Endocrinology, doi:10.1210/en.2005-0365
Endocrinology Vol. 146, No. 11 4951-4960
Copyright © 2005 by The Endocrine Society
Hypoxia-Inducible Factor-1-Mediated Activation of Stanniocalcin-1 in Human Cancer Cells
Ho Y. Yeung,
Keng P. Lai,
Hoi Y. Chan,
Nai K. Mak,
Graham F. Wagner and
Chris K. C. Wong
Department of Biology (H.Y.Y., K.P.L., H.Y.C., N.K.M., C.K.C.W.), Hong Kong Baptist University, Kowloon Tong, Hong Kong; and Departments of Physiology and Pharmacology (G.F.W.), The University of Western Ontario, London, Ontario, Canada N6A 5B8
Address all correspondence and requests for reprints to: Dr. Chris K. C. Wong, Department of Biology, Hong Kong Baptist University, Kowloon Tong, Hong Kong.
 |
Abstract
|
|---|
Stanniocalcin-1 (STC1) is an endocrine hormone originally discovered in the corpuscles of Stannius, endocrine glands on kidneys of bony fishes, and also has been identified in mammals. The mammalian STC1 gene is widely expressed in various tissues and appears to be involved in diverse biological processes. There is growing evidence to suggest that altered patterns of gene expression have a role in human cancer development. Recently STC1 has been identified as a stimulator of mitochondrial respiration and has been hypothesized to be functionally related to the Warburg effect, of which hypoxia-inducible factor (HIF)-1 plays a key role in reprogramming tumor metabolism. This prompted us to examine the involvement of HIF-1 in the regulation of STC1 expression in tumor hypoxia. Our data reveal that hypoxia can stimulate STC1 gene expression in various human cancer cell lines, including those derived from colon carcinomas, nasopharyngeal cancer (CNE-2, HONE-1, HK-1), and ovarian cancer (CaOV3, OVCAR3, SKOV3). By far, the greatest response was observed in CNE-2 cells. In further studies on CNE-2 cells, desferrioxamine, cobalt chloride, and O2 depletion all increased HIF-1
protein and STC1 mRNA levels. Desferrioxamine treatment, when coupled with Fe replenishment, abolished these effects. RNA interference studies further confirmed that endogenous HIF-1
was a key factor in hypoxia-induced STC1 expression. The ability of vascular endothelial growth factor to stimulate STC1 expression in CNE-2 cells was comparatively low. Collectively, the present findings provide the first evidence of HIF-1 regulation of STC1 expression in human cancer cells. The studies have implications as to the role of STC1 in hypoxia induced adaptive responses in tumor cells.
 |
Introduction
|
|---|
STANNIOCALCIN-1 (STC1) IS an endocrine hormone originally discovered in the corpuscles of Stannius, endocrine glands on kidneys of bony fishes (1), and has also been identified in mammals. Human STC1 is encoded by a single copy gene localized on chromosome 8p11.2-p21 (2). The gene comprises four exons that encode 247 amino acids with 11 cysteine residues (2, 3). Numerous studies have shown that the mammalian STC1 is expressed in various tissues such as heart, lung, liver, adrenal, kidney, prostate, and ovary (3, 4, 5). The gene is modulated in numerous developmental, physiological and pathological processes, including cancer, pregnancy, lactation, angiogenesis, organogenesis, cerebral ischemia, and hypertonic stress (6, 7). Furthermore, STC1 overexpression in transgenic mouse models results in high serum phosphate, dwarfism, increased vascular density, mitochondrial hypertrophy, and increased rates of respiration (8, 9). The STC1 receptor has not been cloned. However, STC1 binding sites have been identified on kidney and liver cell membranes and the outer and inner mitochondrial membranes of both organs (10).
Numerous lines of evidence show that the short arm of chromosome 8 includes at least two tumor suppressor genes (prostate, bladder, and colorectal carcinomas) and an amplified region associated with breast carcinoma (2, 11, 12, 13, 14, 15). Intriguingly the mammalian STC1 was cloned in a screen for cancer-related genes (4). There is also growing evidence that altered STC1 expression patterns may have a role in human cancer (6). Enhanced STC1 gene expression has been found in hepatocellular, colorectal, and breast carcinomas and medullary thyroid cancers (16, 17, 18, 19, 20). In contrast, a down-regulation of STC1 expression was found in breast and ovarian cancer cell lines (21, 22, 23, 24, 25). STC1 expression has been found to be induced by the RET- multiple endocrine neoplasia (MEN) 2B mutant protein, BRCA1 (a tumor suppressor gene that has an important role in breast and ovarian cancers), and vascular endothelial growth factor (VEGF) (19, 21, 23, 26, 27, 28). Some evidence has linked STC1 expression to the formation of tumor vasculature (17), and the possible use of STC1 expression levels for the diagnosis of human breast, hepatocellular, and colorectal cancers has been postulated (16, 20, 29). Although a considerable number of reports have indicated that STC1 is differentially expressed in tumors, compared with surrounding normal tissue, the pathological and biological significances of these observations require more investigation.
Despite the growing body of knowledge, little is known about STC1 signaling and its functions in cancer progression. In this report, we examined the regulation of STC1 gene expression in the human nasopharyngeal cancer cell line, CNE-2, and we demonstrated that the transcriptional factor, hypoxia-inducible factor (HIF)-1, mediates the activation of STC1 expression in cells exposed to hypoxic stress.
 |
Materials and Methods
|
|---|
Effects of hypoxia [desferrioxamine mesylate (DFX), cobalt chloride (CoCl2) or O2 depletion] on HIF-1
, STC1, and N-myc downstream-regulated gene 1 (Ndrg1) mRNA levels
The human nasopharyngeal carcinoma cell lines (i.e. CNE-2, HK-1, HONE-1), human ovarian cancer cell lines (i.e. CaOV3, OVCAR3, SKOV3), and human colorectal adenocarcinoma cell lines were maintained in their corresponding media and exposed to 50 µM DFX (Sigma, St. Louis, MO) treatment for 24 h. Total RNA was extracted and reverse transcribed, and STC1 mRNA levels were measured by real-time PCR. Significant inductions of STC1 mRNA were observed in the all cell lines. Among those, CNE-2 produced the most striking response to the treatment. Therefore, CNE-2 cells were used in all subsequent experiments to study the regulation of STC1 gene expression.
CNE-2 cells were grown in RPMI 1640 supplemented with 10% fetal bovine serum and antibiotics (50 U/ml penicillin and 50 µg/ml streptomycin) at a density of 2.5 x 104 cells/well in 12-well plates (Nunc, Nalge Nunc, Rochester, NY). The cells were incubated in 5% CO2 at 37 C. After overnight incubation, the cells were exposed for 2448 h to one of the following treatments: 1) 25, 50, or 100 µM DFX; 2) 250 µM CoCl2; or 3) O2 depletion. To achieve conditions of O2 depletion, the cultures were maintained in an air-tight modular incubator chamber (Billups-Rothenberg Inc., Del Mar, CA) infused with a preanalyzed gas mixture (5% CO2-95% N2) at a flow rate of 25 liters/min for 5 min twice a day. The pO2 was measured by a gas analyzer mounted with an O2 sensor (Quest Technologies, Oconomowoc, WI). The O2 content in the incubator chamber was maintained in a range of 13% throughout the incubation.
Effects of sodium nitroprusside (SNP), FeCl3, potassium ferrocyanide [K3Fe(CN)6], and VEGF on DFX-induced HIF-1
and STC mRNA levels
CNE-2 cells were exposed for 24 h to one of the following treatments: 1) 50 µM DFX; 2) 1000 µM SNP (Calbiochem, La Jolla, CA); 3) 500 µM K3Fe(CN)6; 4) 300 µM FeCl3; or 5) 2550 ng/ml VEGF (Upstate Biotechnology, Lake Placid, NY). In addition, DFX-treated CNE-2 cells were coexposed for 24 h to 100-1000 µM SNP, 100500 µM K3Fe(CN)6, 300 µM FeCl3, or 2550 ng/ml VEGF. Total RNA and cell lysates were collected for real-time PCR and Western blot, respectively.
RNA extraction, PCR product verification, and real-time PCR
Cells were dissolved in TRIZOL reagent (Gibco/BRL, Gaithersburg, MD). Total RNA was extracted according to the manufacturers instructions. The RNA A260/A280 ratios were between 1.6 and 1.8. The primers were designed on the basis of the published sequence of human STC1 (CACACCCACGAGCTGACTTC-forward and TCTCCCTGGTTATGCACTCTCA-reverse), HIF-1
(TCCAGCAGACTCAAATACAAGAAC-forward and GTATGTGGGTAGGAGATGGAGATG-reverse), VEGF (CGAAACCATGAACTTTCTGC-forward and CCTCAGTGGGC ACACACTCC-reverse), Ndrg1 (GCCTTGTCCTTATCAACGTGAAC-forward and CTTGGG TCCATCCTGAGATCTTG-reverse), p21 (CTGCCGAAGTCAGTTCCTTGTG-forward and CATCCCCAGCCGGTTCTGAC-reverse), GADD45 (AGTGAGTGCAGAAAGCAGGC-forward and GCTGACTCAGGGCTTTGCTG), and actin (GACTACCTCATGAAGATCCTCACC-forward and TCTCCTTAATGTCACGCACGATT-reverse). The PCR was run for 3035 cycles with a 56 C annealing cycle (1 min), a 72 C extension cycle (1 min), and a 95 C denaturing cycle (50 sec) plus final incubation at 72 C for 5 min. The PCR products (
140 bp for STC1,
138 bp for HIF-1
,
331 bp for VEGF,
81 bp for Ndrg1,
81 bp for p21,
192 bp for GADD45, and
85 bp for actin) were purified, subcloned into pCR II-TOPO (Invitrogen, Carlsbad, CA), and subjected to verification using an automated DNA sequencer (ABI 3700; PE Applied Biosystems, Foster City, CA).
Real-time PCR was conducted and the housekeeping gene, actin, was used as an internal standard. The treated cells were dissolved in TRIZOL reagent (Gibco/BRL), and total RNA was extracted as described above. Briefly, cDNA was synthesized from 1 µg of total cellular RNA using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA). Quantitated standards (104 to 108) and sample cDNAs were analyzed with the iCycler iQ real-time PCR detection system using iQ SYBR Green Supermix (Bio-Rad). The copy number for each sample was calculated and all the data were normalized to actin. The PCR conditions were 95 C for 3 min and 40 cycles of 95 C for 30 sec, 56 C for 30 sec, and 72 C for 1 min. Fluorescent signals were captured at 82 C, and the occurrence of primer-dimers and secondary products were inspected using melting-curve analysis. Control amplifications were done without either reverse transcription or RNA. After PCR amplification, the reaction products were resolved at 100 V on a 1% agarose gel with 0.5 µg/ml ethidium bromide. All glass- and plasticware were treated with diethyl pyrocarbonate and autoclaved.
Western blot analysis
The treated cells were washed with two to three changes of cold PBS. Adherent cells were scraped from the plastic surface and transferred to a microcentrifuge tube. The cells were pelleted and resuspended in a cold lysis buffer containing 250 mM Tris/HCl (pH 8.0), 1% Nonidet P-40, and 150 mM NaCl. After a 10-min incubation on ice, the lysed cells were pelleted and supernatants assayed for protein concentration (DC Protein Assay Kit II, Bio-Rad Pacific Ltd., Kowloon, Hong Kong). Samples were subjected to electrophoresis in NuPage 412% Bis-Tris gradient gels (Invitrogen). Gels were blotted onto polyvinyl difluoride membrane (PerkinElmer Life Sciences, Norwalk, CT). Western blot was conducted using rabbit antibodies to STC1 (9) or HIF1
(BD Transduction Laboratories, San Diego, CA), followed by incubation with horseradish peroxidase-conjugated goat antirabbit antibody. Specific bands were visualized with chemiluminescent reagent (Western-Lightening Plus, PerkinElmer Life Sciences). Blots were then washed in PBS and reprobed with rabbit antiactin serum (Sigma).
RNA Interference.
One day before transfection, CNE-2 cells were plated into 6-well plates. The cells were grown to 70% confluence and then mock transfected or transfected with 20 nM of siCONTROL nontargeting small interfering (si)RNA duplex, human HIF-1
-specific siRNA duplex, or human VEGF-specific siRNA duplex (Dharmacon, Lafayette, CO) using siLectFect according to the manufacturers instructions (Bio-Rad). The cells were then exposed to 50 µM DFX. Additional HIF-1
RNA interference experiments were conducted in the air-tight modular incubator chamber (O2 content 13%). All treatments were carried out in triplicate. Total RNA and cell lysates were collected for real-time PCR and Western blot, respectively, to determine expression levels of HIF-1
, STC1, and Ndrg1.
Northern blot analysis
Untreated CNE-2 cells or DFX-treated cells transfected with either siCONTROL nontargeting siRNA or human HIF-1
-specific siRNA were harvested. Total RNA was isolated as outlined above. Twenty micrograms of total RNA per lane were resolved on 1% agarose/formaldehyde gels and subjected to Northern blot analysis using random-primed, 32P-labeled human STC1 or actin cDNA probes (1 x 106 cpm/ml) in Rapid-Hyb buffer (Amersham Biosciences, Piscataway, NJ) at 65 C for 2 h. To reduce nonspecific binding, all the blots were washed twice in 2x saline sodium citrate containing 0.1% sodium dodecyl sulfate for 20 min at room temperature, followed by 0.1x saline sodium citrate and 0.1% sodium dodecyl sulfate twice for 15 min at 65 C. Signal was then detected using x-ray film.
Statistical analysis
Drugs treatments were performed in triplicate in the same experiments, and individual experiments were repeated at least three times. All data are represented as the mean ± SEM. Statistical significance was assessed with a Students t test or one-way ANOVA followed by Duncans multiple range test. Groups were considered significantly different if P < 0.05.
 |
Results
|
|---|
STC1 mRNA induction in human cancer cell lines under hypoxia treatments
Real-time PCR analysis of relative basal levels of STC1 mRNA in various human cancer cell lines are shown in Fig. 1A
. Upon DFX treatment, STC1 transcript levels increased in all cancer cell lines, although with different levels of induction (Fig. 1B
). Because the highest response was seen in CNE-2 cells, we selected this line for all subsequent studies. Figure 1C
demonstrates the dose-dependent induction of STC1 mRNA by DFX treatment for 24 h. Induction also occurred after 24 h of O2 depletion or CoCl2 treatment (Fig. 1D
). Figure 1E
points to the possible involvement of HIF-1
in these responses because all the above treatments inhibited the activity of HIF prolyl hydroxylases (30) and in doing so the degradation of HIF-1
. To correlate the expression profiles of STC1 and HIF-1
, Fig. 2A
demonstrates the induction of STC1 and HIF-1
protein by DFX at different time increments over 24 and/or 48 h. In contrast, HIF-1
mRNA levels remained constant (data not shown). A marked discrepancy was evident between the induction in STC1 mRNA levels (high) and STC1 protein levels (low). This was possibly attributable to the hypoxic stress, which can inhibit translation (31, 32). Hence, a reduction of STC1 mRNA translation efficiency may have occurred in our model. The fact that HIF-1
mRNA levels remained stable was in agreement with other reports indicating that HIF-1
is mainly regulated posttranslationally, not at the RNA level (33, 34, 35). We also analyzed Ndrg1 mRNA levels in CNE-2 cells throughout the DFX studies (Fig. 2B
). The induction of Ndrg1 mRNA can serve as a positive control for the DFX treatment because the gene is known to be involved in cellular Fe metabolism and can be induced by HIF-1
(36). In this study, a significant induction in Ndrg1 gene expression was also observed in CoCl2 or O2 depletion-treated cells (data not shown).
It has been suggested that DFX treatment and/or Fe chelation may cause DNA damage (37, 38). This was considered as a possible cause of STC1 mRNA induction in the cells in this study. Moreover, the up-regulation of p21 and GADD45 mRNA are well-described responses to DNA damage and so can serve as good positive controls (36, 39). To assess this possibility, we measured the p21 and GADD45 responses in CNE-2 cells after DFX treatment. Our results indicated, however, that there was no induction of p21 or GADD45 transcripts in DFX-treated cells (data not shown). Hence, in this study, DFX stimulation of STC1 gene expression does not appear to be related to DNA damage. To determine whether STC1 is transcriptionally regulated by hypoxia treatment, we incubated the cells with medium containing DFX and 4 µM actinomycin D (Act D). After 6 and 24 h of incubation, DFX mediated STC1 mRNA induction was almost completely blocked by Act D (Fig. 2C
). Similar results were found for Ndrg1, which is also transcriptionally regulated by DFX (36).
The increase in STC1 expression after DFX treatment is HIF-1
dependent and can be reversed by SNP, K3Fe(CN)6, and iron (III) salts
From the data, it appeared likely that HIF-1
was directly involved in the regulation of STC1 expression. To test this hypothesis, we measured the levels of STC1 mRNA in DFX-treated cells in which HIF-1
activities were suppressed by chemical treatment. SNP [a nitric oxide (NO) donor], K3Fe(CN)6 as well as Fe (III) salts were used to reduce HIF-1
protein levels in DFX-treated cells. This approach can elucidate the role of HIF-1
in STC1 mRNA induction. SNP is known to inhibit HIF-1
(40) and was found to completely reduce the levels of HIF-1
protein as well as STC1 mRNA levels (Fig. 3A
). K3Fe(CN)6, a compound structurally related to SNP but without any NO group, also decreased the levels of HIF-1
protein and significantly reduced STC1 mRNA levels (Fig. 3B
). The Fe (III) salts abolished the effect of DFX on both HIF-1
and STC1 induction. The decrease of HIF-1
protein levels in SNP, K3Fe(CN)6, or Fe (III) salts treatment correlated well with the reductions in STC1 mRNA levels.
To determine whether STC1 induction was attributable to mitochondrial dysfunction, possibly resulting from the Fe-chelating effect of DFX, we conducted experiments to inhibit mitochondrial function in the cells. Psychosine (inhibitor of cytochrome c oxidase), rotenone [inhibitor of complex I-nicotinamide adenine dinucleotide, reduced form (NADH)-CoQ reductase], and 2-thenoyltrifluoroacetone (an inhibitor of electron complex II; Calbiochem) were used to treat the cells for 324 h. In this study, cellular ATP levels of all treated cells were significantly reduced, compared with controls. However, no increases in STC1 mRNA levels were observed (data not shown). Taken together, these results indicated that the induction of STC1 was highly correlated to HIF-1
protein levels and not to mitochondrial dysfunction.
STC1 induction is abolished in siRNAHIF-1
transfected DFX-induced or O2 depletion-treated cells
RNA interference assay was conducted to further verify the role of endogenous HIF-1
in hypoxia-induced STC1 gene expression. An siRNAHIF-1
that specifically targets human HIF-1
mRNA was added to DFX-treated cells. The inhibitory effect of this siRNAHIF-1
on HIF-1
expression was confirmed by both real-time PCR and Western blot, which showed the loss of transcript and protein, respectively (Fig. 4A
). As shown in Fig. 4B
, DFX-treated cells expressed high level of STC1 mRNA. This activation was almost completely abrogated by the treatment with siRNAHIF-1
but not by the mock-transfected or siCONTROL-transfected cells. The observation was further confirmed by Northern blot analysis (Fig. 4C
). The expression of Ndrg1, a gene that is known to be regulated by HIF-1
, was also inhibited by siRNAHIF-1
treatment. Reductions in HIF-1
and STC1 expression were also observed in siRNAHIF-1
-treated, O2-depleted cells (data not shown). To exclude any possible off-target effects of the siRNAHIF-1
treatment, we repeated the experiments with four individual siRNAHIF-1
duplexes (5'-CAAGUCUAAAUCUGUGUCCUU-3', 5'-GGACACAGAUUUAGACUUGUU-3'; 5'-UUUGUCUAGUGCUUCCAUCUU-3', 5'-GAUGGAAGCACUAGACAAAUU-3'; 5'-CAAAGCGACAGAUAACACGUU-3', 5'-CGUGUUAUCUGUCGCUUUGUU-3'; 5'-UCUGAUUCAACUUUGGUGAUU-3', 5'-UCACCAAAGUUGAAUCAGAUU-3') (Dharmacon). Similar suppressive effects on HIF-1
, Ndrg1, and STC1 mRNA levels were observed (data not shown). These results confirm that endogenous HIF-1
is involved in hypoxia-induced STC1 gene expression.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4. Human HIF-1 RNA interference assay. DFX (50 µM)-induced CNE-2 cells were transfected with 20 nM of siCONTROL nontargeting siRNA duplex or human HIF-1 -specific siRNA duplex using siLectFect. Twenty-four hours after transfection, HIF-1 protein (left) and mRNA levels (right) (A) were determined by Western blot and real-time PCR. B, STC1 and Ndrg1 mRNA levels were measured by real-time PCR. DFX-induced HIF-1 , STC1, and Ndrg1 expression patterns were significantly abrogated by the treatment with siRNAHIF-1 but not in siCONTROL-transfected cells. *, P < 0.01, compared with the DFX treatment alone. C, Northern analysis of STC1 expression after RNA interference. Total RNA (20 µg/lane) was resolved on formaldehyde-1% agarose denaturing gels, transferred, and hybridized to a human STC1 cDNA probe. The blot was reprobed with an actin cDNA to normalize the STC1 signal in each lane. Results shown are from three or more independent experiments. Ctrl, Control.
|
|
VEGF is also known to be transcriptionally stimulated by HIF-1. Therefore, in view of numerous reports demonstrating the stimulatory effects of VEGF on STC1 expression in human endothelial cells (23, 26, 27, 28), we decided to investigate the significance of VEGF to STC1 stimulation. In DFX-treated CNE-2 cells, 3- to 4-fold inductions of VEGF transcript levels were detected (Fig. 5A
). Increasing doses of VEGF (2550 ng/ml) stimulated STC1 gene expression (Fig. 5B
). The magnitude of stimulation, however, was far below that induced by DFX treatment. To assess the possible role of endogenous VEGF in DFX-induced STC1 gene expression, RNA interference was conducted. An siRNAVEGF that specifically targets human VEGF mRNA was added to DFX-treated cells. The inhibitory effect of this siRNAVEGF on VEGF expression was confirmed by real-time PCR (Fig. 5C
). However, DFX-induced expression of STC1 mRNA and HIF-1
were not affected by siRNAVEGF treatment. Additional experiments on CNE-2 cells cotreated with DFX (50 µM) and VEGF (2550 ng/ml) were conducted. However, there was no significant difference in STC1 mRNA levels between DFX-treated and DFX/VEGF-treated cells (data not shown). These results further support the notion that endogenous HIF-1
is the key factor stimulating STC1 gene expression.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5. Effect of VEGF on DFX-induced STC1 mRNA expression. A, Induction of VEGF mRNA at 24 h in DFX-treated CNE-2 cells. B, Induction of STC1 mRNA at 24 h in VEGF-treated (2550 ng/ml) CNE-2 cells. *, P < 0.01, compared with the control. Note that the VEGF induction of STC1 mRNA is considerably lower than that of 50 µM DFX (#, P < 0.01). C, Effect of siRNAVEGF on VEGF, STC1, and HIF-1 mRNA levels at 24 h in DFX-treated CNE-2 cells. Western blot analysis revealed no significant reductions in HIF-1 protein levels in siRNA-treated cells. *, P < 0.01, compared with DFX treatment alone. Ctrl, Control.
|
|
 |
Discussion
|
|---|
Mammalian STC1 was cloned in the investigation of cancer-related genes (4) and independently by random sequencing of a fetal lung cDNA library (5). The gene is widely expressed in tissues as diverse as heart, lung, liver, adrenal, kidney, prostate, and ovary (3, 4, 5). More recently there has been increasing evidence to support the role of STC1 in human cancer development. The STC1 receptor has not been cloned; however, high-affinity binding sites have been identified on the outer and inner mitochondrial membranes in which STC-1 has stimulatory effects on electron transport (10). The evidence has put STC1 on an exclusive list of regulatory factors including NO, thyroid hormone, and TGFß1, which can modulate mitochondrial functions (41, 42, 43). In view of its possible role in mitochondrial function, it has been hypothesized that STC1 expression may be related to the Warburg effect (6), in which HIF-1 plays a key role in modulating the expression of glycolytic enzymes and reprogramming of tumor metabolism (44, 45). HIF-1 is a key regulator in the cellular responses to oxygen deprivation and is well known to be involved in cancer progression (44, 46, 47, 48, 49). Moreover, using a serial analysis of gene expression approach, STC1 was found to be induced in human glioblastoma cells under hypoxia conditions (50). Together with the recent studies on STC1 in cancer biology, it was therefore anticipated that HIF-1 might have an effect on STC1 expression in cancer cells.
We have shown that HIF-1
directly stimulates STC1 gene expression. Using different hypoxic approaches in CNE-2 cells (i.e. the DFX, CoCl2, and O2 depletion), HIF-1
was activated, and STC1 expression was significantly increased. RNA interference showed that the induction of STC1 expression was HIF-1
dependent. Based on our Act D studies, we demonstrated that the induction of STC1 mRNA most likely occurred at the transcriptional level.
In DFX-treated CNE-2 cells with SNP and/or Fe replenishment, both HIF-1
and STC1 mRNA levels were substantially reduced. The three compounds [SNP, K3Fe(CN)6, and FeCl3] used in this study to suppress DFX-induced HIF-1
activity all contain iron. The release of ionic iron antagonized the Fe-chelating effect of DFX. Consequently, these treatments likely restored HIF prolyl hydroxylases activity and reactivated the process of HIF-1
degradation (30). Unlike K3Fe(CN)6 and FeCl3, SNP is also a NO donor. The release of NO is known to inhibit the activation step of converting HIF-1
to its DNA-binding form (40). Moreover, the data indicated that SNP was more potent than K3Fe(CN)6 (a compound structurally related to SNP but without an NO group) in suppressing HIF-1
activity and STC1 expression.
Prior studies have demonstrated that hypoxia and VEGF treatment both elevate STC1 mRNA levels in several animal and cell line models. Cerebral ischemic biopsies from human and rat brain showed high level of STC1 expression (51). Biopsy specimens of pimonidazole-marked oropharyngeal carcinomas involving tissue hypoxia also have elevated STC1 levels (50). A study of the hypoxia-driven angiogenic pathways in von Hippel-Lindau syndrome-associated pheochromocytomas revealed that STC1 is one of the up-regulated candidate genes (52). Furthermore, hypoxia-induced STC1 mRNA expression has been reported in mouse embryonic fibroblasts (53). Although hypoxia was shown to induce STC1 expression in these studies, they did not provide direct evidence to indicate that the induction was HIF-1 dependent. During manuscript preparation, Manalo et al. (54) reported STC1 as one of the genes up-regulated in vascular endothelial cells under either hypoxic conditions or normoxia after infection with adenovirus encoding an active form of HIF-1
. Similarly, these data inferred but did not prove the direct involvement of HIF-1
in the regulation of STC1 expression. Using RNA interference, we have revealed that endogenous HIF-1
plays an essential role in hypoxia-induced STC1 expression. Thus, the STC1 gene is a possible target of HIF-1. It is well known that HIF-1 can also induce VEGF expression. Differential gene expression studies in vascular endothelial cells has demonstrated that the STC1 is indeed activated by VEGF treatment (23, 26, 27, 28), although no experimental data have delineated the underlying mechanism. Consistent with these findings, our data also demonstrated that VEGF treatment alone stimulates STC1 gene expression. However, the magnitude of induction was markedly lower than that in hypoxic cells. Furthermore, the VEGF RNA interference and DFX/VEGF cotreatment studies revealed that VEGF had no significant effect on STC1 expression in DFX-treated cells, whereas HIF-1 had an overwhelming effect on STC1 gene activation. These findings support the notion that HIF-1 is a more potent stimulator of STC1 expression.
In summary, we have shown that hypoxia is an inducer of STC1 gene expression in various human cancer cell lines. More importantly, the present findings provide evidence that HIF-1 is a potent regulator of STC1 expression. The data obtained from SNP and Fe replenishment and RNA interference assays were unequivocal of the involvement of HIF-1 in the up-regulation of STC1 mRNA under hypoxic conditions. Hypoxia-driven cellular responses can lead to apoptosis, growth arrest, and tumor vascularization (55, 56, 57). Fe chelation is able to up-regulate HIF-1
protein and Ndrg1, which is recognized as a metastatic suppressor gene that inhibits tumor growth (30, 36). A considerable number of studies and clinical trials have shown that DFX and other Fe chelators are effective antitumor agents (37, 39, 58, 59, 60). Fe chelation is demonstrated to be effective in causing cell arrest and apoptosis because tumor cells are far more sensitive than normal cells to Fe depletion (36, 37, 58, 61, 62). In hypoxic CNE-2 cells, the stimulation of STC1 expression was accompanied by a marked up-regulation of Ndrg1. The coactivation of STC1 and Ndrg1 expressions has also been demonstrated in one other study involving hypoxia in human carcinomas (50). Most solid human tumors have common hypoxic regions in the latter stages of carcinogenesis. Although the exact function of STC1 remains uncertain, it is possible that the HIF-1-mediated activation of STC1 relates to the final stages of cancer development.
 |
Footnotes
|
|---|
This work was supported by the Research Grants Council, Hong Kong, and the Faculty Research Grant, Hong Kong Baptist University (to C.K.C.W.) and through funding from The Canadian Institutes of Health Research and the Kidney Foundation of Canada (to G.F.W.).
First Published Online August 18, 2005
Abbreviations: Act D, Actinomycin D; CoCl2, cobalt chloride; DFX, desferrioxamine mesylate; HIF, hypoxia-inducible factor; Ndrg1, N-myc downstream-regulated gene 1; NO, nitric oxide; si, small interfering; SNP, sodium nitroprusside; STC1, stanniocalcin-1; VEGF, vascular endothelial growth factor.
Received March 29, 2005.
Accepted for publication August 10, 2005.
 |
References
|
|---|
- Wagner GF, Hampong M, Park CM, Copp DH 1986 Purification, characterization, and bioassay of teleocalcin, a glycoprotein from salmon corpuscles of Stannius. Gen Comp Endocrinol 63:481491
- Chang AC, Jeffrey KJ, Tokutake Y, Shimamoto A, Neumann AA, Dunham MA, Cha J, Sugawara M, Furuichi Y, Reddel RR 1998 Human stanniocalcin (STC): genomic structure, chromosomal localization, and the presence of CAG trinucleotide repeats. Genomics 47:393398
- Varghese R, Wong CK, Deol H, Wagner GF, DiMattia GE 1998 Comparative analysis of mammalian stanniocalcin genes. Endocrinology 139:47144725
- Chang AC, Janosi J, Hulsbeek M, de Jong D, Jeffrey KJ, Noble JR, Reddel RR 1995 A novel human cDNA highly homologous to the fish hormone stanniocalcin. Mol Cell Endocrinol 112:241247
- Olsen HS, Cepeda MA, Zhang QQ, Rosen CA, Vozzolo BL 1996 Human stanniocalcin: a possible hormonal regulator of mineral metabolism. Proc Natl Acad Sci USA 93:17921796
- Chang AC, Jellinek DA, Reddel RR 2003 Mammalian stanniocalcins and cancer. Endocr Relat Cancer 10:359373
- Ishibashi K, Imai M 2002 Prospect of a stanniocalcin endocrine/paracrine system in mammals. Am J Physiol Renal Physiol 282:F367F375
- Filvaroff EH, Guillet S, Zlot C, Bao M, Ingle G, Steinmetz H, Hoeffel J, Bunting S, Ross J, Carano RA, Powell-Braxton L, Wagner GF, Eckert R, Gerritsen ME, French DM 2002 Stanniocalcin 1 alters muscle and bone structure and function in transgenic mice. Endocrinology 143:36813690
- Varghese R, Gagliardi AD, Bialek PE, Yee SP, Wagner GF, DiMattia GE 2002 Overexpression of human stanniocalcin affects growth and reproduction in transgenic mice. Endocrinology 143:868876
- McCudden CR, James KA, Hasilo C, Wagner GF 2002 Characterization of mammalian stanniocalcin receptors. Mitochondrial targeting of ligand and receptor for regulation of cellular metabolism. J Biol Chem 277:4524945258
- Fujiwara Y, Emi M, Ohata H, Kato Y, Nakajima T, Mori T, Nakamura Y 1993 Evidence for the presence of two tumor suppressor genes on chromosome 8p for colorectal carcinoma. Cancer Res 53:11721174
- Fujiwara Y, Monden M, Mori T, Nakamura Y, Emi M 1993 Frequent multiplication of the long arm of chromosome 8 in hepatocellular carcinoma. Cancer Res 53:857860
- Trapman J, Sleddens HF, van der Weiden MM, Dinjens WN, Konig JJ, Schroder FH, Faber PW, Bosman FT 1994 Loss of heterozygosity of chromosome 8 microsatellite loci implicates a candidate tumor suppressor gene between the loci D8S87 and D8S133 in human prostate cancer. Cancer Res 54:60616064
- Kagan J, Stein J, Babaian RJ, Joe YS, Pisters LL, Glassman AB, von Eschenbach AC, Troncoso P 1995 Homozygous deletions at 8p22 and 8p21 in prostate cancer implicate these regions as the sites for candidate tumor suppressor genes. Oncogene 11:21212126
- Takle LA, Knowles MA 1996 Deletion mapping implicates two tumor suppressor genes on chromosome 8p in the development of bladder cancer. Oncogene 12:10831087
- Fujiwara Y, Sugita Y, Nakamori S, Miyamoto A, Shiozaki K, Nagano H, Sakon M, Monden M 2000 Assessment of Stanniocalcin-1 mRNA as a molecular marker for micrometastases of various human cancers. Int J Oncol 16:799804
- Gerritsen ME, Soriano R, Yang S, Ingle G, Zlot C, Toy K, Winer J, Draksharapu A, Peale F, Wu TD, Williams PM 2002 In silico data filtering to identify new angiogenesis targets from a large in vitro gene profiling data set. Physiol Genomics 10:1320
- Okabe H, Satoh S, Kato T, Kitahara O, Yanagawa R, Yamaoka Y, Tsunoda T, Furukawa Y, Nakamura Y 2001 Genome-wide analysis of gene expression in human hepatocellular carcinomas using cDNA microarray: identification of genes involved in viral carcinogenesis and tumor progression. Cancer Res 61:21292137
- Watanabe T, Ichihara M, Hashimoto M, Shimono K, Shimoyama Y, Nagasaka T, Murakumo Y, Murakami H, Sugiura H, Iwata H, Ishiguro N, Takahashi M 2002 Characterization of gene expression induced by RET with MEN2A or MEN2B mutation. Am J Pathol 161:249256
- McCudden CR, Majewski A, Chakrabarti S, Wagner GF 2004 Co-localization of stanniocalcin-1 ligand and receptor in human breast carcinomas. Mol Cell Endocrinol 213:167172
- Welcsh PL, Lee MK, Gonzalez-Hernandez RM, Black DJ, Mahadevappa M, Swisher EM, Warrington JA, King MC 2002 BRCA1 transcriptionally regulates genes involved in breast tumorigenesis. Proc Natl Acad Sci USA 99:75607565
- Bouras T, Southey MC, Chang AC, Reddel RR, Willhite D, Glynne R, Henderson MA, Armes JE, Venter DJ 2002 Stanniocalcin 2 is an estrogen-responsive gene coexpressed with the estrogen receptor in human breast cancer. Cancer Res 62:12891295
- Kahn J, Mehraban F, Ingle G, Xin X, Bryant JE, Vehar G, Schoenfeld J, Grimaldi CJ, Peale F, Draksharapu A, Lewin DA, Gerritsen ME 2000 Gene expression profiling in an in vitro model of angiogenesis. Am J Pathol 156:18871900
- Ismail RS, Baldwin RL, Fang J, Browning D, Karlan BY, Gasson JC, Chang DD 2000 Differential gene expression between normal and tumor-derived ovarian epithelial cells. Cancer Res 60:67446749
- Liang P, Averboukh L, Keyomarsi K, Sager R, Pardee AB 1992 Differential display and cloning of messenger RNAs from human breast cancer versus mammary epithelial cells. Cancer Res 52:69666968
- Bell SE, Mavila A, Salazar R, Bayless KJ, Kanagala S, Maxwell SA, Davis GE 2001 Differential gene expression during capillary morphogenesis in 3D collagen matrices: regulated expression of genes involved in basement membrane matrix assembly, cell cycle progression, cellular differentiation and G-protein signaling. J Cell Sci 114:27552773
- Liu D, Jia H, Holmes DI, Stannard A, Zachary I 2003 Vascular endothelial growth factor-regulated gene expression in endothelial cells: KDR-mediated induction of Egr3 and the related nuclear receptors Nur77, Nurr1, and Nor1. Arterioscler Thromb Vasc Biol 23:20022007
- Wary KK, Thakker GD, Humtsoe JO, Yang J 2003 Analysis of VEGF-responsive genes involved in the activation of endothelial cells. Mol Cancer 2:25
- Wascher RA, Huynh KT, Giuliano AE, Hansen NM, Singer FR, Elashoff D, Hoon DS 2003 Stanniocalcin-1: a novel molecular blood and bone marrow marker for human breast cancer. Clin Cancer Res 9:14271435
- Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ, Kriegsheim A, Hebestreit HF, Mukherji M, Schofield CJ, Maxwell PH, Pugh CW, Ratcliffe PJ 2001 Targeting of HIF-
to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 292:468472
- Kraggerud SM, Sandvik JA, Pettersen EO 1995 Regulation of protein synthesis in human cells exposed to extreme hypoxia. Anticancer Res 15:683686
- Pettersen EO, Juul NO, Ronning OW 1986 Regulation of protein metabolism of human cells during and after acute hypoxia. Cancer Res 46:43464351
- Huang LE, Gu J, Schau M, Bunn HF 1998 Regulation of hypoxia-inducible factor 1alpha is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci USA 95:79877992
- Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, Ratcliffe PJ 1999 The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399:271275
- Garayoa M, Martinez A, Lee S, Pio R, An WG, Neckers L, Trepel J, Montuenga LM, Ryan H, Johnson R, Gassmann M, Cuttitta F 2000 Hypoxia-inducible factor-1 (HIF-1) up-regulates adrenomedullin expression in human tumor cell lines during oxygen deprivation: a possible promotion mechanism of carcinogenesis. Mol Endocrinol 14:848862
- Le NT, Richardson DR 2004 Iron chelators with high antiproliferative activity up-regulate the expression of a growth inhibitory and metastasis suppressor gene: a link between iron metabolism and proliferation. Blood 104:29672975
- Chaston TB, Lovejoy DB, Watts RN, Richardson DR 2003 Examination of the antiproliferative activity of iron chelators: multiple cellular targets and the different mechanism of action of triapine compared with desferrioxamine and the potent pyridoxal isonicotinoyl hydrazone analogue 311. Clin Cancer Res 9:402414
- Cooper CE, Lynagh GR, Hoyes KP, Hider RC, Cammack R, Porter JB 1996 The relationship of intracellular iron chelation to the inhibition and regeneration of human ribonucleotide reductase. J Biol Chem 271:2029120299
- Liang SX, Richardson DR 2003 The effect of potent iron chelators on the regulation of p53: examination of the expression, localization and DNA-binding activity of p53 and the transactivation of WAF1. Carcinogenesis 24:16011614
- Sogawa K, Numayama-Tsuruta K, Ema M, Abe M, Abe H, Fujii-Kuriyama Y 1998 Inhibition of hypoxia-inducible factor 1 activity by nitric oxide donors in hypoxia. Proc Natl Acad Sci USA 95:73687373
- Cadenas E, Poderoso JJ, Antunes F, Boveris A 2001 Analysis of the pathways of nitric oxide utilization in mitochondria. Free Radic Res 33:747756
- Chen W, Jin W, Tian H, Sicurello P, Frank M, Orenstein JM, Wahl SM 2001 Requirement for transforming growth factor ß1 in controlling T cell apoptosis. J Exp Med 194:439453
- Wrutniak-Cabello C, Casas F, Cabello G 2001 Thyroid hormone action in mitochondria. J Mol Endocrinol 26:6777
- Maxwell PH, Dachs GU, Gleadle JM, Nicholls LG, Harris AL, Stratford IJ, Hankinson O, Pugh CW, Ratcliffe PJ 1997 Hypoxia-inducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth. Proc Natl Acad Sci USA 94:81048109
- Wang GL, Jiang BH, Rue EA, Semenza GL 1995 Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci USA 92:55105514
- Ravi R, Mookerjee B, Bhujwalla ZM, Sutter CH, Artemov D, Zeng Q, Dillehay LE, Madan A, Semenza GL, Bedi A 2000 Regulation of tumor angiogenesis by p53-induced degradation of hypoxia-inducible factor 1
. Genes Dev 14:3444
- Akakura N, Kobayashi M, Horiuchi I, Suzuki A, Wang J, Chen J, Niizeki H, Kawamura K, Hosokawa M, Asaka M 2001 Constitutive expression of hypoxia-inducible factor-1
renders pancreatic cancer cells resistant to apoptosis induced by hypoxia and nutrient deprivation. Cancer Res 61:65486554
- Jiang BH, Agani F, Passaniti A, Semenza GL 1997 V-SRC induces expression of hypoxia-inducible factor 1 (HIF-1) and transcription of genes encoding vascular endothelial growth factor and enolase 1: involvement of HIF-1 in tumor progression. Cancer Res 57:53285335
- Carmeliet P, Dor Y, Herbert JM, Fukumura D, Brusselmans K, Dewerchin M, Neeman M, Bono F, Abramovitch R, Maxwell P, Koch CJ, Ratcliffe P, Moons L, Jain RK, Collen D, Keshert E 1998 Role of HIF-1
in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature 394:485490
- Lal A, Peters H, St. Croix B, Haroon ZA, Dewhirst MW, Strausberg RL, Kaanders JH, van der Kogel AJ, Riggins GJ 2001 Transcriptional response to hypoxia in human tumors. J Natl Cancer Inst 93:13371343
- Zhang K, Lindsberg PJ, Tatlisumak T, Kaste M, Olsen HS, Andersson LC 2000 Stanniocalcin: a molecular guard of neurons during cerebral ischemia. Proc Natl Acad Sci USA 97:36373642
- Eisenhofer G, Huynh TT, Pacak K, Brouwers FM, Walther MM, Linehan WM, Munson PJ, Mannelli M, Goldstein DS, Elkahloun AG 2004 Distinct gene expression profiles in norepinephrine- and epinephrine-producing hereditary and sporadic pheochromocytomas: activation of hypoxia-driven angiogenic pathways in von Hippel-Lindau syndrome. Endocr Relat Cancer 11:897911
- Ito D, Walker JR, Thompson CS, Moroz I, Lin W, Veselits ML, Hakim AM, Fienberg AA, Thinakaran G 2004 Characterization of stanniocalcin 2, a novel target of the mammalian unfolded protein response with cytoprotective properties. Mol Cell Biol 24:94569469
- Manalo DJ, Rowan A, Lavoie T, Natarajan L, Kelly BD, Ye SQ, Garcia JG, Semenza GL 2005 Transcriptional regulation of vascular endothelial cell responses to hypoxia by HIF-1. Blood 105:659669
- Giatromanolaki A, Sivridis E, Koukourakis MI 2004 Tumour angiogenesis: vascular growth and survival. APMIS 112:431440
- Schmitt O, Schubert C, Feyerabend T, Hellwig-Burgel T, Weiss C, Kuhnel W 2002 Preferential topography of proteins regulating vascularization and apoptosis in a MX1 xenotransplant after treatment with hypoxia, hyperthermia, ifosfamide, and irradiation. Am J Clin Oncol 25:325336
- Hopfl G, Wenger RH, Ziegler U, Stallmach T, Gardelle O, Achermann R, Wergin M, Kaser-Hotz B, Saunders HM, Williams KJ, Stratford IJ, Gassmann M, Desbaillets I 2002 Rescue of hypoxia-inducible factor-1
-deficient tumor growth by wild-type cells is independent of vascular endothelial growth factor. Cancer Res 62:29622970
- Le NT, Richardson DR 2002 The role of iron in cell cycle progression and the proliferation of neoplastic cells. Biochim Biophys Acta 1603:3146
- Richardson DR 2001 The controversial role of deferiprone in the treatment of thalassemia. J Lab Clin Med 137:324329
- Richardson DR, Ponka P 1998 Pyridoxal isonicotinoyl hydrazone and its analogs: potential orally effective iron-chelating agents for the treatment of iron overload disease. J Lab Clin Med 131:306315
- Darnell G, Richardson DR 1999 The potential of iron chelators of the pyridoxal isonicotinoyl hydrazone class as effective antiproliferative agents III: the effect of the ligands on molecular targets involved in proliferation. Blood 94:781792
- Brodie C, Siriwardana G, Lucas J, Schleicher R, Terada N, Szepesi A, Gelfand E, Seligman P 1993 Neuroblastoma sensitivity to growth inhibition by desferrioxamine: evidence for a block in G1 phase of the cell cycle. Cancer Res 53:39683975
This article has been cited by other articles:

|
 |

|
 |
 
A. C.-M. Chang, J. Hook, F. A. Lemckert, M. M. McDonald, M.-A. T. Nguyen, E. C. Hardeman, D. G. Little, P. W. Gunning, and R. R. Reddel
The Murine Stanniocalcin 2 Gene Is a Negative Regulator of Postnatal Growth
Endocrinology,
May 1, 2008;
149(5):
2403 - 2410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Westberg, M. Serlachius, P. Lankila, and L. C. Andersson
Hypoxic preconditioning induces elevated expression of stanniocalcin-1 in the heart
Am J Physiol Heart Circ Physiol,
September 1, 2007;
293(3):
H1766 - H1771.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Gillespie, K. Whang, B. T. Ragel, J. R. Flynn, D. A. Kelly, and R. L. Jensen
Silencing of Hypoxia Inducible Factor-1{alpha} by RNA Interference Attenuates Human Glioma Cell Growth In vivo
Clin. Cancer Res.,
April 15, 2007;
13(8):
2441 - 2448.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Westberg, M. Serlachius, P. Lankila, M. Penkowa, J. Hidalgo, and L. C. Andersson
Hypoxic Preconditioning Induces Neuroprotective Stanniocalcin-1 in Brain via IL-6 Signaling
Stroke,
March 1, 2007;
38(3):
1025 - 1030.
[Abstract]
[Full Text]
[PDF]
|
 |
|