| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Obstetrics, Gynecology, and Reproductive Science, Yale School of Medicine, New Haven, Connecticut 06520
Address all correspondence and requests for reprints to: Carlos Stocco, Department of Obstetrics, Gynecology, and Reproductive Science, 333 Cedar Street, New Haven, Connecticut 06520. E-mail: carlos.stocco{at}yale.edu.
| Abstract |
|---|
|
|
|---|
-dihydroprogesterone decreased binding of [3H]progesterone, whereas androstenedione, 17
-hydroxyprogesterone, and pregnenolone were less potent. Other steroids, including corticosterone, mifepristone, and estradiol, were ineffective. We found that the rat CL expresses five genes previously postulated to encode for putative PMRs: PMR
, PMRß, PMR
, PR membrane component 1 (PRMC1), and Rda288. Pmr
, Pmr
, and Prmc1 transcripts rose steadily during pregnancy whereas Pmrß and Rda288 remained constant. Just before parturition, concomitant with falling progesterone levels, Pmr
, Pmrß, and Prmc1 decreased. Luteal PMR
and PRMC1 protein levels were lower in samples taken at the end of pregnancy compared with midpregnancy samples. Ergocriptine, which inhibits the secretion of prolactin, the primary luteotrophic hormone in the rat CL, reduced Pmr
, Pmrß, and Prmc1 expression significantly. Ergocriptine effects were prevented by coadministration of prolactin. These findings provide evidence for the expression and regulation of putative membrane-bound progestin-binding proteins in the rat CL, a tissue that does not express detectable levels of nuclear progesterone receptors. | Introduction |
|---|
|
|
|---|
-hydroxysteroid dehydrogenase (20
-HSD) expression (6, 7). In rodents, luteal 20
-HSD is involved in progesterone catabolism, and its expression is a hallmark of luteal regression. Moreover, progesterone also prevents apoptosis in the CL of rats (8, 9). Interestingly, although luteal cells of primates and farm animals express progesterone receptors (PR), immunohistochemical (6) and cDNA amplification studies (10) were unable to detect expression of PR in rat corpora lutea. In the absence of PR, it is possible to consider that alternative progesterone signaling pathways are present in rat luteal cells. In addition to the well-established role of PR in mediating the genomic effects of progesterone, the signal transduction properties of progesterone also involve rapid nongenomic signaling via plasma membrane-bound receptors. For example, progesterone-mediated inhibition of uterine sensitivity to oxytocin involves direct interaction of progesterone with the oxytocin receptor (11). Progesterone induction of oocyte maturation in amphibians and fish (12, 13) and initiation of the acrosome reaction in human sperm (14) are mediated by other membrane-bound progesterone-binding proteins. Several putative membrane-associated progesterone receptors have been cloned in a number of species. The first of these proteins was isolated from pig liver membranes in 1996 (15, 16). Its homologs were cloned in other species and referred to as 25-Dx in rats (17, 18) and Hpr6.6 (19) in humans. This protein was subsequently renamed PR membrane component 1 (PRMC1) and was found to be regulated by progesterone in brain regions involved in female reproductive behavior (18). Overexpression of PRMC1 in CHO cells increases progesterone binding to the cell membrane (20). An antibody directed against this protein suppresses progesterone-initiated Ca2+ increase in sperm (20). A second putative 60-kDa membrane-bound progesterone receptor was isolated from immature rat granulosa cells by using an antibody directed against the steroid-binding domain of nuclear PR (c-262) (21) and shown by ligand blot and ligand binding studies to bind progesterone (22). Its mRNA sequence is identical to a protein called RDA288 (23).
A very recent addition to the list of putative membrane receptors for progesterone was identified in sea trout and called mPR (24). This putative membrane receptor exerts nongenomic effects, including cAMP generation and activation of the MAPK pathway (24). Homologous proteins were identified in mammalian species, including humans, pigs, and mice (25). Phylogenetic analysis of these mammalian genes indicates that they comprise three distinct groups: mPR
, mPRß, and mPR
(25). We will refer to these proteins as progestin membrane receptors (PMR)
, ß, and
.1The expression of these proteins has not yet been studied in rat tissues. Recombinant mammalian PMR proteins expressed in Escherichia coli bind progesterone with high affinity and specificity (25). Recent observations indicate that PMR
is the dominant form in pregnant human reproductive tract tissues with the highest expression in fetal membranes and decreased expression in laboring myometrium (26). Taken together, these findings suggest that PMRs are novel membrane-bound PRs with defined actions.
Because progesterone exhibits autocrine effects in the rat CL, a tissue without detectable nuclear PR, we hypothesize that progesterone regulates rat luteal cell function through membrane-bound progestin-binding proteins. In this study, we examined whether there are proteins in the rat CL that 1) have properties consistent with a membrane progestin receptor, e.g. specific binding of progesterone in luteal membranes, 2) are homologs of putative membrane-bound progesterone-binding proteins, and 3) are expressed during pregnancy in a manner that parallels luteal function.
| Materials and Methods |
|---|
|
|
|---|
Identification, sequencing, and characterization of rat PMR orthologs
Nucleotide and protein sequence databases were searched using the standard nucleotide-nucleotide Basic Local Alignment Search Tool (BLASTN), protein query vs. translated database BLAST (TBLASTN), and translated query vs. translated database BLAST (TBLASTX) at the National Center for Biotechnology Information BLAST server (www.ncbi.nlm.nih.gov/blast). Mouse PMR
, PMRß, and PMR
(GenBank accession nos. AF313618, AF313617, and AK002481, respectively) cDNA sequences were used (25). Multiple alignments of the three rat PMR genes and proteins were performed using the MEGALIGN program, from the LASERGENE package (DNASTAR, Madison, WI). Protein structure predictions were performed using several internet resources, including DAS-domain prediction, Topology, TMAP, TmPRED, PredTMR, HMMTOP, and SOSUI (28).
Cloning of rat PMR
, PMRß, and PMR
cDNA
To clone rat PMR
, PMRß, and PMR
, total RNA was isolated from rat corpora lutea using Trizol reagent (Invitrogen, Carlsbad, CA) and reverse transcribed using oligo-dT18 primers and SuperScript II reverse transcriptase (Invitrogen). PCR on luteal cDNA was undertaken with Takara Ex Taq polymerase (Takara Mirus Bio, Madison, WI), using primers designed to amplify the entire coding sequence of each Pmr without stop codons and to incorporate specific restriction sites. The following primers were used: PMR
, caagcttatggcgatggcagtagcccag, gctcgagcttggtcttctgatggagtttgc; PMRß, ccgaattcgatgacgactgccatcctgg and cctcgagggaatctttcttaatcagtctg; PMR
, cgaattccccgccatggtgagcctgaagctccc and cctcgagtgtttccttttcatgtaattcaggc. Italicized letters indicate restriction sites. PCR products were cloned into the pCR2.1 vector (Invitrogen). Three to four clones were obtained for each Pmr gene, and sequencing (Keck Core Facility, Yale University) was carried out on each to ensure no unintended mutations had been introduced.
Total RNA isolation and reverse transcription
Total RNA from frozen tissues was isolated using Tri-Reagent according to the manufacturers instructions. For mRNA analysis by RT-PCR, 1 µg total RNA was reverse transcribed at 42 C using oligo-dT18 primers and SuperScript II reverse transcriptase (Invitrogen). The RT products were diluted to a final volume of 100 µl. A 5-µl aliquot of this dilution was used for PCR analysis.
mRNA quantification
Purified full-length cDNA for rat ß-actin, PMR
, PMRß, PMR
, and PRMC1 was used to prepare standard curves by performing dilutions ranging from 103 to 109 copies/µl. Real-time quantitative PCR was performed in single wells of a 96-well plate (Bio-Rad, Hercules, CA) using components of the iQ SYBR Green supermix (Bio-Rad). The 25-µl reaction mixture contained 12.5 µl iQ SYBR Green supermix (2x), 0.5 µM forward and reverse specific primer, and 5 µl of the sample (RT products) or standard. The following primers were used for PCR amplification: PMR
, ctggaagccgtacatctatgc and gaagctgtaatgccagaactc; PMRß, aagaaggccagccctgctggtac and tttgtggaggcaggggcatt; PMR
, agttccgccactgcctgcat and ccggggcttctggagttcaa; PRMC1, atgtggcaaggcccctggat and ggcgggctgcttcaagagattt; Rda288, cggcccagaccaactccaac and gaccacctcggcctcggata; ß-actin, ggccgggacctgacagacta and aggaagaggatgcggcagtg; and glyceraldehyde-3-phosphate dehydrogenase, tcaccagggctgccttctct and agtggcagtgatggcatgga. The following PCR thermocycling program was used: 95 C for 3 min followed by 35 cycles of 95 C for 10 sec, 62 C for 10 sec, and 72 C for 10 sec. Fluorescence was measured after each cycle and displayed graphically (iCycler iQ Real-time Detection System Software, version 2.3; Bio-Rad). The software determined the cycle threshold (Ct) values for each sample and standard. Standard curve Ct values and starting standard cDNA copies per reaction were used to determine the initial quantity of each PMR or that of the internal standard ß-actin based on the Ct values of each sample. Finally, the number of copies per nanogram of total RNA was calculated for each gene. The ratio between copies per nanogram of total RNA of the target genes and ß-actin is reported in each figure. Expression levels of 20
-HSD and
2-macroglobulin are reported as
ct values (29).
Subcellular fractionation and measurement of [3H]progesterone binding to rat luteal fractions
To examine whether luteal membranes contain specific binding for progestins, corpora lutea were isolated from d-14 pregnant rats pretreated with aminoglutethimide (25 mg/kg), an inhibitor of steroid synthesis, for 6 h to decrease the endogenous levels of progesterone. Corpora lutea were homogenized at 4 C with 10 strokes of the loose pestle B of a Dounce homogenizer (Weaton, Millville, NJ), followed by 10 strokes of the tight pestle A in a hypotonic buffer (0.25 M sucrose, 1 mM MgCl2, 20 mM HEPES-KOH, pH 7.4) supplemented with a mixture of protease inhibitors (Roche Applied Science, Indianapolis, IN). Homogenates were centrifuged at 2000 x g for 10 min to remove nuclei. Supernatants were centrifuged at 20,000 x g for 15 min to pellet the mitochondria. Cytosol and membranes were separated by centrifugation of the last supernatant at 105,000 x g for 60 min at 4 C in a T45 rotor (Beckman Instruments, Palo Alto, CA). Pellets were washed twice and then resuspended in a TEMGD binding buffer (see below). Protein concentration was determined using BSA as a standard.
Duplicate aliquots of rat luteal fractions were incubated at 4 C for 16 h (except where indicated) in a 0.5-ml TEMGD buffer containing 10 mM Tris-HCl (pH 7.4), 1.5 mM EDTA, 10% glycerol, 25 mM sodium molybdate, and 1 mM dithiothreitol in the presence of 5 nM of 3H-labeled progesterone and digitonin. The final digitonin concentration was 250 µM, except where indicated. The bound and free tracers were separated by the addition of 0.1 ml ice-cold, vigorously stirred dextran-coated charcoal [25 g Norit A activated charcoal (250350 mesh) and 2.5 g dextran (Sigma) in 100 ml TEMGD buffer]. After centrifugation at 3000 x g for 10 min at 4 C, the supernatants were carefully decanted, mixed with 5 ml scintillant, and counted by using liquid scintillation spectrometry. Nonspecific binding was measured in duplicate in the presence of 5 µM unlabeled progesterone. Additional controls included tubes without luteal membranes but with digitonin, and tubes with membranes but without digitonin. Saturation binding experiments were performed using increasing concentrations of 3H-labeled progesterone (101600 nM). Data from the saturation experiments were analyzed by nonlinear regression analysis using GraphPad Prism (GraphPad Software Inc., San Diego, CA). [3H]Progesterone binding was also measured in the absence or presence of increasing concentrations of several steroids. Tested steroids were dissolved in ethanol and added to the assay tubes; the final ethanol concentration in the assay was always 0.2%. Half-maximal inhibitory concentrations (IC50) were obtained by nonlinear fitting of inhibition curves (GraphPad Software).
Northern blot analysis
Ten micrograms of total RNA were fractionated by electrophoresis in 1% agarose gels and blotted to nylon membranes. Ethidium bromide staining was used to determine RNA quality, loading, and transfer. Full-length rat PMR
, PMRß, and PRMC1 cDNA were labeled with [
-32P]deoxy-CTP using random hexamer primers and Klenow DNA polymerase (Stratagene, Cedar Creek, TX). Blots were prehybridized for 5 h at 42 C in a solution containing 40% formamide, 6x SSPE (sodium chloride, sodium phosphate, EDTA), 5x Denhardts (pH 7.0), 0.2% SDS, and 150 µg/ml heterologous DNA. Hybridization was completed in the same solution containing 32P-labeled cDNA probe (3 x 106 cpm/ml) at 42 C overnight. Blots were washed and then exposed to Kodak X-AR film (Eastman Kodak, Rochester, NY) with an intensifying screen at 70 C.
Western blot analysis
A polyclonal antibody against the oligonucleotide KYRYRRPYPVMRKIC derived from PMRß was generated in a rabbit. For Western blot analysis, corpora lutea were homogenized in an ice-cold lysis buffer (10 mM Tris-Cl, pH 8.0; 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 40 µM phenylmethylsulfonyl fluoride, 0.3 µM aprotinin, and 1 µM leupeptin). This was followed by incubation for 30 min on ice and centrifugation at 10,000 x g for 20 min at 4 C. The supernatant was transferred to new tubes, aliquoted, and stored at 70 C until electrophoresis was performed. An aliquot of the supernatant was kept for protein measurement using BSA as the standard. Samples were denatured by adding sample buffer [62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, and 0.01% bromophenol blue], followed by boiling for 10 min. Thirty micrograms of protein were separated on 12% SDS-PAGE gels in Tris-glycine, 0.1% SDS buffer, and transferred into nitrocellulose membranes in 25 mM Tris, 192 mM glycine, and 20% methanol at 250 mA for 1.5 h. Blots were incubated for 2 h at room temperature in 5% nonfat dry milk to block nonspecific binding. Blots were then incubated overnight at 4 C with an anti-PMRß, an anti-PRMC1 (30, 31), or an anti-ß-actin antibody (Santa Cruz Biotechnology, Santa Cruz, CA). After washing, protein-antibody complexes were visualized using Western blotting Luminol reagent following the manufacturers protocol (Santa Cruz Biotechnology).
Statistical analysis
The one-way ANOVA, followed by the Tukey test, was carried out for the statistical analysis of mRNA expression levels using Prism software (GraphPad Software). Values were considered statistically significant at P < 0.05.
| Results |
|---|
|
|
|---|
|
|
-dihydroprogesterone (20
-DH-Pg) (IC50 = 283 ± 45 nM) competed for binding of the tracer in a dose-dependent manner (Fig. 3
-OH-progesterone (IC50 = 1820 ± 145 nM), androstenedione (IC50 = 3687 ± 341 nM), or pregnenolone (IC50 = 9171 ± 465 nM) were required to reduce binding by 50%. 17ß-Estradiol, corticosterone, and the progesterone antagonist RU486 failed to inhibit binding even at micromolar concentrations (Fig. 3
|
, Pmrß, and Pmr
have not been identified in the rat. Using BLASTN, a rat coding sequence, accession number XM_233551, with a homology of 98% to the mouse Pmr
cDNA and a homology of 59% to the sea trout mPR cDNA was found. Two matches were found for Pmrß (accession numbers NM_001014099 and BC079247). The former is a predicted coding sequence; the latter is a full cDNA sequence obtained from rat testis (32). One match was found for Pmr
, accession number BC087040, a cDNA clone from a rat kidney library (32).
Expression of Pmr
, Pmrß, Pmr
, Prmc1, and Rda288 mRNA in different rat tissues
We determined whether predicted Pmr cDNA sequences are present in rat tissues using RT-PCR. This analysis showed a distinct distribution of all putative receptors.
Pmr
.
Pmr
mRNA was found in the adrenal gland, kidney, brain, lung, and ovary of an adult nonpregnant rat. We found the highest expression of Pmr
mRNA in CL of d-15 pregnant rats (Fig. 4A
).
|
and Pmrß (data not shown).
Pmr
.
For Pmr
, PCR results indicate high levels of expression in kidney, but low expression was found in brain and CL of d-22 pregnant rats (Fig. 4A
). No signal for Pmr
, Pmrß, or Pmr
was detected in muscle.
In addition to Pmr, we examined the expression of Prmc1 and Rda288 in different tissues.
Prmc1.
PRmc1 mRNA was found to be expressed in the adrenal gland, ovary, liver, and CL. No expression was observed in skeletal or heart muscles (Fig. 4B
).
Rda288.
In contrast to the tissue-specific pattern of expression observed for Pmr
, Pmrß, Pmr
, and Prmc1, Rda288 transcript was expressed ubiquitously (Fig. 4B
).
Because PMRs are expressed in a tissue-specific manner, we compared [3H]progesterone binding in 1) the CL, which expresses Pmr
and PRMC1, 2) the brain and kidney (Pmrß and Pmr
), and 3) muscle (only Rda288). In the presence of digitonin, highly specific [3H]progesterone binding was observed in luteal, kidney, and brain membranes but not in muscle membranes. [3H]Progesterone binding was significantly higher in the CL when compared with that of kidney and brain.
Cloning and analysis of the rat PMR
, PMRß, and PMR
coding sequence
To further characterize rat Pmr
, Pmrß, and Pmr
, we cloned the full coding sequence of these receptors from CL. The full cDNA sequences of rat Pmr
, Pmrß, and Pmr
was submitted to GenBank (accession nos. DQ027002, DQ088964, and DQ088965, respectively). A 49.2% homology between rat Pmr
and Pmrß cDNA was found in annealing studies, whereas a 33% homology and a 31% homology were found between the rat Pmr
and Pmr
and the rat Pmrß and Pmr
, respectively. The coding region of each Pmr gene was subjected to a BLAST homology search against the Rat Genome database of the National Center for Biotechnology Information. This analysis placed the sequence of Pmr
in chromosome 5q36, Pmrß in chromosome 9q13, and Pmr
in chromosome 8q24. Thus, the three Pmr are on separate chromosomes.
The rat Pmr
, Pmrß, and Pmr
mRNA were predicted to encode proteins with 345, 354, and 330 amino acids with molecular masses of 39.2, 40.5, and 38 kDa, respectively (Fig. 5A
). The amino acid sequences of these proteins showed a 45% homology between rat PMR
and PMRß, whereas a 24% homology and a 26% homology were observed between PMR
and PMR
and PMRß and PMR
, respectively. Computational analyses (DAS-domain prediction, Topology, TMAP, TmPRED, PredTMR, HMMTOP, and SOSUI) and hydrophilicity studies of the deduced amino acid sequences indicated that rat PMR
, PMRß, and PMR
proteins are transmembrane proteins with several putative transmembrane domains (Fig. 5A
). These analyses consistently predicted the presence of seven transmembrane domains in PMR
. The predicted transmembrane domains ranged from 58 for PMRß and PMR
. Although the overall homology between PMR
and PMRß was 45%, the homology of the transmembrane regions ranged from 4874% (Fig. 5B
). The same tendency was observed between the transmembrane domains of PMR
and PMR
.
|
, Pmrß, Pmr
, and Prmc1 mRNA in the rat CL
, Pmrß, Pmr
, Prmc1, and Rda288 were found in the CL of pregnant rats, we examined the expression levels of these genes throughout pregnancy using Northern blot analysis (Fig. 6
|
|
.
transcripts of 5 and 1.7 kb. Northern blot (Fig. 6
mRNA content is low on d 4 of pregnancy but progressively increases from d 412. Maximal levels of Pmr
mRNA were found between d 12 and 20 of gestation. A significant (P < 0.01) decrease in Pmr
mRNA levels was observed between d 20 and 21 of gestation; mRNA levels remained low until d 22. The lower band (1.7 kb) detected by Northern blot showed a similar decrease toward the end of pregnancy, but its expression did not change between d 4 and 15.
PMRß.
Northern blot showed the presence of two transcripts of approximately 6 and 2 kb (Fig. 6
). In contrast to Pmr
, Pmrß mRNA levels (Northern and PCR) were much lower and remained constant between d 4 and 20 of gestation. A 4-fold decrease in Pmrß expression was observed on d 21 (Fig. 7B
).
PMR
.
Pmr
mRNA levels detected by RT-PCR were very low and increased progressively throughout pregnancy with no changes on d 21 (Fig. 7C
). Northern blot analysis failed to detect Pmr
mRNA when 10 µg of total mRNA were used.
PRmc1.
Prmc1 expression increased from d 412 of pregnancy (Figs. 6
and 7D
), reaching its highest levels on d 12 and 15. Thereafter, a progressive decrease that reached statistical significance on d 20 was observed.
Rda288.
No changes in the expression levels of Rda288 mRNA were observed at any stage of pregnancy (data not shown). No changes in the expression of ß-actin or ribosomal proteins S28 and S18 were observed throughout pregnancy. A summary of the relative expression levels of Prm
, Pmrß, Pmr
, and Prmc1, along with serum progesterone levels throughout pregnancy, is displayed in Fig. 7E
.
PMRß and PRMC1 protein levels in the rat CL
Next, we examined the expression of PMRß and PRMC1 in nuclear, microsomal, and cytosolic fractions obtained from corpora lutea of d-14 pregnant rats. PMRß and PRMC1 proteins were exclusively found in the microsomal fraction (Fig. 8A
). As expected from the mRNA levels, developmental studies showed a significant decrease in the expression of PMRß protein on d 17 and 22 of pregnancy when compared with d 12 (Fig. 8B
). Again, in good agreement with mRNA levels (Fig. 6
), high levels of PRMC1 protein were found on d 12 and 17 of pregnancy, followed by a large decrease on d 22 (Fig. 8B
). No changes in ß-actin protein levels were observed throughout pregnancy (Fig. 8B
).
|
, Pmrß, Pmr
, and Prmc1 mRNA expression by PRL
, Pmrß, Pmr
, and Prmc1 expression take place throughout pregnancy. Because, in rats, the CL of gestation is directly under the control of PRL or PRL-like hormones (33), we determined whether PRL affects the expression of Pmr and Prmc1. Rats on d 5 of gestation were treated with ERGO, ERGO plus PRL, or vehicle. Animals were killed 24 h after PRL treatment. Luteal expression of all receptors was quantified using real-time PCR. The expression of
2-macroglobulin (
2MG) and 20
-HSD, two genes known to be regulated by PRL (34, 35), was also studied.
As shown in Fig. 9
, Pmr
, Pmrß, and Prmc1 mRNA levels were significantly lower in ERGO-treated animals when compared with those of control animals. PRL treatment prevented the inhibitory effect of ERGO on the expression of Pmrß and Prmc1 but only partially blocked the inhibitory effect of ERGO on the expression of Pmr
. In contrast, a significant increase in the expression of PMR
was observed in ERGO-treated animals. PRL treatment attenuated the increase in PMR
induced by ERGO; however, because of the large variability, this effect was not statistically significant. As expected, ERGO treatment significantly inhibited the expression of
2MG and stimulated the expression of 20
-HSD, whereas cotreatment with PRL completely reversed these effects (Fig. 9
).
|
| Discussion |
|---|
|
|
|---|
The presence of binding sites in particulate fractions of the CL have been described in several species, including pigs (36), cows (37), sheep (38), and humans (39). We have extended these observations to show that similar binding sites are present in the rat CL. Although the mechanism by which digitonin acts to uncover the binding of progesterone is not known, as shown in this and previous studies (40), its action is not mimicked by other detergents. Moreover, the binding uncovered by digitonin is saturable and specific for progesterone, increases linearly with protein concentration, and is denatured by proteases and high heat. In addition, digitonin does not increase binding when added to nuclear fractions but does stimulate [3H]progesterone binding in microsomal fractions, which we showed contain at least two progesterone-binding proteins. Digitonin-stimulated binding to luteal membranes cannot be displaced by P450scc or 3ß-HSD inhibitors (37), two membrane-bound enzymes, which suggests that the [3H]progesterone binding observed in this study is unlikely to be a result of binding of the tracer to steroidogenic enzymes.
The apparent dissociation constant of 162 nM derived from saturation experiments is well within the range of values reported for other membrane progesterone-binding sites, including those found in the bovine CL [197 nM (37)], the rat and porcine liver [170 nM (41) and 11286 nM (16)], and the rat brain [160 nM (42)]. The dissociation constant of progesterone in rat luteal membranes is 40 times higher than the Kd reported for cytosolic progesterone receptors in the rat uterus [4 nM (43)]. Despite the relatively low affinity, it is probable that luteal membrane progesterone-binding sites are completely saturated because of the high concentration of progesterone present in the CL. The binding of progesterone to luteal membranes is specific, and the only steroid that can compete for binding of [3H]progesterone with an affinity close to that of progesterone is 20
-DH-Pg. The other steroids tested either competed poorly (17
-DH-Pg, androstenedione, and pregnenolone) or not at all (corticosterone, estradiol, and RU486). The binding of 20
-DH-Pg to CL membranes and the lack of binding of RU486 is strikingly different from the classical PR that does not bind 20
-DH-Pg (44) but avidly binds RU486 (45). After progesterone, 20
-DH-Pg is the second most abundant C21 steroid produced by the rat CL. It is synthesized only at the end of pregnancy, and its production, through metabolism of progesterone, is thought to be a mechanism for the initiation of parturition by eliminating the progestagenic activity of progesterone. Although 20
-DH-Pg binds to the CL membranes, it is possible that this steroid could act in this manner as an antagonist. However, this needs to be determined.
It has been previously shown that RU486 does not compete for binding of progesterone to other nongenomic sites, including human spermatozoa (46), human PMR
(25), and granulosa cells (22). Despite the failure of RU486 to compete for binding of [3H]progesterone to luteal membranes in this study, RU486 has been shown to act locally within the CL to regulate progesterone production (5, 47, 48). However, it is well known that RU486 is an antagonist of the glucocorticoid receptor. This protein is present in the CL (49, 50), and it is possible that RU486 is acting on the glucocorticoid receptor.
We cloned in the rat three PMRs homologous to the recently reported sea trout PMR. RT-PCR analysis showed a distinct tissue distribution of rat Pmr, with only a few tissues expressing significant amounts of more than one subtype. In the CL, we observed that the expression of Pmr mRNA and protein is regulated during pregnancy. Notably, developmental studies indicate that each PMR seems to be regulated independently. Whereas Pmrß remains almost constant throughout pregnancy, Pmr
and Pmr
expression increases with advancing gestation. In contrast, a different pattern was observed toward the end of pregnancy when a dramatic decrease in Pmr
and Pmrß expression takes place just before parturition, but PMR
mRNA levels remained constant. Quantification of mRNA levels demonstrated that Pmr
is expressed at very low levels, suggesting that it may not contribute physiologically to regulate luteal function. Developmental analysis also revealed that Pmr
and Prmc1 expression closely mimics serum progesterone concentration during pregnancy in the rat, suggesting that these genes have a central role in the regulation of luteal function. Obviously, a significant amount of work is necessary to determine the function of these progesterone-binding proteins in the rat CL.
Analyses of the rat PMR amino acid sequences indicate that these receptors are transmembrane proteins. We found that rat PRM
and PMRß share homology to a great degree, whereas much less homology exists between these receptors and PMR
. Similar findings have been reported for the human and mouse PMRs (25). Although expression of mouse and human PMRs in E. coli clearly indicates that they bind progesterone (25), a computational analysis of rat PMRs failed to predict possible steroid-binding domains. Additional studies on the structure and subcellular localization of these receptors are necessary to understand their mechanism of action, binding characteristics, and activation.
We also report for the first time the expression and regulation of PRMC1 (protein and mRNA) in the rat CL during pregnancy. Prmc1 cDNA was isolated and cloned from pig liver membranes (15, 16); an antibody against rat PRMC1 was produced much earlier in an effort to identify molecules specifically expressed in different zones of the rat adrenal gland (30). It was found that the antigen for this antibody is expressed exclusively in the adrenal inner zone; correspondingly, it was named the inner zone antigen (IZA). Later, IZA was identified as PRMC1 (31). The tissue distribution of Prmc1 mRNA agrees with the distribution of PRMC1 (IZA) protein previously reported (51). Thus, Prmc1 was found to be expressed at high levels in the adrenal gland, liver, and ovary of adult rats. Interestingly, we found the highest expression of Prmc1 in the CL of pregnant rats. Using immunohistochemical analysis, PRMC1 was found in the CL and the theca interna of preovulatory follicles but not in granulosa cells, the oocyte, theca externa, or in early stages of follicle development (51). These findings suggest that PRMC1 becomes expressed in granulosa cells after ovulation and remains highly expressed in the CL. We are currently investigating whether the expression of this protein is induced by LH. In the adrenal gland, PRMC1 is induced by cAMP (52), suggesting that in the ovary, PRMC1 could also respond to the LH/cAMP system. We have demonstrated that Prmc1 mRNA expression is regulated by PRL in the rat CL (see below), which suggests that multiple mechanisms may be involved in the regulation of this gene.
We found that the rat CL also expresses the mRNA for a protein named RDA288. This protein was proposed as a membrane-bound progesterone receptor (22) and to mediate the antiapoptotic effects of progesterone in granulosa cells (23). In our studies of the rat CL, [3H]progesterone binding was seen solely in membrane fractions. RDA288, however, does not contain transmembrane domains (23). Moreover, we found that Rda288 expression is not affected by the progress of the gestation and is expressed in all tissues examined, including those that do not bind progesterone. Consequently, it does not appear likely to us that RDA288 is an important mediator of progesterone action in the CL. It is possible that RDA288 may regulate luteal function in a progesterone-dependent manner through an association with a membrane-bound protein.
A key finding presented in this report is the regulation of Pmr and Prmc1 mRNA expression by PRL. In rodents, the CL of pregnancy is highly dependent upon the action of PRL and PRL-like hormones to maintain CLs structure and to produce progesterone needed for the maintenance of gestation. Accordingly, the main cause of infertility in PRL receptor knockout mice is a defect in CL formation and the absence of progesterone support for implantation and placental development (53). It is known that the inhibition of PRL secretion in vivo by ERGO treatment causes demise of the CL and abortion (27). We showed that ERGO causes a significant inhibition of Pmr
, Pmrß, and Prmc1 mRNA expression in the CL, and an increase in the expression of Pmr
was observed. The effects of ERGO were prevented by cotreatment with PRL. These results suggest that PRL is involved in the regulation of the expression of these receptors and that the PMRs and PRMC1 expression correlates with CL function. It is noteworthy that a decrease in PRL levels throughout ERGO treatment causes changes in the expression of Pmr and Prmc1 mRNA similar to those observed at the end of pregnancy. It is known that a decrease in the expression of PRL receptors takes place before parturition (54), which is induced by the luteolytic factor prostaglandin F2
(55). It is likely that the decrease in Pmr and Prmc1 expression observed on d 21 of pregnancy may be related to the decrease in PRL receptor expression throughout the luteolytic effect of prostaglandin F2
.
The intracellular signaling and specific functions of PMR
, PMRß, PMR
, and PRMC1 in luteal cells remain to be investigated. Because rat luteal cells do not express nuclear progesterone receptors, these cells are an ideal model for studying the effect of progesterone mediated by nonclassical receptors. In mouse knockout models of the classical progesterone receptors, despite the lack of ovulation, luteinization is normal (56), suggesting the classical progesterone receptor affects neither CL formation nor its function. This further implies an important role for nonclassical progesterone receptors in the maintenance of luteal function in rodents. In summary, our results represent the first report on the expression and regulation of putative membrane progesterone receptors in the rat CL.
| Acknowledgments |
|---|
| Footnotes |
|---|
This work was supported by a Startup fund from the Department of Obstetrics Gynecology, and Reproductive Science, Yale School of Medicine.
First Published Online August 25, 2005
Abbreviations: CL, Corpus luteum; Ct, cycle threshold; 20
-DH-Pg, 20
-dihydroprogesterone; ERGO, ergocriptine; 20
-HSD, 20
-hydroxysteroid dehydrogenase; IZA, inner zone antigen;
2MG,
2-macroglobulin; PMR, progestin membrane receptor; PR, progesterone receptor; PRL, prolactin; PRMC1, progesterone membrane component 1.
Received June 22, 2005.
Accepted for publication August 19, 2005.
| References |
|---|
|
|
|---|
in LH-induced luteolysis in pregnant rat. J Endocrinol 156:253259[Abstract]
-aminobutyric acid receptor-like features. Biol Reprod 58:11311137
2-macroglobulin by luteinizing hormone and prolactin during cell differentiation in the rat ovary. Mol Endocrinol 5:12801291
-hydroxysteroid dehydrogenase gene expression and the tyrosine kinase system. Biochem Biophys Res Commun 235:587592[CrossRef][Medline]
-hydroxysteroid dehydrogenase expression in the rat corpus luteum through the glucocorticoid receptor. Endocrinology 138:44974500
(PGF2
) and prolactin signaling: PGF2
-mediated inhibition of prolactin receptor expression in the corpus luteum. Endocrinology 144:33013305This article has been cited by other articles:
![]() |
S. Glaser, S. DeMorrow, H. Francis, Y. Ueno, E. Gaudio, S. Vaculin, J. Venter, A. Franchitto, P. Onori, B. Vaculin, et al. Progesterone stimulates the proliferation of female and male cholangiocytes via autocrine/paracrine mechanisms Am J Physiol Gastrointest Liver Physiol, July 1, 2008; 295(1): G124 - G136. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ndiaye, D. H. Poole, and J. L. Pate Expression and Regulation of Functional Oxytocin Receptors in Bovine T Lymphocytes Biol Reprod, April 1, 2008; 78(4): 786 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Dosiou, A E Hamilton, Y Pang, M T Overgaard, S Tulac, J Dong, P Thomas, and L C Giudice Expression of membrane progesterone receptors on human T lymphocytes and Jurkat cells and activation of G-proteins by progesterone J. Endocrinol., January 1, 2008; 196(1): 67 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schumacher, R. Guennoun, A. Ghoumari, C. Massaad, F. Robert, M. El-Etr, Y. Akwa, K. Rajkowski, and E.-E. Baulieu Novel Perspectives for Progesterone in Hormone Replacement Therapy, with Special Reference to the Nervous System Endocr. Rev., June 1, 2007; 28(4): 387 - 439. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Josefsberg Ben-Yehoshua, A. L. Lewellyn, P. Thomas, and J. L. Maller The Role of Xenopus Membrane Progesterone Receptor {beta} in Mediating the Effect of Progesterone on Oocyte Maturation Mol. Endocrinol., March 1, 2007; 21(3): 664 - 673. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Stocco, C. Telleria, and G. Gibori The Molecular Control of Corpus Luteum Formation, Function, and Regression Endocr. Rev., February 1, 2007; 28(1): 117 - 149. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Thomas, Y. Pang, J. Dong, P. Groenen, J. Kelder, J. de Vlieg, Y. Zhu, and C. Tubbs Steroid and G Protein Binding Characteristics of the Seatrout and Human Progestin Membrane Receptor {alpha} Subtypes and Their Evolutionary Origins Endocrinology, February 1, 2007; 148(2): 705 - 718. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Hapon, A. B Motta, M. Ezquer, M. Bonafede, and G. A Jahn Hypothyroidism prolongs corpus luteum function in the pregnant rat Reproduction, January 1, 2007; 133(1): 197 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E Nilsson, J. Stanfield, and M. K Skinner Interactions between progesterone and tumor necrosis factor-{alpha} in the regulation of primordial follicle assembly. Reproduction, December 1, 2006; 132(6): 877 - 886. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Krietsch, M. S. Fernandes, J. Kero, R. Losel, M. Heyens, E. W.-F. Lam, I. Huhtaniemi, J. J. Brosens, and B. Gellersen Human Homologs of the Putative G Protein-Coupled Membrane Progestin Receptors (mPR{alpha}, {beta}, and {gamma}) Localize to the Endoplasmic Reticulum and Are Not Activated by Progesterone Mol. Endocrinol., December 1, 2006; 20(12): 3146 - 3164. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Ashley, C. M. Clay, T. A. Farmerie, G. D. Niswender, and T. M. Nett Cloning and Characterization of an Ovine Intracellular Seven Transmembrane Receptor for Progesterone that Mediates Calcium Mobilization Endocrinology, September 1, 2006; 147(9): 4151 - 4159. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hanna, Y. Pang, P. Thomas, and Y. Zhu Cell-surface expression, progestin binding, and rapid nongenomic signaling of zebrafish membrane progestin receptors {alpha} and {beta} in transfected cells. J. Endocrinol., August 1, 2006; 190(2): 247 - 260. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Peluso Multiplicity of Progesterone's Actions and Receptors in the Mammalian Ovary Biol Reprod, July 1, 2006; 75(1): 2 - 8. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Peluso, A. Pappalardo, R. Losel, and M. Wehling Progesterone Membrane Receptor Component 1 Expression in the Immature Rat Ovary and Its Role in Mediating Progesterone's Antiapoptotic Action Endocrinology, June 1, 2006; 147(6): 3133 - 3140. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |