Abstract/Free Full Text]
  27. McCaig C, Perks CM, Holly JM 2002 Intrinsic actions of IGFBP-3 and IGFBP-5 on Hs578T breast cancer epithelial cells: inhibition or accentuation of attachment and survival is dependent upon the presence of fibronectin. J Cell Sci. 115:4293–4303
  28. Booth BA, Boes M, Andress DL, Dake BL, Kiefer MC, Maack C, Linhardt RJ, Bar K, Caldwell EE, Weiler J, Bar RS 1995 IGFBP-3 and IGFBP-5 association with endothelial cells: role of C-terminal heparin binding domain. Growth Regul. 5:1–17
  29. Gui Y, Murphy LJ 2001 Insulin-like growth factor (IGF)-binding protein-3 (IGFBP-3) binds to fibronectin (FN): demonstration of IGF-I/IGFBP-3/fn ternary complexes in human plasma. J Clin Endocrinol Metab. 86:2104–2110
  30. Nam T, Moralez A, Clemmons D 2002 Vitronectin binding to IGF binding protein-5 (IGFBP-5) alters IGFBP-5 modulation of IGF-I actions. Endocrinology 143:30–36[Abstract/Free Full Text]
  31. Arai T, Clarke J, Parker A, Busby Jr W, Nam T, Clemmons DR 1996 Substitution of specific amino acids in insulin-like growth factor (IGF) binding protein 5 alters heparin binding and its change in affinity for IGF-I response to heparin. J Biol Chem. 271:6099–6106
  32. Firth SM, Ganeshprasad U, Baxter RC 1998 Structural determinants of ligand and cell surface binding of insulin-like growth factor-binding protein-3. J Biol Chem. 273:2631–2638
  33. Janet T, Ludecke G, Otten U, Unsicker K 1995 Heterogeneity of human neuroblastoma cell lines in their proliferative responses to basic FGF, NGF, and EGF: correlation with expression of growth factors and growth factor receptors. J Neurosci Res. 40:707–715
  34. Russo VC, Metaxas S, Kobayashi K, Harris M, Werther GA 2004 Anti-apoptotic effects of leptin in human neuroblastoma cells. Endocrinology 145:4103–4112[Abstract/Free Full Text]
  35. Hoeflich A, Fettscher O, Preta G, Lahm H, Kolb HJ, Wolf E, Weber MM 2003 Increased activity of catalase in tumor cells overexpressing IGFBP-2. Horm Metab Res. 35:816–821
  36. Babajko S, Binoux M 1996 Modulation by retinoic acid of insulin-like growth factor (IGF) and IGF binding protein expression in human SK-N-SH neuroblastoma cells. Eur J Endocrinol. 134:474–480
  37. Martin DM, Feldman EL 1993 Regulation of insulin-like growth factor-II expression and its role in autocrine growth of human neuroblastoma cells. J Cell Physiol. 155:290–300
  38. Matthews CC, Feldman EL 1996 Insulin-like growth factor I rescues SH-SY5Y human neuroblastoma cells from hyperosmotic induced programmed cell death. J Cell Physiol. 166:323–331
  39. Russo VC, Andaloro E, Fornaro SA, Najdovska S, Newgreen DF, Bach LA, Werther GA 2004 Fibroblast growth factor-2 over-rides insulin-like growth factor-I induced proliferation and cell survival in human neuroblastoma cells. J Cell Physiol. 199:371–380
  40. Scarpa S, Modesti A, Triche TJ 1987 Extracellular matrix synthesis by undifferentiated childhood tumor cell lines. Am J Pathol. 129:74–85
  41. Hutchinson R, Fligiel S, Appleyard J, Varani J, Wicha M 1989 Attachment of neuroblastoma cells to extracellular matrix: correlation with metastatic capacity. J Lab Clin Med. 113:561–568
  42. Gladson CL, Dennis C, Rotolo TC, Kelly DR, Grammer JR 1997 Vitronectin expression in differentiating neuroblastic tumors: integrin {alpha}vß5 mediates vitronectin-dependent adhesion of retinoic-acid-differentiated neuroblastoma cells. Am J Pathol. 150:1631–1646
  43. Stewart DA, Cooper CR, Sikes RA 2004 Changes in extracellular matrix (ECM) and ECM-associated proteins in the metastatic progression of prostate cancer. Reprod Biol Endocrinol. 2:2
  44. DeClerck YA, Mercurio AM, Stack MS, Chapman HA, Zutter MM, Muschel RJ, Raz A, Matrisian LM, Sloane BF, Noel A, Hendrix MJ, Coussens L, Padarathsingh M 2004 Proteases, extracellular matrix, and cancer: a workshop of the path B study section. Am J Pathol. 164:1131–1139
  45. Campbell PG, Andress DL 1997 Insulin-like growth factor (IGF)-binding protein-5-(201–218) region regulates hydroxyapatite and IGF-I binding. Am J Physiol. 273:E1005–E1013
  46. Nam TJ, Busby Jr W, Clemmons DR 1997 Insulin-like growth factor binding protein-5 binds to plasminogen activator inhibitor-I. Endocrinology 138:2972–2978[Abstract/Free Full Text]
  47. Nam TJ, Busby Jr WH, Rees C, Clemmons DR 2000 Thrombospondin and osteopontin bind to insulin-like growth factor (IGF)-binding protein-5 leading to an alteration in IGF-I-stimulated cell growth. Endocrinology 141:1100–1106[Abstract/Free Full Text]
  48. Shimasaki S, Ling N 1991 Identification and molecular characterization of insulin-like growth factor binding proteins (IGFBP-1, -2, -3, -4, -5 and -6). Prog Growth Factor Res. 3:243–266
  49. Korc-Grodzicki B, Ren N, Hilf R 1996 Effects of estradiol on the expression and production of IGFBP-2 by R3230AC mammary tumor cells. Oncol Res. 8:473–483
  50. Ho PJ, Baxter RC 1997 Insulin-like growth factor-binding protein-2 in patients with prostate carcinoma and benign prostatic hyperplasia. Clin Endocrinol (Oxf). 46:333–342
  51. Tennant MK, Thrasher JB, Twomey PA, Birnbaum RS, Plymate SR 1996 Insulin-like growth factor-binding protein-2 and -3 expression in benign human prostate epithelium, prostate intraepithelial neoplasia, and adenocarcinoma of the prostate. J Clin Endocrinol Metab. 81:411–420
  52. Mohnike KL, Kluba U, Mittler U, Aumann V, Vorwerk P, Blum WF 1996 Serum levels of insulin-like growth factor-I, -II and insulin-like growth factor binding proteins -2 and -3 in children with acute lymphoblastic leukaemia. Eur J Pediatr. 155:81–86
  53. Duan C, Ding J, Li Q, Tsai W, Pozios K 1999 Insulin-like growth factor binding protein 2 is a growth inhibitory protein conserved in zebrafish. Proc Natl Acad Sci USA. 96:15274–15279
  54. Hoeflich A, Reisinger R, Schuett BS, Elmlinger MW, Russo VC, Vargas GA, Jehle PM, Lahm H, Renner-Muller I, Wolf E 2004 Peri/nuclear localization of intact insulin-like growth factor binding protein-2 and a distinct carboxyl-terminal IGFBP-2 fragment in vivo. Biochem Biophys Res Commun. 324:705–710
  55. Liotta LA 2001 An attractive force in metastasis. Nature 410:24–25[CrossRef][Medline]
  56. Liotta LA, Kohn EC 2001 The microenvironment of the tumour-host interface. Nature 411:375–379[CrossRef][Medline]
  57. Jin H, Varner J 2004 Integrins: roles in cancer development and as treatment targets. Br J Cancer. 90:561–565
  58. Ramnath N, Creaven PJ 2004 Matrix metalloproteinase inhibitors. Curr Oncol Rep. 6:96–102
  59. Zhang D, Samani AA, Brodt P 2003 The role of the IGF-I receptor in the regulation of matrix metalloproteinases, tumor invasion and metastasis. Horm Metab Res. 35:802–808
  60. Nagle RB 2004 Role of the extracellular matrix in prostate carcinogenesis. J Cell Biochem. 91:36–40
  61. Jackson RL, Busch SJ, Cardin AD 1991 Glycosaminoglycans: molecular properties, protein interactions, and role in physiological processes. Physiol Rev. 71:481–539
  62. Hojilla CV, Mohammed FF, Khokha R 2003 Matrix metalloproteinases and their tissue inhibitors direct cell fate during cancer development. Br J Cancer 89:1817–1821[CrossRef][Medline]
  63. Nordqvist AC, Mathiesen T 2002 Expression of IGF-II, IGFBP-2, -5, and -6 in meningiomas with different brain invasiveness. J Neurooncol 57:19–26[CrossRef][Medline]
  64. Shariat SF, Lamb DJ, Kattan MW, Nguyen C, Kim J, Beck J, Wheeler TM, Slawin KM 2002 Association of preoperative plasma levels of insulin-like growth factor I and insulin-like growth factor binding proteins-2 and -3 with prostate cancer invasion, progression, and metastasis. J Clin Oncol. 20:833–841
  65. Baron-Hay S, Boyle F, Ferrier A, Scott C 2004 Elevated serum insulin-like growth factor binding protein-2 as a prognostic marker in patients with ovarian cancer. Clin Cancer Res. 10:1796–1806
  66. Fowlkes JL, Thrailkill KM, George-Nascimento C, Rosenberg CK, Serra DM 1997 Heparin-binding, highly basic regions within the thyroglobulin type-1 repeat of insulin-like growth factor (IGF)-binding proteins (IGFBPs) -3, -5, and -6 inhibit IGFBP-4 degradation. Endocrinology 138:2280–2285[Abstract/Free Full Text]
  67. Headey SJ, Keizer DW, Yao S, Brasier G, Kantharidis P, Bach LA, Norton RS 2004 C-terminal domain of insulin-like growth factor binding protein-6: structure and interaction with insulin-like growth factor-II. Mol Endocrinol. 18:2740–2750



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
T. Yazawa, H. Sato, H. Shimoyamada, K. Okudela, T. Woo, M. Tajiri, T. Ogura, N. Ogawa, T. Suzuki, H. Mitsui, et al.
Neuroendocrine Cancer-Specific Up-Regulating Mechanism of Insulin-Like Growth Factor Binding Protein-2 in Small Cell Lung Cancer
Am. J. Pathol., September 1, 2009; 175(3): 976 - 987.
[Abstract] [Full Text] [PDF]

Home page
 Neuro Oncol DukeHome page
A. Pezzolo, E. Rossi, S. Gimelli, F. Parodi, F. Negri, M. Conte, A. Pistorio, A. Sementa, V. Pistoia, O. Zuffardi, et al.
Presence of 1q gain and absence of 7p gain are new predictors of local or metastatic relapse in localized resectable neuroblastoma
Neuro-oncol, January 1, 2009; 11(2): 192 - 200.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
D. Kiepe, A. Van Der Pas, S. Ciarmatori, L. Standker, B. Schutt, A. Hoeflich, U. Hugel, J. Oh, and B. Tonshoff
Defined Carboxy-Terminal Fragments of Insulin-Like Growth Factor (IGF) Binding Protein-2 Exert Similar Mitogenic Activity on Cultured Rat Growth Plate Chondrocytes as IGF-I
Endocrinology, October 1, 2008; 149(10): 4901 - 4911.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Fu, J. A. Thompson, and L. A. Bach
Promotion of Cancer Cell Migration: AN INSULIN-LIKE GROWTH FACTOR (IGF)-INDEPENDENT ACTION OF IGF-BINDING PROTEIN-6
J. Biol. Chem., August 3, 2007; 282(31): 22298 - 22306.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J. D. Blais, C. L. Addison, R. Edge, T. Falls, H. Zhao, K. Wary, C. Koumenis, H. P. Harding, D. Ron, M. Holcik, et al.
Perk-Dependent Translational Regulation Promotes Tumor Cell Adaptation and Angiogenesis in Response to Hypoxic Stress
Mol. Cell. Biol., December 15, 2006; 26(24): 9517 - 9532.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
K. W Frommer, K. Reichenmiller, B. S Schutt, A. Hoeflich, M. B Ranke, G. Dodt, and M. W Elmlinger
IGF-independent effects of IGFBP-2 on the human breast cancer cell line Hs578T.
J. Mol. Endocrinol., August 1, 2006; 37(1): 13 - 23.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. Fornoni, S. A. Rosenzweig, O. Lenz, A. Rivera, G. E. Striker, and S. J. Elliot
Low Insulin-Like Growth Factor Binding Protein-2 Expression Is Responsible for Increased Insulin Receptor Substrate-1 Phosphorylation in Mesangial Cells from Mice Susceptible to Glomerulosclerosis
Endocrinology, July 1, 2006; 147(7): 3547 - 3554.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
C. Fottner, T. Minnemann, S. Kalmbach, and M. M Weber
Overexpression of the insulin-like growth factor I receptor in human pheochromocytomas.
J. Mol. Endocrinol., April 1, 2006; 36(2): 279 - 287.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russo, V. C.
Right arrow Articles by Werther, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russo, V. C.
Right arrow Articles by Werther, G. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
Medline Plus Health Information
*Neuroblastoma

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals