| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Center for Biomedical Research, The Population Council (T.I., K.H., D.L., P.L.M.), and Rockefeller University (P.L.M.), New York, New York 10021
Address all correspondence and requests for reprints to: Dr. Patricia L. Morris, Center for Biomedical Research, The Population Council and Rockefeller University, 1230 York Avenue, New York, New York 10021. E-mail: p-morris{at}popcbr.rockefeller.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-6, and IL-1ß mRNAs (1–3 h) are observed. As StAR-related lipid transfer protein domain containing protein 1 (StARD1) mRNA decreases, StARD5 mRNA increases; substantial recovery phase induction of StARD1 mRNA above control is noted (24 h). Inhibition of JNK or COX-2 activities prevents IL-1ß induction of IL and StARD5 mRNAs and subsequent increases in StARD1 mRNA (24 h), indicating that these effects depend on the activation of both enzymes. StARD1 and D5 protein levels are significantly altered, consistent with posttranscriptional and posttranslational regulation. IL-1ß rapidly decreases levels of precursor and mature sterol regulatory element-binding protein-1, changes not altered by cycloheximide, suggesting coordinate regulation of StARD1 and -D5, but not StARD4, expression. These data demonstrate that JNK and COX-2 activities regulate Sertoli cytokines and particularly START domain-containing proteins, suggesting protective stress responses, including transcription and protein and lipid regulation, within this specialized epithelium. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-1ß, and IL-6, and also accompanies pathological testicular inflammation (1, 2, 3, 4, 5, 6, 7). Stage-specific IL-1-like activity was found to stimulate DNA synthesis in mitotic spermatogonia and preleptotene spermatocytes, whereas IL-6 exerts the opposite effect (8, 9, 10). IL-1ß and IL-6 family members and their specific receptors are expressed in cell-specific patterns in the human, mouse, porcine, and rat testis, indicating their potential as paracrine factors to exert biological activity (7, 11, 12, 13, 14, 15, 16). In SC, IL-1ß has been shown to regulate estradiol, lactate, IL-6, and transferrin production and secretion, suggesting that this cytokine regulates diverse, but critical, autocrine and paracrine secretory factors (5, 17, 18, 19, 20, 21). However, to date, the molecular mechanisms subserving such effects within the seminiferous tubule are not well understood.
IL-1ß signaling involves multiple signal transduction pathways and numerous intracellular mediators, including the c-Jun N-terminal kinase (JNK), MAPK, p44/42 and p38 MAPK, and Akt/protein kinase B pathways (22, 23, 24, 25, 26, 27). In human astrocytes, vascular smooth muscle cells, and endothelial cells, IL-1ß cyclooxygenase (COX) induction was shown to be dependent on the activation of protein kinase C (28, 29). The inducible isozyme COX-2 is a protein whose expression and activity are induced by IL-1ß in specialized cell types and regulated during tissue development and remodeling (30, 31). Little is known about the functional consequence(s) of physiological COX activation in the testis. Using steroidogenic Leydig cell progenitors purified from the testis, we showed that acute treatment with IL-1ß is a potent inducer of the transient expression of several ILs, effects mediated by activation of the COX-2 pathway and induction of prostaglandin (PG) F2 and PGE2 production (24, 32). In such steroid-producing progenitors, the expression of steroidogenic acute regulatory protein [StAR; StAR-related lipid transfer protein domain containing protein 1 (StARD1)], the founding member of the StAR lipid transfer [StAR-related lipid transfer protein (START) domain] family of proteins, was unaffected by IL-1ß treatment or the induction of COX-2 and PG. In contrast, lipopolysaccharide-induced shock or the presence of inflammatory levels of cytokines, including IL-1ß, can decrease StAR and inhibit several steroidogenic enzymes in adult Leydig cells, leading to subsequent decline in testosterone and sperm production (33, 34, 35, 36, 37). Differences between these studies are probably due in part to the complex array and high levels of cytokines released in response to lipopolysaccharide.
Therefore, particular effects of IL-1ß are probably specified by the distinct testicular cell type and duration and degree of exposure: transient and within physiological levels, rapidly induced as a response to a stress, or released in a chronic, elevated manner during the development of inflammatory disease (27, 38). For this study, the specific kinetics and molecular mechanisms of IL-1ß signaling and intracellular regulation of the SC were investigated.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
95% pure) were maintained at a density of 1 x 107 cells/100-mm polystyrene dish in phenol red-, serum-, and endotoxin-free DMEM/Ham’s F-12 medium (Irvine Scientific, Santa Ana, CA) at 34 C as described previously (11, 12). The medium was supplemented with 2.5 µg/ml bovine insulin (Sigma-Aldrich Corp., St. Louis, MO), 1 µg/ml transferrin (Calbiochem, La Jolla, CA), and 10 µg/ml bacitracin (Sigma-Aldrich Corp.). On d 3 ex vivo, SC were rinsed twice with fresh serum- and phenol red-free culture medium and then treated with IL-1ß (10 ng/ml) in the absence or presence of COX activity inhibitors, 1-(4-chlorobenzoyl)-5-methoxy-2-methyl-1H-indole-3-acetic acid (INDO; 10 µM; COX-1 and -2) or NS-398 (N-[2-(cyclohexyloxy)-4-nitrophenyl]-methanesulfonamide; 10 µM; COX-2 selective), and/or the JNK inhibitor, SP600125 [(N1-methyl-substituted pyrazolanthrone (N1-methyl-1, 9-pyrazoloanthrone)); 10 µM], or the protein synthesis inhibitor, cycloheximide (CHX; 5 µg/ml). At 1, 3, 6, and 24 h after vehicle, IL-1ß, or addition of the inhibitor(s), whole-cell lysates for protein and total RNA were isolated from each replicate. Duplicate or triplicate culture dishes were used for each drug treatment, and experiments were repeated at least twice. The mean (±SEM) of all the experiments was calculated for RNA analyses.
Drugs
Recombinant IL-1ß was purchased from R&D Systems, Inc. (Minneapolis, MN). NS-398 was purchased from Cayman Chemical Co. (Ann Arbor, MI). INDO and CHX were obtained from Sigma-Aldrich Corp. SP600125 was purchased from Calbiochem.
Recombinant IL-1ß was dissolved in 0.1% BSA in PBS as a 100-fold (10 µg/ml) stock solution. Matched aliquots of 0.1% BSA were used in control cultures; the final BSA concentration was 0.0001%. COX and JNK inhibitors were dissolved in dimethylsulfoxide (DMSO) and CHX was dissolved in absolute ethanol; subsequent dilutions, as needed, were performed in serum- and phenol red-free medium on the day of the experiment. DMSO alone and/or ethanol were used as matched vehicle controls in all plates as required. The final DMSO concentration was 0.1%.
Protein extraction and Western analysis
Whole-cell homogenates were extracted for protein lysates for 15 min on ice in buffer [10 mM Tris-HCl (pH 7.8) containing 1% Nonidet P-40, 0.1% sodium dodecyl sulfate, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonylfluoride, 2 mM dithiothreitol, 2 mM sodium orthovanadate, 2 µg/ml aprotinin, 2 µg/ml pepstatin, and 2 µg/ml leupeptin]. Cellular debris was pelleted by centrifugation at 12,000 x g for 15 min.
The proteins in the supernatant were then subjected, under reducing conditions, to SDS-PAGE using 4–20% Tris-glycine gels (Novex, San Diego, CA), and were electrophoretically transferred to a nitrocellulose membrane (Schleicher & Schuell, Keene, NH). The membranes were probed with antibodies, as described below. Phospho-stress-activated protein kinase/JNK polyclonal antibody (pAb; 1:1000), phospho-MAPK pAb (1:1000), and phospho-p38 MAPK pAb (1:1000) were obtained from Cell Signaling Technology, Inc. (Beverly, MA). COX-2 pAb (1:1000) was obtained from Cayman Chemical Co. StARD1 pAb (1:2000) was obtained from Affinity BioReagents, Inc. (Golden, CO). StARD5 and StARD4 pAbs were provided by Dr. Jan Breslow (The Rockefeller University, New York, NY) (39). Sertoli sterol regulatory element-binding protein-1 (SREBP-1) pAb was obtained from Santa Cruz Biotechnology, Inc. (H-160; Santa Cruz, CA). Monoclonal anti-ß-actin antibody (1:2000) was purchased from Sigma-Aldrich Corp. Blots were developed with the ECL Western blotting system (Amersham Biosciences, Arlington Heights, IL) and exposed to x-ray film (Eastman Kodak Co., Rochester, NY). Densitometric analysis was performed using the personal computer version of National Institutes of Health Image software (Scion Image) after scanning. For Western analyses, particular signal intensities in each lane were normalized with those for ß-actin on the same membranes, and data are expressed as arbitrary units relative to control, set as a value of 1.
Total RNA extraction
Total RNA was extracted from SC using the TRIzol reagent (Invitrogen Life Technologies, Inc., Grand Island, NY) according to the manufacturer’s instructions. RNA was measured using 260/280 UV spectrophotometry.
RT-PCR analysis
Total RNA (2 µg) was reverse transcribed for 15 min at 42 C. RT was performed in a 20-µl mixture containing 5 mM MgCl2, 1x PCR buffer II, 4 mM each of deoxy-NTP, 1 U/µl ribonuclease inhibitor, and 2.5 mM random hexamers. Samples were then denatured for 5 min at 99 C. A no-template control was performed for each experiment, establishing the absence of genomic contamination of the samples. PCR was performed using 3 µl of each RT product as a template. The following primers were used: COX-2 sense primer, 5'-GGCCATGGAGTGGACTTAAA-3'; antisense primer, 5'-GGAACTGCTGGTTGAAAAGC-3' (442-bp product); and S16 ribosomal gene sense primer, 5'-TCCGCTGCAGTCCGTTCAAGTCTT-3'; antisense primer, 5'-GCCAAACTTCTTGGATTCGCAGCG-3' (385-bp product). AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA) was used at 25 mU/µl. The PCR mixture (25 µl) contained 2 mM MgCl2, 1x PCR buffer II, and each primer at 0.2 µM. Amplification was performed in a programmable thermal controller (model PTC-100, MJ Research, Inc., Watertown, MA). The samples were first denatured at 95 C for 2 min, followed by 30 PCR cycles; the temperature profile was 95 C (30 sec), 60 C (30 sec), and 72 C (1.5 min). After the last cycle, additional extension incubation at 72 C (7 min) was performed. After amplification, PCR products (5 µl of each sample) were subjected to size separation by polyacrylamide gel (4–20% Tris/boric acid/EDTA gels; Novex). The bands were visualized by UV fluorescence after staining with ethidium bromide (1 µg/ml) for 15 min. Densitometric analysis was performed using the personal computer version of National Institutes of Health Image software (Scion Image) after photography with a computer-assisted camera (Eastman Kodak Co.). COX-2 levels were normalized with S16 values and were expressed as arbitrary units relative to the control, set as a value of 1.
Real-time PCR analysis
Quantitative real-time fluorescence-monitored PCR (Q-PCR) assays using a standard curve method of analysis were conducted to quantitatively determine in each sample the levels of rat IL-1, IL-1ß, IL-6, StARD1, and StARD5 mRNAs (6-carboxy-fluorescein-labeled probes) with 18S ribosomal RNA (VIC dye-labeled probe) used to normalize the data for specific mRNAs.
Reactions were set up in triplicate in optical 96-well reaction plates by adding 23 µl of a mix containing 1x Q-PCR Master Mix Plus (Eurogentec, Philadelphia, PA), 200 nM primers, 100 nM probe for the gene of interest, 50 nM primers, and 200 nM probes for the 18S ribosomal RNA, and 2 µl of 6-fold diluted cDNA sample was subsequently added to each well.
Detection of IL mRNAs was performed using proprietary TaqMan primers and probes (Applied Biosystems). StARD1, StARD4, and StARD5 primers were designed and prepared to order (Applied Biosystems) for this study: D1: forward, GCCCATGGACAGACTCTATGAAG; and reverse, TCCTTGACATTTGGGTTCCACT, with ACCGCATGGAGGCCATGGG as probe; D4: forward, ATGCGTTACACCACTGCTGG; and reverse, CTTCATAGCCCACAGTATAGGAGAAA, using CAGCTTTTAAATATTATTTCCCCGAGAGAGTTTGTTG as probe; and D5: forward, TGGCACCATCAGCTCCAAT; and reverse, TCTCACAAAACCGGGCTTTG, using CCCATGTGGAACATCCATTGTGTCCC as probe.
Q-PCRs were performed using a PE Applied Biosystems model 7700 Sequence Detection System. The temperature profile for the reactions was 50 C (2 min), 95 C (10 min), and for 40 cycles at 95 C (15 sec) and 60 C (1 min). Using the manufacturer’s software, a threshold above the noise was chosen, and the cycle number at which fluorescence, generated by the cleavage of the probe, exceeded the threshold was determined for each well. For each real-time PCR assay, a standard curve was generated by six 2-fold serial dilutions in water of the RT samples corresponding to the 1-h treatment of SC with IL-1ß. The mean threshold cycle value for each cDNA sample was expressed as an arbitrary value relative to the standard curve after linear regression analysis. A no-template control was performed for each reaction in duplicate. Data were normalized with 18S values and were expressed as arbitrary units relative to the control, set as a value of 1.
Bioimaging
Primary SC were isolated from rat testes, purified, and maintained (3 d, 34 C) in 35-mm, glass-bottom culture dishes (MatTek, Ashland, MA). SC were then treated with IL-1ß for 3 h, placed on ice, and fixed (15 min) with 2% paraformaldehyde. Fixed cells were washed well with PBS and then permeabilized with 1 ml 0.1% IGEPAL CA630 detergent (Sigma-Aldrich Corp.) in PBS (15 min at room temperature). Free aldehyde groups were quenched by incubation with 0.1 M glycine in PBS (15 min at room temperature). Nonspecific binding was blocked by incubation of cells in PBS with 10% normal goat serum in PBS (blocking buffer; 30 min at room temperature). To double label the cells, rabbit antisera directed against StARD1 and StARD5 were preincubated with Alexa Fluor 488- and Alexa Fluor 594-conjugated rabbit IgG labeling reagents, respectively, according to the manufacturer’s protocol (Zenon Tricolor Rabbit IgG Labeling Kit, Molecular Probes, Inc., Eugene, OR). For the negative control, antibody complexes were prepared using normal rabbit IgG (Upstate Biotechnology, Inc., Lake Placid, NY) as the primary antibody. The ratio of labeling reagent to primary antibody was 6:1; final complexes were combined and diluted to a 1:90 final concentration in blocking buffer. Cell monolayers were incubated with 50 µl antibody mixtures in a humidified chamber (30 min at room temperature), then washed with blocking buffer. SC nuclei were stained using 4,6-diamino-2-phenylindole (DAPI) (Sigma-Aldrich Corp.; 4 µg/ml; 5 min) and rinsed in PBS before mounting in ProLong Antifade (Molecular Probes, Inc.), which was applied to the glass bottom, with a second coverglass used to seal the well. Images were captured using an inverted Axiovert 200 laser scanning microscope LSM510 confocal analyzer (Carl Zeiss, New York, NY) equipped with a UV laser, and a krypton/argon laser with 488- and 568-nm lines and a helium-neon laser with 633-nm line, allowing excitation of green-, red-, and far red-emitting fluorochromes and multitrack scanning fluorescence.
Flow cytometry
The fluoroprobe, 5-(and 6)-chloromethyl-2', 7'-dichlorodihydrofluorescein diacetate (CM-H2-DCFDA) was used to measure reactive oxygen species (ROS) in SC after treatment with inflammatory stimuli. This probe diffuses passively through the cellular membrane and is retained after intracellular deacetylation by endogenous esterases. The thiol-reactive chloromethyl group reacts with intracellular glutathione and other thiols. Upon oxidation, the fluorescent product dichlorofluorescein (DCF) is produced. On d 3, SC were preloaded with CM-H2-DCFDA (8 µM) for 30 min, then maintained for various times (2.5, 5, 10, 15, 20, 30, and 60 min) with IL-1ß, IL-6, vehicle (negative control), or 0.03% hydrogen peroxide (H2O2; positive control) at 34 C in 5% CO2. Cell samples were washed and resuspended in PBS, and cell-associated fluorescence intensity was measured using a FACSCalibur cytometer (BD Biosciences, San Jose, CA).
Data analysis
Densitometric analyses are expressed in arbitrary units. All results are the mean ± SEM derived from the number of different experiments. Statistical analyses were performed using t test or paired t test and ANOVA. P 
0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IL-1ß activates phosphorylation of SC JNK
Proteins were isolated from whole-cell lysates of SC treated with IL-1ß as indicated. Western analyses showed a doublet of phosphorylated JNK (phospho-JNK2/3 and phospho-JNK1; 54 and 46 kDa, respectively) within 30 min (Fig. 1A
), but not p44/42 or p38 MAPK, Akt, or JAK2 kinases (data not shown). Each membrane was reprobed for ß-actin to determine equal loading in the lanes and for normalization of particular signals. IL-1ß significantly activated JNK1 and JNK2/3 by serine phosphorylation as demonstrated (i.e. at 30 min, a 4.1-fold increase compared with control; P < 0.001; Fig. 1B). Treatment with the JNK-specific inhibitor SP600125 (10 µM) blocked IL-1ß-induced phospho-JNK (Fig. 2A).
|
|
, upper panel) or IL-6 (Fig. 2B, lower panel). In fact, the response to IL-1ß was less than the vehicle control for all time points tested, indicating reduced basal intracellular ROS levels. Such findings support an antiinflammatory role for IL-1ß signaling in SC. We next determined the kinetics and dose dependency of SC COX-2 induction by IL-1ß activation of JNK.
IL-1ß induces SC COX-2 and requires JNK activation
JNK phosphorylation was required for the increases observed in IL-1ß-inducible COX-2 protein [Fig. 2C, lane 1 vs. 3 (1 h) and lane 2 vs. 4 (3 h)]. To determine whether IL-1ß regulates COX-2 transcription, RT-PCR analyses were performed using total RNA extracts (three replicates) obtained from multiple primary SC experiments. COX-2 mRNA levels significantly increased in response to IL-1ß as early as 3 h (1.7-fold over control; P < 0.01) and remained significantly elevated at similar levels for 24 h or more after IL-1ß addition (P < 0.01; Fig. 3A). Steady-state S16 RNA levels were used for normalization.
|
0.04), findings consistent with the involvement of the JNK pathway in the 2-fold induction of COX-2 mRNA by IL-1ß (Fig. 3A). COX-1 remained constitutively expressed, but unchanged (data not shown).
To more fully evaluate the effects of IL-1ß on COX-2 induction at the level of its translation and steady-state protein levels in SC, Western blot analyses were performed. A time-dependent IL-1ß induction of COX-2 protein was demonstrated (Figs. 2C and 3, B and C). Significant induction of COX-2 protein was first evident within 1 h of treatment and was elevated more than 20-fold by 3 h. Strikingly, IL-1ß-stimulated 50-fold increases in COX-2 protein levels at 6 h (Fig. 3C; P < 0.001). Given that IL-1ß induced COX-2 mRNA levels 2-fold, these data are consistent with two different, but complementary, IL-1ß mechanisms of action, one transcriptional and the second a potent translational and/or posttranslational effect.
Stimulation of COX-2 protein requires de novo protein synthesis
To determine the mechanisms for induction of COX-2 expression by IL-1ß, SC were pretreated with the protein synthesis inhibitor, CHX (30 min). CHX prevented the IL-1ß induction of COX-2 protein (Fig. 3D), indicating that IL-1ß induction of COX-2 protein requires de novo protein synthesis. After CHX and IL-1ß treatment, no significant change was seen in the constitutive levels of COX-1 protein (data not shown).
Previous studies from this laboratory and others have indicated that physiological and proinflammatory cytokine factors may play a role in the paracrine and autocrine regulation and dysregulation of SC paracrine function. Therefore, we next examined the effect of IL-1ß on levels of SC cytokine expression.
Concomitant IL-1ß induction of IL expression occurs in a time- and dose-dependent manner
IL-1, IL-1ß, and IL-6 mRNAs were evaluated by Q-PCR analyses using sets of matched RNA replicates from five different experiments. IL-1 (5.6-fold; Fig. 4A) and IL-6 (2.8-fold; Fig. 4C) mRNAs were significantly induced by IL-1ß by 1 h (P < 0.001), a time at which no increase in IL-1ß mRNA was observed (Fig. 4B). At 6 h, levels of IL-1, IL-6, and IL-1ß mRNAs increased 9.4-, 3.3-, and 12.7-fold, respectively, above control levels (P < 0.001; Fig. 4). To examine the dose-response effect of IL-1ß on IL-1, IL-1ß, and IL-6 expression, SC were treated with or without IL-1ß at various doses (0.1, 1, 10, and 100 ng/ml) for 3 and 6 h. At both 3 and 6 h, IL-1ß induced the mRNA for each of these cytokines in a dose-dependent manner (Fig. 5).
|
|
, IL-1ß, and IL-6 mRNA levels were examined.
COX and JNK activity inhibitors decrease IL-1ß induction of SC IL-1, IL-1ß, and IL-6 mRNAs
In contrast to the failure of the COX activity inhibitors to affect IL-1ß induction of COX-2 mRNA levels, as early as 1 h the dual COX-1/COX-2 activity inhibitor INDO did significantly reduce, in part, the IL-1ß-stimulated increases in IL-6 mRNA, but not those in IL-1 or IL-1ß (data not shown). This inhibition was maintained at 3 h (2.9-fold; P < 0.001, compared with IL-1ß and vehicle; Fig. 6, E and F). For 3 and 6 h, the NS-398-specific inhibitor of COX-2 activity significantly decreased IL-1ß induction of IL-1 (1.5- and 1.9-fold, respectively; Fig. 6, A and B), IL-1ß (1.8- and 2.6-fold; Fig. 6, C and D), and IL-6 (3.9- and 2.8-fold; Fig. 6, E and F) mRNA levels (Fig. 6, B, D, and F; P < 0.001). Similar to those effects observed with INDO treatment, NS398 significantly decreased IL-1ß-induction of IL-6 mRNA as early as 1 h. Therefore, the early-onset changes in IL-6 expression are dependent on rapid changes in COX activity.
|
and IL-6 mRNAs, but not those in IL-1ß, effects observed as early as 3 h (Fig. 6, A, C, and E). At 6 h, SP600125 significantly inhibited IL-1ß induction of IL-1 (1.7-fold; Fig. 6B) and IL-1ß (3.7-fold; Fig. 6D) mRNA levels (P < 0.05 and P < 0.001, respectively). NS398 plus SP600125 treatment completely inhibited the IL-1ß-stimulated increases in IL-1ß and IL-6 by 6 h (Fig. 6, D and F). In comparison, the elevated level of IL-1 mRNA was significantly abrogated (Fig. 6B). To determine whether the IL-1ß-induction of SC COX, JNK, and cytokine pathways were associated with endoplasmic reticulum (ER) stress or intracellular lipid trafficking (41), we next evaluated the expression of several START domain-containing proteins. The expression of StARD5 (ER stress regulated) and StARD4 (cholesterol) were first determined in SC, then compared with that of a known START domain protein, StAR (D1; cAMP regulated) (39, 42).
IL-1ß regulates SC StARD1 and StARD5 mRNAs and proteins, but not StARD4
StARD1, StARD4, and StARD5 mRNA levels were evaluated by Q-PCR analyses using sets of matched RNA replicates from five different primary experiments (i.e. SC isolated and purified from 40 testes in each experiment). In contrast to the induction of cytokines, IL-1ß significantly decreased StARD1 mRNA as early as 1 h (Fig. 7A, 
; 0.7-fold; P < 0.001) as StARD5 mRNA levels increased (Fig. 7A,
, 
).
|
). In contrast to StARD1, the 28-kDa StARD5 protein decreased as early as 30 min and remained significantly decreased at very low, but detectable, levels from 1–6 h (Fig. 7B). Taken together, cellular StARD5 levels indicate that IL-1ß-induced changes in transcription are accompanied by a significant posttranslational effect(s), i.e. on its half-life, or degradation. No changes in StARD4 protein levels were observed (data not shown).
Bioimaging of StARD1and StARD5
On d 3 ex vivo, SC were treated for 3 h without (Fig. 8, A–C) or with IL-1ß (10 ng/ml; Fig. 8, D–F). SC were double immunolabeled with anti-StARD1 and anti-StARD5 antibodies. To facilitate the use of two pAb for a double-labeling protocol, Fabs of anti-Fc antibodies coupled to Alexa Fluor 488 and 594 (Molecular Probes, Inc.) fluorochromes were employed. As a control for nonspecific binding, we also double labeled with nonimmune rabbit IgG that was complexed separately with both fluorophores. For both antibody reagents, the nonspecific controls gave little to no background labeling (Fig. 8, H and I). StARD1 was localized in the perinuclear regions of the monolayer epithelial SC, but we did not observe any apparent changes in the pattern of localization induced by IL-1ß (Fig. 8, B and E). Based on fluorescent labeling, StARD5 was diffusely distributed in the cytoplasm compared with StARD1. Qualitatively, fluorescent levels of intracellular StARD5 decreased dramatically. These bioimaging findings are consistent with decreases measured quantitatively for whole-cell StARD5 protein using Western analysis, which show a dramatic decline 3 h after the addition of IL-1ß.
|
and 9A, ). In contrast to StARD1, NS-398 did inhibit the IL-1ß-mediated inductions in StARD5 mRNA levels at 3 h (Fig. 9B), consistent with COX regulation of D5 transcription. Taken together, these data suggest that although the initial IL-1ß-mediated inhibition of StARD1 transcription is not dependent on COX activity, the subsequent recovery phase StARD1 increases are COX dependent.
|
, lanes 2–5). In the presence of either the inhibitor of COX-2 (lanes 6–9) or JNK (not shown) activities, the IL-1ß-induced decline in SREBP-1 levels was truncated; SREBP-1 levels recovered to control levels as early as 3 h (Fig. 10, lane 8). CHX pretreatment had no effect on the IL-1ß-induced decreases in either the precursor or mature SREBP-1 (not shown). These findings are consistent with posttranslational mechanisms for the SREBP-1 transcription factor.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). By altering the seminiferous tubule microenvironment through COX-2-mediated changes in SC secretions such as PGs and cytokines, the potential exists for secondary, specific paracrine effects on germ cells. The data provide additional evidence that IL-1ß is a potent transcriptional autocrine regulator of SC, inducing the expression of several cytokines (IL-1, IL-1ß, and IL-6) in a time- and dose-dependent manner. These data suggest an important regulatory role for p54 and p46 JNK and the COX-2 cascade pathways in the control of cytokine production within the seminiferous tubule.
|
or IL-1ß, expression are dependent on the activity of the COX-2 enzyme. In contrast to our study with steroidogenic Leydig progenitors showing that the addition of IL-1ß and COX-2 activation of PG production had no direct effect on StAR expression (24), using age-matched, but fully differentiated, epithelial SC, IL-1ß significantly decreased StARD1 mRNA levels as early as 1 h. This inhibition was sustained at 6 h, but was followed by a subsequent and significant recovery phase increase in StAR mRNA beyond control steady-state levels (24 h). Differences in the regulatory mechanisms in distinct cell types are suggestive of specific feedback mechanisms defined by cell type as well as function. In the testis, the adult Leydig cell exhibits the most abundant expression of StARD1 commensurate with its ability to respond to the pituitary gonadotropin, LH, with cAMP-dependent StAR-mediated acute mitochondrial transfer of cholesterol to accumulate at the P450 side-chain cleavage site of action. Both posttranslational processing of the preexisting 37-kDa StAR to the intermediate 32- and mature 30-kDa forms for cholesterol transfer and new synthesis of the StARD1 protein are required (47, 48, 49). Previous studies demonstrated StAR protein in human and rodent SC and its induction in immature rat primary SC in response to stimulation by the gonadotropin FSH or a cAMP analog (50, 51). However, its precise role in this specialized epithelial cell remains largely unknown.
To our knowledge, this study shows for the first time the expression of two additional START domain-containing proteins, StARD4 and StARD5, in epithelial SC. Sertoli StAR and StARD5 proteins are differentially regulated by IL-1ß, but StARD4 is not. StARD5 mRNA levels increased with IL-1ß treatment as early as 1 h compared with concomitant decreases in StARD1 mRNA. Although little is known about the regulation of StARD5, the pattern of its expression indicates that it may be regulated by ER stresses, functioning as a sensor and mediator for the intracellular shuttling of sterols or other lipids (39). Interestingly, the bioimaging of the two START domain proteins also demonstrated somewhat different cellular patterns of localization. In SC, StARD1 protein is localized in perinuclear regions of the monolayer epithelial SC, a common pattern consistent with mitochondrial localization, whereas StARD5 was diffusely distributed in the cytoplasm. Consistent with our expression data, no apparent change was observed in the overall immunodetectable pattern of StARD1 between the control and IL-1ß-treated cells at 3 h. Because the ratios of the two forms of StAR did not change during this time, and the antibody recognizes both forms, the Western and intracellular immunodetection findings are consistent. Also, in agreement with multiple sequential D1 and D5 Western analyses from replicate experiments, StARD5 protein was significantly decreased in IL-1ß-treated SC to barely detectable levels compared with the uniformly distributed and relatively abundant D5 levels in matched control cells. StARD5 mRNA levels were not transiently induced in IL-1ß-treated SC in which COX-2 and JNK activities were also inhibited, indicating a requirement for kinase and COX activities. At 6 h, levels of StARD5 protein remained significantly below those in vehicle-matched control cells. Together, these findings indicate a role for COX-2 activity and the products of this pathway in StARD5 expression and homeostasis.
Cholesterol homeostasis is finely regulated in all cells to ensure an adequate intracellular supply and lipid homeostasis while avoiding excessive accumulation (52). Much of this regulation is transcriptional and mediated by members of the SREBP family of transcription factors that control cholesterol and lipid homeostasis (53, 54). However, it is likely that cholesterol regulation in the testis reflects a high degree of cell specificity at the transcriptional level. For example, the lack of a coordinate transcriptional control over the cholesterol biosynthetic pathway contributes importantly to overproduction of the signaling sterol testis meiosis-activating sterol (T-MAS) in the testis (55).
Recent studies identified transcriptional and posttranscriptional regulation of specific genes by cholesterol- and isoprenoid-derived signaling molecules (reviewed in Ref.54). In addition, the metabolic pathways in which these signaling molecules participate may exert important regulatory influences on the SC, which regulate the developing germ cells within the seminiferous tubule. Whether the observed decline in immunodetectable StARD5 is due to a combination of posttranscriptional and posttranslational effects, such as a failure to properly fold and/or protect the protein from degradation, requires additional study. However, it is likely that specific StARD5 protein function is compromised. For example, proper protein folding regulates the StAR-like steroidogenic function of the START domain-containing protein MLN64 (metastatic lymph node 64) (56, 57). Additionally, a recent study showed that NIH-3T3 fibroblast cells treated with tunicamycin to induce ER stress had 6- to 8-fold increases in StARD5 mRNA levels (39). Regulation of Sertoli START domain protein function may represent fine-tuning of metabolic processes and gene expression directly or may indirectly affect spermatogenesis by altering the Sertoli secretory microenvironment of developing germ cells and differentiating sperm.
Changes in StAR transcription and/or mRNA stability are known to be important regulatory events in the functional response of steroidogenic cells to hormone action (58). The StAR gene controls the rate-limiting step in the biogenesis of steroid hormones, delivery of cholesterol to the cholesterol side-chain cleavage enzyme on the inner mitochondrial membrane (47). Transcriptional regulation of the StAR gene is under basal regulation by steroidogenic factor-1 and is acutely regulated by hormones through the functional involvement of a cAMP response element-binding protein (59, 60). Recent studies identified histone modifications associated with active transcription and gene silencing in the control of StAR gene expression (61). Analysis of the human and rodent StARD1 promoter indicates that SREBP-1 enhances StAR transcription, but is unaffected when mature SREBP levels are suppressed (62, 63, 64).
SREBPs are bound to ER membranes until their cleavage by an SREBP cleavage-activating protein (SCAP), an event that requires new transcription of SCAP (65, 66). SREBP-1 (125 kDa) is bound in a hairpin fashion, and when proteolytically released from the membrane, the released NH2-terminal domain (68 kDa) is a transcription factor of the basic-helix-loop-helix-leucine zipper family, which then enters the nucleus. SREBP-regulated genes are involved not only in the synthesis of cholesterol, fatty acids, triglycerides, low-density lipoprotein receptor, and reduced nicotinamide adenine dinucleotide phosphate, but also in the synthesis of phospholipids (67). In the present studies, cellular levels of both the precursor and mature SREBP-1 decreased rapidly, findings coincident with the decline in StARD1 mRNA levels. The COX-2 specific activity inhibitor or the JNK inhibitor, which subsequently blocked induction of COX-2 RNA and protein, truncated this decrease in SREBP-1 and shortened the recovery to control levels. Induction of COX-2 in SC leads to marked deceases in the endoplasmic membrane 125-kDa SREBP-1, with a concomitant decline in the 68-kDa transcription factor. Transcription-dependent SCAP degradation of SREBP precursor and coactivators have been shown to be feedback mechanisms to regulate the expression of genes involved in cholesterol metabolism and may also regulate the duration of such transcriptional responses through protein stability (68, 69, 70). To date, our findings indicate that the effect of IL-1ß on endogenous SREBP-1 is due in part to posttranscriptional mechanisms.
Known SREBP target genes show coordinate regulation (39). In contrast to StARD4, the expression of START domain-containing family members MLN64 and StARD5 do not appear to be sterol regulated (39, 42, 52). However, overexpression of both StARD4 and StARD5 does stimulate liver X receptors reporter activity, suggesting their roles in cholesterol metabolism (39). In SC, decreases in both SREBP-1 forms were temporally associated with rapid induction of StARD5 mRNA at a time when D5 protein decreased to almost undetectable levels. Such IL-1ß-induced changes are indicative of transcriptional regulation of StARD5 as well as posttranscriptional effects. Temporally the effects on D5 were the inverse of those on D1, i.e. StARD1 mRNA levels strikingly decrease whereas the 32 30-kDa forms of mature StAR increase markedly, effects consistent with posttranslational processing. Although the effects of IL-1ß on SREBP-1 may directly affect StARD1 promoter activity (62, 63, 71), concomitant changes in D5 expression may be SREBP-1 independent, because StARD5 is transcriptionally activated by ER stressors (39, 52). Proper protein folding appears to regulate StAR-like steroidogenic function of MLN64 (56, 57). Taken together, these data indicate that noninflammatory IL-1ß activation of signaling mediated by COX-2, JNK phosphorylation, reduced intracellular ROS, and induction of IL-1, IL-6, and StARD5 transcription may reflect early-stage responses of the SC to ER stress, coordinated responses that together protect this cell. The absence of changes in StARD4 expression is consistent with studies that indicate it is regulated by sterols and SREBP2 transcriptional activation, but not by ER stress (39).
In summary, the present study indicates that specific Sertoli StAR-related (START) domain-containing proteins and cytokines are regulated by IL-1ß using mechanisms involving the activation of JNK and inducible COX-2 pathways, with effects on SC gene and protein expression within the seminiferous tubule (proposed model, Fig. 11). In addition, the present findings may be relevant to physiological role(s) for distinct START domain-containing proteins in intracellular sterol or lipid trafficking or metabolism by specialized epithelial cells in other organs.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
First Published Online August 25, 2005
Abbreviations: CHX, Cycloheximide; CM-H2-DCFDA, 5-(and 6)-chloromethyl-2', 7'-dichlorodihydrofluorescein diacetate; COX, cyclooxygenase; DAPI, 4,6-diamino-2-phenylindole; DCF, dichlorofluorescein; DMSO, dimethylsulfoxide; ER, endoplasmic reticulum; INDO, 1-(4-chlorobenzoyl)-5-methoxy-2-methyl-1H-indole-3-acetic acid; JNK, c-Jun NH2-terminal kinase; MLN64, metastatic lymph node 64 protein; pAb, polyclonal antibody; PG, prostaglandin; Q-PCR, quantitative real-time PCR; ROS, reactive oxygen species; SC, Sertoli cell; SCAP, sterol regulatory element-binding protein cleavage-activating protein; SREBP-1, sterol regulatory element-binding protein-1; StAR, steroidogenic acute regulatory protein; StARD1, StAR-related lipid transfer protein domain containing protein 1; START, StAR-related lipid transfer protein.
Received May 11, 2005.
Accepted for publication August 17, 2005.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production. Biochem Biophys Res Commun 185:154–161[CrossRef][Medline]
(IL-1) release, which triggers IL-6 production by an autocrine mechanism, through the lipoxygenase pathway. Endocrinology 136:3070–3078[Abstract]
and -1ß regulate interleukin-6 expression in Leydig and Sertoli cells. Recent Prog Horm Res 50:367–372
. Endocrinology 129:1614–1620
(IFN) receptor subunits: IFN enhances interferon regulatory factor-1 and interleukin-1ß converting enzyme expression. Endocrinology 139:2636–2644 messenger ribonucleic acid in rat Sertoli cells is dependent upon interaction with germ cells. Endocrinology 140:3755–3761 stimulates lactate dehydrogenase A expression and lactate production in cultured porcine Sertoli cells. Biol Reprod 59:1425–1432 in rat Sertoli cells. Gen Comp Endocrinol 122:88–97[CrossRef][Medline]
receptor expression by interleukin-1ß in cultured human granulosa-luteal cells. Endocrinology 138:3638–3644, -1ß, and IL-6 mRNA levels in Leydig cell progenitors. Endocrinology 143:3276–3283
B induction by IL-1ß in epithelial and lymphoid cells. J Immunol 159:5264–5272[Abstract]
-induced low density lipoprotein receptor expression in HepG2 cells. J Biol Chem 273:15742–15748 and PGE2 regulation of IL-1ß expression in Leydig cell progenitors. Endocrinology 144:1284–1291-hydroxylase/C17–20 lyase cytochrome P450 expression. Endocrinology 131:2165–2172 and interleukin-1 on 3ß-hydroxysteroid dehydrogenase/
5-4 isomerase expression in mouse Leydig cells. Endocrine 7:295–301[Medline]
and interleukin-6: model of NF-B- and map kinase-dependent inflammation in advanced atherosclerosis. J Biol Chem 280:21763–21772
SEK1/MKK4p38 mitogen-activated protein kinase pathway. J Biol Chem 273:12901–12908-induced activation of the c-jun amino-terminal kinases in stromal cells. Blood 88:3792–3800This article has been cited by other articles:
 |
|
 |
|
  T. J. Jerde and W. Bushman IL-1 Induces IGF-Dependent Epithelial Proliferation in Prostate Development and Reactive Hyperplasia Sci. Signal., September 1, 2009; 2(86): ra49 - ra49. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. LaVoie and S. R. King Transcriptional Regulation of Steroidogenic Genes: STARD1, CYP11A1 and HSD3B Experimental Biology and Medicine, August 1, 2009; 234(8): 880 - 907. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-C. Chen, R. K. Meier, S. Zheng, S. J. Khundmiri, M. T. Tseng, E. D. Lederer, P. N. Epstein, and B. J. Clark Steroidogenic acute regulatory-related lipid transfer domain protein 5 localization and regulation in renal tubules Am J Physiol Renal Physiol, August 1, 2009; 297(2): F380 - F388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Onorato, P. W. Brown, and P. L. Morris Mono-(2-ethylhexyl) Phthalate Increases Spermatocyte Mitochondrial Peroxiredoxin 3 and Cyclooxygenase 2 J Androl, May 1, 2008; 29(3): 293 - 303. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. R. Winnall, U. Ali, M. K. O'Bryan, J. J. Hirst, P. A.F. Whiley, J. A. Muir, and M. P. Hedger Constitutive Expression of Prostaglandin-Endoperoxide Synthase 2 by Somatic and Spermatogenic Cells Is Responsible for Prostaglandin E2 Production in the Adult Rat Testis Biol Reprod, May 1, 2007; 76(5): 759 - 768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. F. Riera, M. N. Galardo, E. H. Pellizzari, S. B. Meroni, and S. B. Cigorraga Participation of phosphatidyl inositol 3-kinase/protein kinase B and ERK1/2 pathways in interleukin-1{beta} stimulation of lactate production in Sertoli cells Reproduction, April 1, 2007; 133(4): 763 - 773. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ishikawa and P. L. Morris Interleukin-1{beta} Signals through a c-Jun N-Terminal Kinase-Dependent Inducible Nitric Oxide Synthase and Nitric Oxide Production Pathway in Sertoli Epithelial Cells Endocrinology, November 1, 2006; 147(11): 5424 - 5430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ishikawa and P. L. Morris A Multistep Kinase-Based Sertoli Cell Autocrine-Amplifying Loop Regulates Prostaglandins, Their Receptors, and Cytokines Endocrinology, April 1, 2006; 147(4): 1706 - 1716. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
, Vehicle control; 
