| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Lilly Research Laboratories (A.K., Y.B.C., M.M., A.F., P.A.G.-D., J.E.H., D.L., D.D.Y., J.G.H., S.R.J., P.E.), Eli Lilly & Company, Indianapolis, Indiana 46285; and Millennium Pharmaceutical Inc. (Y.Q., C.C.F.), Cambridge, Massachusetts 02139
Address all correspondence and requests for reprints to: Anja Köster, Lilly Research Laboratories, Eli Lilly & Company, Indianapolis, Indiana 46225. E-mail: koester_anja{at}lilly.com.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
LPL is an endothelium-associated enzyme that hydrolyzes the triacylglycerol component of circulating chylomicrons and very low-density lipoproteins (VLDL), resulting in the production of nonesterified fatty acids and 2-monoacylglycerol for tissue use (13, 14). LPL is known to play a central role in overall lipid metabolism and is associated with several pathophysiological conditions such as atherosclerosis, obesity, and diabetes (13, 14, 15). Administration of recombinant Angptl3 or Angptl4 protein to mice mediates hypertriglyceridemia, presumably through inhibition of LPL (4, 16). The KK/San mouse is a natural Angptl3-deficient mouse strain due to a stop mutation in the coding region of the Angptl3 gene (designated as the hypl mutation). It is hypolipidemic on an obese, diabetic background (16). Also, these mice have significantly lower plasma free fatty acids, and Angptl3 has been shown to activate lipolysis in adipocytes as a mechanism for this effect (17).
Angptl3 and Angptl4 are thought to represent a new class of molecules that modulate lipid metabolism by regulation of VLDL triglyceride levels through inhibition of LPL activity. In this study, we have taken a genetic approach to evaluate the function of these proteins in mice. We have generated targeted disruptions of both, Angptl3 and Angptl4 as well as transgenics overexpressing Angptl4 in the liver and examined the effects of these genotypes on lipid metabolism and postheparin plasma (PHP) LPL activity in both fed and fasted nutritional states. Our data provide strong evidence that these proteins are important regulators of VLDL triglyceride levels in vivo and suggest that both proteins play a role in the nutritional regulation of LPL activity.
| Materials and Methods |
|---|
|
|
|---|
Generation of Angptl4 transgenic mice
The human apolipoprotein (Apo) E promoter including its hepatic control region (18) was used to express the human Angptl4 cDNA in transgenic mice. B6SJL eggs were injected by standard microinjection methods (19). Transgenic mice were identified by PCR with transgene-specific primers, and transgene expression was confirmed by real-time quantitative PCR from liver RNA. Transgenic mice were mated to C57BL/6 mice (Taconic Farms, Germantown, NY).
Generation of Angptl4-deficient mice
The genomic sequence of Angptl4 could be directly extracted from GenBank (accession no. AF 110520.1). The targeting vector deleted 2.05 kb of the endogenous gene including most of exon 1 containing the start codon and the signal peptide and exons 2 and 3. Homologous recombination in E14129/Ola embryonic stem cells was performed according to standard procedures as described (20). Homologous recombination was confirmed by Southern blot analysis using a 3' external probe and a 5' external probe, respectively. Three positive clones were identified and microinjected into C57BL/6 blastocysts. Male chimeric founders were mated to C57BL/6 females, and agouti-coated offspring were analyzed for germ line transmission of the Angptl4 mutation by Southern blot. 129B6F2 littermates were used for all experiments.
Generation of Angptl3-deficient mice
The sequence of Angptl3 exon 1 (NM_013913) was used as a probe to isolate mouse genomic DNA clones corresponding to the Angptl3 locus from a
-Fix II phage library prepared from mouse strain 129/SvJ (Stratagene Inc., La Jolla, CA). The targeting vector deleted 1.3 kb of the gene including the exon 1 containing the start codon. Homologous recombination and blastocyst injection were done as described for Angptl4-deficient mice except R1 embryonic stem cells were used for gene targeting. All experiments were performed on 129B6F2 hybrid mice.
Western analysis
Plasma samples for Western analysis were collected in EDTA tubes containing protease inhibitors (Complete mini-protease inhibitor cocktail tablets, Roche Diagnostics, Indianapolis, IN). The polyclonal rabbit antibody was raised against peptide (residues 5265; GQGLREHAERTRSQ) of the human sequence (2) and purified by affinity chromatography with the antigen.
Northern blot analysis
Livers from wild-type and Angptl3-deficient mice were used for total RNA preparation with the TRIzol reagent according to the manufacturers instructions (Invitrogen, Carlsbad, CA). Northern blot analysis was performed with PolyA+ RNA, which was obtained from the total RNA using Oligotex (QIAGEN, Santa Clarita, CA). The probe for the Northern blot was a PCR-amplified, 253-bp fragment corresponding to nucleotides 554806 of the murine Angptl3 cDNA. The primers used were: SF3F2, 5'-AGAACAGCAAGACAACAGCATAAGA-3' and SF3B2, 5'-TCTGTTATAAACGGCAGAGCAGTCG-3', respectively. The probe was labeled with 32P d-CTP and hybridization was performed according to the manufacturers instructions (Clontech, Palo Alto, CA). The same blot was stripped and reprobed with ß-actin as a quantity control. Northern blot analysis of Angptl4 knockout mice was performed using total RNA from white adipose tissue isolated from wild-type, heterozygous, and homozygous Angptl4 knockout mice. A 700-bp Angptl4 cDNA fragment spanning exons 15 was used as probe. As control the blot was stripped and reprobed with ß-actin.
Lipoprotein analysis by fast protein liquid chromatography (FPLC)
The lipoprotein distribution of plasma cholesterol was determined by FPLC. Briefly, plasma samples were injected onto Superose 6 HR column (Amersham Pharmacia Biotech AB, Uppsala, Sweden) at a flow rate of 0.5 ml/min of PBS containing 5 mM EDTA. Cholesterol was assayed post column with the in-line addition of cholesterol reagent (Roche Diagnostics) at a flow rate of 0.12 ml/min. After passing through a 15-m reactor tubing at 37 C, lipoprotein components were detected at 505 nm with a spectrophotometer. Peak quantification was done with Turbochrom Professional software (PerkinElmer LLC, Norwalk, CT).
Analysis of LPL mRNA levels
Real-time quantitative PCR assays of LPL mRNA in murine fat was performed as previously described (21) with the following primer/probe set: AMF104, TGGATGAGCGACTCCTACTTCA; AMF105, CGGATCCTCTCGATGACGAA, AMF106FT CTGGCCCGACTGGTGGAGCAG (probe).
Analyses of serum and plasma samples
Plasma triglyceride and cholesterol levels were determined with a Hitachi 912 (Roche Diagnostics). Cholesterol levels were detected with the cholesterol esterase/cholesterol oxidase enzyme assay (Roche Diagnostics). Triglycerides were determined with the lipase assay enzyme kit (Roche Diagnostics). Blood glucose levels were determined with the Precision G instrument (Abbott Diagnostics, Abbott Park, IL).
Oral glucose tolerance testing
Oral glucose tolerance testing was performed as previously described (22)
Body mass composition analysis by nuclear magnetic resonance (NMR)
A wide-line NMR instrument (Echo-Bruker Instruments; Houston, TX) was used as described elsewhere (22).
Body mass composition analysis by dual-energy x-ray absorptiometry (DEXA) scan
A pDEXA forearm bone densitometer (Norland Medical Systems, White Plains, NY) was used to perform DEXA as previously described (23).
Expression and purification of mouse Angptl4
A HIS tag (sequence DIHHHHHH) was fused to the C terminus of the Angptl4 protein. Media from a stably transfected Chinese hamster ovary cell line were applied to a Ni-loaded iminodiacetic acid column (Amersham Bioscience, Fairfield, CT). The column was washed with 10 mM sodium phosphate, 150 mM sodium chloride buffer (pH 7.5) (PBS). Bound protein was eluted with a gradient from 0 to 0.5 M imidazole in PBS. Fractions were analyzed by SDS-PAGE from which the purity was assessed as greater than 90%. The identity of mAngptl4-his was confirmed by N-terminal sequence analysis.
LPL activity assays
The triolein/gum arabic assay for lipase activity was based on Henderson et al. (24). Substrate in the form of triolein emulsion in gum arabic was prepared by sonication in 0.2 M Tris saline buffer (pH 8.5). BSA and heat-inactivated rabbit serum was added after sonication. Free fatty acid released was separated from the substrate and diacylglycerol, according to Borensztajn et al. (25). The assay was carried out in the presence and absence of 1 M NaCl to determine hepatic lipase activity. Purified recombinant human LPL and hepatic lipase (HL) were used as standards. Apo CII peptide (residues 4479, Midwest Biotech, Fishers, IN) was used instead of Apo CII-containing serum. The final concentration of phosphatidylcholine, which is essential for the high potency of the Apo CII peptide, was 1 mM.
Statistics
Results were statistically evaluated with an unpaired Students t test (Microsoft Excel, Microsoft, Redmond, CA). P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
|
|
|
Angptl4 knockout (KO) mice are hypolipidemic and have elevated LPL activity
To further evaluate the function of Angptl4 in vivo, we generated Angptl4 KO mice. Homozygous Angptl4/ mice did not show any detectable Angptl4 mRNA in adipose tissue, its major endogenous site of expression (Fig. 1C
). Angptl4 KO mice were born at the expected Mendelian frequency, were fertile, and had a normal lifespan (up to 24 months) with no apparent phenotype or developmental abnormalities. There were no changes in plasma glucose, insulin, and leptin in KO mice, compared with wild-type mice (data not shown).
Plasma triglycerides in male Angptl4 KO mice in the fed state were reduced by 70%, but there was no change in females (Fig. 4A
). The mice were also studied in the fasted state because Angptl4 is up-regulated in wild-type mice by fasting (7), and we expected a stronger phenotype in fasted Angptl4 KO mice. In the fasted state, both male and female KO mice had significantly reduced plasma triglycerides (Fig. 4A
). In male KO mice, plasma triglyceride levels were reduced by nearly 90% relative to their wild-type controls, and female KO mice displayed a 65% reduction. Also, plasma cholesterol was decreased significantly in male KO mice in either nutritional state, but in females the decrease did not reach statistical significance (Fig. 4B
). Whereas there were no apparent differences in body weight of the KO mice at 2 and 6 months of age relative to wild-type mice, the striking reduction in serum triglycerides led us to evaluate body composition of the KO mice by NMR analysis. There were no significant differences in either fat or lean mass of KO mice at 6 months of age, whether fed chow or a high-fat diet for 15 wk (data not shown).
|
|
|
Angptl3-KO mice have hypolipidemia and elevated PHP LPL activity
The absence of Angptl3 mRNA in Angptl3/ mice was confirmed by Northern blot analysis from liver tissue (Fig. 1D
). Angptl3 KO mice had no gross abnormalities, were fertile, and exhibited no developmental abnormalities. Body weight and body composition determined by pDEXA scan at 5 months of age were not significantly different between the KO and wild-type mice in (not shown). Plasma cholesterol was significantly lower in males and females in fed and fasted states (Fig. 7B
). Furthermore, male and female Angptl3 KO mice displayed severe hypotriglyceridemia in the fed state (Fig. 7A
). Whereas female KO mice also displayed this phenotype in the fasted state, we did not observe the severe hypotriglyceridemic phenotype in fasted male Angptl3 KO mice. Because the effects of Angptl3 on plasma triglycerides were previously shown to be caused by an inhibition of LPL (3), we determined whether the differential effects on plasma triglycerides in fasted vs. fed Angptl3 KO males were related to changes in LPL activity. PHP LPL activity was approximately 9-fold higher in male Angptl3 KO, compared with male wild-type mice (Fig. 8
). In the fasted condition, there was no such increase, and, in fact, LPL activity was slightly decreased in the Angplt3 KO mice.
|
|
| Discussion |
|---|
|
|
|---|
The mechanism of plasma triglyceride regulation by the Angptl proteins involves the modulation of LPL activity. In mice lacking either Angptl3 or Angptl4, PHP LPL activity was increased, whereas LPL activity was very low in transgenic mice overexpressing Angptl4. Our in vitro experiments demonstrated that recombinant Angptl4 protein inhibits LPL activity directly, a property that it shares with Angptl3 (3). The increases in plasma triglycerides and VLDL cholesterol in our Angptl4 transgenic mice were likely due to reduced clearance of VLDL because it has been demonstrated that inhibition of LPL by the Angptl proteins results in delayed clearance of VLDL without impacting the VLDL production from the hepatocytes (3, 27). The Angptl3 and 4 KO mice, in contrast, displayed a hypolipidemic phenotype due to increased LPL activity, which likely increased clearance of VLDL from the circulation. Another potential cause for the detected low plasma triglyceride levels could be impaired intestinal lipid absorption. However, we observed that feeding the Angptl4 KO mice a high-fat diet (60% calories from fat) for 15 wk did not cause changes in body weight or body fat relative to wild-type littermates (Köster, A., A. Ford, and P. Eacho, unpublished data), which makes intestinal lipid malabsorption unlikely. Accordingly, both Angptl3 and Angptl 4 regulate circulating levels of triglycerides through inhibition of LPL, the major catabolic enzyme for triglycerides.
The activity of LPL in vivo is subject to tissue-specific regulation in response to changes in nutritional state (13). It is up-regulated in adipose tissue after feeding to promote the storage of triglycerides, in part through the actions of insulin. During fasting, when insulin levels are low, LPL activity is decreased in adipose tissue to promote the use of triglycerides by peripheral tissues. The short-term regulation of LPL activity in rodents is posttranscriptional in adipose and heart (28, 29), and inhibition of LPL activity in fasting adipose requires the expression of a distinct gene (30). Angptl4 expression is increased in adipose during fasting (8), making it a prime candidate for a gene product Bergö et al. (30) described that down-regulates LPL during periods of caloric restriction. This is supported by our observation that Angptl4 deficiency impacts LPL activity and triglycerides more significantly in fasted compared with fed mice. In contrast, the effects of Angptl3 deficiency on triglycerides and LPL activity were greater in the fed state. Thus, Angptl3, whose mRNA expression is not regulated by nutritional state in mouse liver (12), seems to have a more dominant role in LPL regulation during the postprandial period when Angptl4 levels are low. The important role of Angptl4 as a fasting-induced factor is also demonstrated by our observation that in mice lacking both proteins, the hypertriglyceridemic phenotype is most severe in the fasted state. A differential effect of nutritional state on the lipid levels and PHP LPL activity was observed for both KO lines but not the Angptl4 transgenic mice (not shown), most likely due to the already high overexpression of the protein and the lack of endogenous regulation of the Angptl4 transgene. We also observed some gender-related differences in the triglyceride phenotype of the Angptl3 and Angptl4 deficient mice dependent on the nutritional state (Figs. 4
and 7
). We have not explored the mechanism of these gender differences, but they may involve estrogen, which exerts transcriptional control over LPL expression (31).
Although both Angptl3 and Angptl4 inhibit LPL activity, they do not appear to be redundant proteins. We observed decreased triglyceride levels in mice deficient in either gene, which would not be expected if one gene assumed the function of the other. Thus the differential effects of nutritional status observed in the KO mice suggest distinct roles for the proteins. Angptl3 and Angptl4 would also be expected to have distinct roles in regulating triglyceride metabolism based on their sites of expression. Angptl4 is expressed primarily in adipose, which is rich in LPL, whereas Angptl3 is mainly expressed in the liver, an organ normally low in LPL. Yu et al. (10) speculated that proteolytic processing of Angptl4 into a truncated, active N-terminal coiled-coil domain, which circulates in plasma, is delayed in LPL-rich tissues like adipose due to a tethering effect to LPL. As a result, Angptl4 may not be readily released into the circulation and thus may function mostly in an autocrine/paracrine manner, regulating LPL locally in adipose. Consistent with this proposal was the finding that overexpression of Angptl4 in the heart, an LPL-rich organ, resulted in inhibition of LPL activity only in the heart (10). PHP LPL activity was not decreased by heart-specific Angptl4 overexpression, even though plasma triglycerides were increased by about the same magnitude we observed in our liver-specific Angptl4 transgenics. These findings demonstrate that the level of expression of LPL in the heart is sufficient to regulate systemic triglyceride levels and, apparently, to cause transgenically expressed Angptl4 to be retained in the heart to function locally in an autocrine/paracrine fashion. This is in contrast to the situation in our mice, in which transgenic Angptl4 was made in the LPL-low liver, presumably processed readily, and released into the circulation as a truncated, 35-kDa N-terminal fragment. This concept is consistent with the observations of Mandard et al. (9) that human adipose seems to produce exclusively unprocessed, full-length Angptl4, whereas human liver mainly produces the truncated protein. Thus, liver-expressed Angptl4 may function in an endocrine fashion and contributes to the regulation of LPL in adipose and potentially other tissues. It has been shown that Angptl3 is processed in a manner similar to Angptl4 (5). Thus, endogenous Angptl3, which is primarily made in mouse liver, may also be processed into the truncated form and function in an endocrine fashion.
The inhibition of LPL activity in Angptl4 transgenic mice resulted in a 2.6- to 3-fold increase in plasma triglycerides. Administration of Angptl4 by injection or adenoviral expression also resulted in increased plasma triglyceride levels, although the increase after adenoviral expression was much higher, probably due to higher transient expression levels of Angptl4. In all cases, the effect was modest, compared with the 30- to 50-fold elevation of plasma triglycerides observed in LPL knockout mice (32), suggesting only a partial inhibition of total LPL activity by Angptl3 or Angptl4.
Because adipose LPL facilitates the storage of postprandial triglycerides within adipocytes, we anticipated that Angptl4 transgenic mice, with reduced LPL activity, would have reduced fat storage and adipose mass. However, there was no significant change in adipose mass of the Angptl4 transgenic mice. Likewise, despite the elevated LPL activity and a reduction in plasma triglycerides in the Angptl3 and Angptl4 KO mice, body weights and fat content were not significantly different from wild-type mice. Moreover, Angptl3 deficiency in KK/San mice also had no effect on body weight (16). The lack of a significant change in the fat mass of our transgenic and knockout mice suggests that compensatory mechanisms exist in adipose to stabilize fat mass under conditions of variable fatty acid delivery by LPL. Increased adipose lipogenesis is one likely mechanism at play in the Angptl4 transgenic mice because lipogenesis is activated in LPL-deficient adipose tissue (33, 34). In addition, adipocytes can modulate intracellular fat content by regulating hormone-sensitive lipase activity, as was observed in human LPL transgenic mice (35). Other lipases in adipose tissue may compensate for decreased LPL to maintain input of fatty acids from lipoproteins. Indeed, endothelial lipase, a phospholipase whose expression is undetectable in adipose of normal mice, is abundantly expressed in adipose of LPL-deficient mice (36). We feel it is likely that the maintenance of normal fat mass in mice overexpressing or deficient in Angptl3 and Angptl4 results from compensatory metabolic changes in adipose triglyceride metabolism.
In conclusion, we have shown that: 1) hepatic overexpression of Angptl4 in transgenic mice results in hypertriglyceridemia, concomitant with reduced PHP LPL activity; 2) Angptl4 protein is an inhibitor of LPL activity; 3) Angptl3 and Angptl4 deficiency results in hypotriglyceridemia associated with elevated PHP LPL activity, the magnitude of which is dependent on the nutritional state of the mice; and 4) mice deficient in both Angptl3 and Angptl4 exhibit severe hypotriglyceridemia and early death. Taken together, our data support the hypothesis that these molecules are key regulators of triglyceride metabolism that function by modulating LPL activity.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: Angptl, Angiopoietin-like; Apo, apolipoprotein; DEXA, dual-energy x-ray absorptiometry; FPLC, fast protein liquid chromatography; HL, hepatic lipase; KO, knockout; LPL, lipoprotein lipase; mAngptl4-his, recombinant mouse Angptl4; NMR, nuclear magnetic resonance; PHP, postheparin plasma; rh, recombinant human; VLDL, very low-density lipoprotein.
Received April 21, 2005.
Accepted for publication July 27, 2005.
| References |
|---|
|
|
|---|
target gene encoding a novel angiopoietin-related protein associated with adipose differentiation. Mol Cell Biol 20:53435349This article has been cited by other articles:
![]() |
W. K. Sonnenburg, D. Yu, E-C. Lee, W. Xiong, G. Gololobov, B. Key, J. Gay, N. Wilganowski, Y. Hu, S. Zhao, et al. GPIHBP1 stabilizes lipoprotein lipase and prevents its inhibition by angiopoietin-like 3 and angiopoietin-like 4 J. Lipid Res., December 1, 2009; 50(12): 2421 - 2429. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kersten and A. Bensadoun Stabilizing lipoprotein lipase J. Lipid Res., December 1, 2009; 50(12): 2335 - 2336. [Full Text] [PDF] |
||||
![]() |
L. M. Sanderson, T. Degenhardt, A. Koppen, E. Kalkhoven, B. Desvergne, M. Muller, and S. Kersten Peroxisome Proliferator-Activated Receptor {beta}/{delta} (PPAR{beta}/{delta}) but Not PPAR{alpha} Serves as a Plasma Free Fatty Acid Sensor in Liver Mol. Cell. Biol., December 1, 2009; 29(23): 6257 - 6267. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang and R. H. Eckel Lipoprotein lipase: from gene to obesity Am J Physiol Endocrinol Metab, August 1, 2009; 297(2): E271 - E288. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kersten, L. Lichtenstein, E. Steenbergen, K. Mudde, H. F.J. Hendriks, M. K. Hesselink, P. Schrauwen, and M. Muller Caloric Restriction and Exercise Increase Plasma ANGPTL4 Levels in Humans via Elevated Free Fatty Acids Arterioscler Thromb Vasc Biol, June 1, 2009; 29(6): 969 - 974. [Abstract] [Full Text] [PDF] |
||||
![]() |
E-C. Lee, U. Desai, G. Gololobov, S. Hong, X. Feng, X.-C. Yu, J. Gay, N. Wilganowski, C. Gao, L.-L. Du, et al. Identification of a New Functional Domain in Angiopoietin-like 3 (ANGPTL3) and Angiopoietin-like 4 (ANGPTL4) Involved in Binding and Inhibition of Lipoprotein Lipase (LPL) J. Biol. Chem., May 15, 2009; 284(20): 13735 - 13745. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Yin, S. Romeo, S. Chang, N. V. Grishin, H. H. Hobbs, and J. C. Cohen Genetic Variation in ANGPTL4 Provides Insights into Protein Processing and Function J. Biol. Chem., May 8, 2009; 284(19): 13213 - 13222. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-h. Yau, Y. Wang, K. S. L. Lam, J. Zhang, D. Wu, and A. Xu A Highly Conserved Motif within the NH2-terminal Coiled-coil Domain of Angiopoietin-like Protein 4 Confers Its Inhibitory Effects on Lipoprotein Lipase by Disrupting the Enzyme Dimerization J. Biol. Chem., May 1, 2009; 284(18): 11942 - 11952. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Staiger, C. Haas, J. Machann, R. Werner, M. Weisser, F. Schick, F. Machicao, N. Stefan, A. Fritsche, and H.-U. Haring Muscle-Derived Angiopoietin-Like Protein 4 Is Induced by Fatty Acids via Peroxisome Proliferator-Activated Receptor (PPAR)-{delta} and Is of Metabolic Relevance in Humans Diabetes, March 1, 2009; 58(3): 579 - 589. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shan, X.-C. Yu, Z. Liu, Y. Hu, L. T. Sturgis, M. L. Miranda, and Q. Liu The Angiopoietin-like Proteins ANGPTL3 and ANGPTL4 Inhibit Lipoprotein Lipase Activity through Distinct Mechanisms J. Biol. Chem., January 16, 2009; 284(3): 1419 - 1424. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Talmud, M. Smart, E. Presswood, J. A. Cooper, V. Nicaud, F. Drenos, J. Palmen, M. G. Marmot, S. M. Boekholdt, N. J. Wareham, et al. ANGPTL4 E40K and T266M: Effects on Plasma Triglyceride and HDL Levels, Postprandial Responses, and CHD Risk Arterioscler Thromb Vasc Biol, December 1, 2008; 28(12): 2319 - 2325. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Gealekman, A. Burkart, M. Chouinard, S. M. Nicoloro, J. Straubhaar, and S. Corvera Enhanced angiogenesis in obesity and in response to PPAR{gamma} activators through adipocyte VEGF and ANGPTL4 production Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1056 - E1064. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kuchtey, M. E. Kallberg, K. N. Gelatt, T. Rinkoski, A. M. Komaromy, and R. W. Kuchtey Angiopoietin-like 7 Secretion Is Induced by Glaucoma Stimuli and Its Concentration Is Elevated in Glaucomatous Aqueous Humor Invest. Ophthalmol. Vis. Sci., August 1, 2008; 49(8): 3438 - 3448. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Dallinga-Thie, A. J. Zonneveld-de Boer, L. C. van Vark-van der Zee, R. van Haperen, T. van Gent, H. Jansen, R. De Crom, and A. van Tol Appraisal of hepatic lipase and lipoprotein lipase activities in mice J. Lipid Res., December 1, 2007; 48(12): 2788 - 2791. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Andrew, V. Bernardo, L. A. Warnke, J. C. Davey, T. Hampton, R. A. Mason, J. E. Thorpe, M. A. Ihnat, and J. W. Hamilton Exposure to Arsenic at Levels Found in U.S. Drinking Water Modifies Expression in the Mouse Lung Toxicol. Sci., November 1, 2007; 100(1): 75 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lichtenstein, J. F.P. Berbee, S. J. van Dijk, K. W. van Dijk, A. Bensadoun, I. P. Kema, P. J. Voshol, M. Muller, P. C.N. Rensen, and S. Kersten Angptl4 Upregulates Cholesterol Synthesis in Liver via Inhibition of LPL- and HL-Dependent Hepatic Cholesterol Uptake Arterioscler Thromb Vasc Biol, November 1, 2007; 27(11): 2420 - 2427. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. A. Moen, A. P. Tholens, P. J. Voshol, W. de Haan, L. M. Havekes, P. Gargalovic, A. J. Lusis, K. W. van Dyk, R. R. Frants, M. H. Hofker, et al. The Hyplip2 locus causes hypertriglyceridemia by decreased clearance of triglycerides J. Lipid Res., October 1, 2007; 48(10): 2182 - 2192. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wu, L. Zhang, J. Gupta, G. Olivecrona, and T. Olivecrona A transcription-dependent mechanism, akin to that in adipose tissue, modulates lipoprotein lipase activity in rat heart Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E908 - E915. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Desai, E-C. Lee, K. Chung, C. Gao, J. Gay, B. Key, G. Hansen, D. Machajewski, K. A. Platt, A. T. Sands, et al. Lipid-lowering effects of anti-angiopoietin-like 4 antibody recapitulate the lipid phenotype found in angiopoietin-like 4 knockout mice PNAS, July 10, 2007; 104(28): 11766 - 11771. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Galaup, A. Cazes, S. Le Jan, J. Philippe, E. Connault, E. Le Coz, H. Mekid, L. M. Mir, P. Opolon, P. Corvol, et al. Angiopoietin-like 4 prevents metastasis through inhibition of vascular permeability and tumor cell motility and invasiveness PNAS, December 5, 2006; 103(49): 18721 - 18726. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sukonina, A. Lookene, T. Olivecrona, and G. Olivecrona Angiopoietin-like protein 4 converts lipoprotein lipase to inactive monomers and modulates lipase activity in adipose tissue PNAS, November 14, 2006; 103(46): 17450 - 17455. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. G. Schaap, M. C. Nierman, J. F. P. Berbee, H. Hattori, P. J. Talmud, S. F. C. Vaessen, P. C. N. Rensen, R. A. F. M. Chamuleau, J. A. Kuivenhoven, and A. K. Groen Evidence for a complex relationship between apoA-V and apoC-III in patients with severe hypertriglyceridemia J. Lipid Res., October 1, 2006; 47(10): 2333 - 2339. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fugier, J.-J. Tousaint, X. Prieur, M. Plateroti, J. Samarut, and P. Delerive The Lipoprotein Lipase Inhibitor ANGPTL3 Is Negatively Regulated by Thyroid Hormone J. Biol. Chem., April 28, 2006; 281(17): 11553 - 11559. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mandard, F. Zandbergen, E. van Straten, W. Wahli, F. Kuipers, M. Muller, and S. Kersten The Fasting-induced Adipose Factor/Angiopoietin-like Protein 4 Is Physically Associated with Lipoproteins and Governs Plasma Lipid Levels and Adiposity J. Biol. Chem., January 13, 2006; 281(2): 934 - 944. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |