help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0759
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
146/12/5522    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cai, Z.
Right arrow Articles by Stocco, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cai, Z.
Right arrow Articles by Stocco, C.
Endocrinology Vol. 146, No. 12 5522-5532
Copyright © 2005 by The Endocrine Society

Expression and Regulation of Progestin Membrane Receptors in the Rat Corpus Luteum

Zailong Cai and Carlos Stocco

Department of Obstetrics, Gynecology, and Reproductive Science, Yale School of Medicine, New Haven, Connecticut 06520

Address all correspondence and requests for reprints to: Carlos Stocco, Department of Obstetrics, Gynecology, and Reproductive Science, 333 Cedar Street, New Haven, Connecticut 06520. E-mail: carlos.stocco{at}yale.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Despite evidence strongly supporting progesterone’s autocrine actions in the rat corpus luteum (CL), classical progesterone receptors (PR) have not been detected in this gland. Alternatively, in several other systems, progestins have been reported to activate nongenomic pathways via putative progestin membrane receptors (PMRs). The aim of this investigation was to determine whether rat CL membranes bind progestins and contain PMR homologs and whether these proteins are expressed during CL development in a manner that parallels luteal function. We found that luteal cell membranes specifically bind progesterone. Low levels of progesterone and 20{alpha}-dihydroprogesterone decreased binding of [3H]progesterone, whereas androstenedione, 17{alpha}-hydroxyprogesterone, and pregnenolone were less potent. Other steroids, including corticosterone, mifepristone, and estradiol, were ineffective. We found that the rat CL expresses five genes previously postulated to encode for putative PMRs: PMR{alpha}, PMRß, PMR{gamma}, PR membrane component 1 (PRMC1), and Rda288. Pmr{alpha}, Pmr{gamma}, and Prmc1 transcripts rose steadily during pregnancy whereas Pmrß and Rda288 remained constant. Just before parturition, concomitant with falling progesterone levels, Pmr{alpha}, Pmrß, and Prmc1 decreased. Luteal PMR{alpha} and PRMC1 protein levels were lower in samples taken at the end of pregnancy compared with midpregnancy samples. Ergocriptine, which inhibits the secretion of prolactin, the primary luteotrophic hormone in the rat CL, reduced Pmr{alpha}, Pmrß, and Prmc1 expression significantly. Ergocriptine effects were prevented by coadministration of prolactin. These findings provide evidence for the expression and regulation of putative membrane-bound progestin-binding proteins in the rat CL, a tissue that does not express detectable levels of nuclear progesterone receptors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PROGESTERONE IS PRODUCED in large amounts by the corpus luteum (CL). Luteal progesterone acts not only in tissues such as the endometrium, mammary gland, and brain but also locally to regulate ovarian function. In the ovary, progesterone regulates mitosis and apoptosis of granulosa cells (1) and plays a key role in ovulation (2). Progesterone also regulates CL function. In humans, progesterone is critical for the development and maintenance of the CL during the menstrual cycle and extends luteal function during early pregnancy (3). Progesterone has antiapoptotic effects in bovine luteal cells (4). Incubation of rat luteal cells with R5020, a synthetic progestin, increases progesterone production in a dose-dependent manner (5, 6). Progesterone has also been shown to inhibit 20{alpha}-hydroxysteroid dehydrogenase (20{alpha}-HSD) expression (6, 7). In rodents, luteal 20{alpha}-HSD is involved in progesterone catabolism, and its expression is a hallmark of luteal regression. Moreover, progesterone also prevents apoptosis in the CL of rats (8, 9). Interestingly, although luteal cells of primates and farm animals express progesterone receptors (PR), immunohistochemical (6) and cDNA amplification studies (10) were unable to detect expression of PR in rat corpora lutea. In the absence of PR, it is possible to consider that alternative progesterone signaling pathways are present in rat luteal cells.

In addition to the well-established role of PR in mediating the genomic effects of progesterone, the signal transduction properties of progesterone also involve rapid nongenomic signaling via plasma membrane-bound receptors. For example, progesterone-mediated inhibition of uterine sensitivity to oxytocin involves direct interaction of progesterone with the oxytocin receptor (11). Progesterone induction of oocyte maturation in amphibians and fish (12, 13) and initiation of the acrosome reaction in human sperm (14) are mediated by other membrane-bound progesterone-binding proteins. Several putative membrane-associated progesterone receptors have been cloned in a number of species. The first of these proteins was isolated from pig liver membranes in 1996 (15, 16). Its homologs were cloned in other species and referred to as 25-Dx in rats (17, 18) and Hpr6.6 (19) in humans. This protein was subsequently renamed PR membrane component 1 (PRMC1) and was found to be regulated by progesterone in brain regions involved in female reproductive behavior (18). Overexpression of PRMC1 in CHO cells increases progesterone binding to the cell membrane (20). An antibody directed against this protein suppresses progesterone-initiated Ca2+ increase in sperm (20). A second putative 60-kDa membrane-bound progesterone receptor was isolated from immature rat granulosa cells by using an antibody directed against the steroid-binding domain of nuclear PR (c-262) (21) and shown by ligand blot and ligand binding studies to bind progesterone (22). Its mRNA sequence is identical to a protein called RDA288 (23).

A very recent addition to the list of putative membrane receptors for progesterone was identified in sea trout and called mPR (24). This putative membrane receptor exerts nongenomic effects, including cAMP generation and activation of the MAPK pathway (24). Homologous proteins were identified in mammalian species, including humans, pigs, and mice (25). Phylogenetic analysis of these mammalian genes indicates that they comprise three distinct groups: mPR{alpha}, mPRß, and mPR{gamma} (25). We will refer to these proteins as progestin membrane receptors (PMR) {alpha}, ß, and {gamma}.1The expression of these proteins has not yet been studied in rat tissues. Recombinant mammalian PMR proteins expressed in Escherichia coli bind progesterone with high affinity and specificity (25). Recent observations indicate that PMR{alpha} is the dominant form in pregnant human reproductive tract tissues with the highest expression in fetal membranes and decreased expression in laboring myometrium (26). Taken together, these findings suggest that PMRs are novel membrane-bound PRs with defined actions.

Because progesterone exhibits autocrine effects in the rat CL, a tissue without detectable nuclear PR, we hypothesize that progesterone regulates rat luteal cell function through membrane-bound progestin-binding proteins. In this study, we examined whether there are proteins in the rat CL that 1) have properties consistent with a membrane progestin receptor, e.g. specific binding of progesterone in luteal membranes, 2) are homologs of putative membrane-bound progesterone-binding proteins, and 3) are expressed during pregnancy in a manner that parallels luteal function.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Sprague-Dawley rats (d 1 = sperm positive) purchased from Sasco Animal Labs (Madison, WI) were housed at 24 C with a 14-h light, 10-h dark cycle (lights on 0500–1900 h) and allowed free access to Purina Rat Chow and water. To study the effect of prolactin (PRL) on luteal gene expression, on d 5 of gestation, at the time when CL function is exclusively sustained by pituitary PRL (27), rats were treated with either ergocryptine (ERGO) (25 mg/rat), an inhibitor of PRL secretion, or with ERGO plus PRL (50 µg/rat). PRL was administered 30 min before the administration of ERGO (27). Animals were killed 24 h after PRL treatment. Animal care and handling conformed to the National Institutes of Health guidelines for animal research. The experimental protocol was approved by the Yale Institutional Animal Care and Use Committee.

Identification, sequencing, and characterization of rat PMR orthologs
Nucleotide and protein sequence databases were searched using the standard nucleotide-nucleotide Basic Local Alignment Search Tool (BLASTN), protein query vs. translated database BLAST (TBLASTN), and translated query vs. translated database BLAST (TBLASTX) at the National Center for Biotechnology Information BLAST server (www.ncbi.nlm.nih.gov/blast). Mouse PMR{alpha}, PMRß, and PMR{gamma} (GenBank accession nos. AF313618, AF313617, and AK002481, respectively) cDNA sequences were used (25). Multiple alignments of the three rat PMR genes and proteins were performed using the MEGALIGN program, from the LASERGENE package (DNASTAR, Madison, WI). Protein structure predictions were performed using several internet resources, including DAS-domain prediction, Topology, TMAP, TmPRED, PredTMR, HMMTOP, and SOSUI (28).

Cloning of rat PMR{alpha}, PMRß, and PMR{gamma} cDNA
To clone rat PMR{alpha}, PMRß, and PMR{gamma}, total RNA was isolated from rat corpora lutea using Trizol reagent (Invitrogen, Carlsbad, CA) and reverse transcribed using oligo-dT18 primers and SuperScript II reverse transcriptase (Invitrogen). PCR on luteal cDNA was undertaken with Takara Ex Taq polymerase (Takara Mirus Bio, Madison, WI), using primers designed to amplify the entire coding sequence of each Pmr without stop codons and to incorporate specific restriction sites. The following primers were used: PMR{alpha}, caagcttatggcgatggcagtagcccag, gctcgagcttggtcttctgatggagtttgc; PMRß, ccgaattcgatgacgactgccatcctgg and cctcgagggaatctttcttaatcagtctg; PMR{gamma}, cgaattccccgccatggtgagcctgaagctccc and cctcgagtgtttccttttcatgtaattcaggc. Italicized letters indicate restriction sites. PCR products were cloned into the pCR2.1 vector (Invitrogen). Three to four clones were obtained for each Pmr gene, and sequencing (Keck Core Facility, Yale University) was carried out on each to ensure no unintended mutations had been introduced.

Total RNA isolation and reverse transcription
Total RNA from frozen tissues was isolated using Tri-Reagent according to the manufacturer’s instructions. For mRNA analysis by RT-PCR, 1 µg total RNA was reverse transcribed at 42 C using oligo-dT18 primers and SuperScript II reverse transcriptase (Invitrogen). The RT products were diluted to a final volume of 100 µl. A 5-µl aliquot of this dilution was used for PCR analysis.

mRNA quantification
Purified full-length cDNA for rat ß-actin, PMR{alpha}, PMRß, PMR{gamma}, and PRMC1 was used to prepare standard curves by performing dilutions ranging from 103 to 109 copies/µl. Real-time quantitative PCR was performed in single wells of a 96-well plate (Bio-Rad, Hercules, CA) using components of the iQ SYBR Green supermix (Bio-Rad). The 25-µl reaction mixture contained 12.5 µl iQ SYBR Green supermix (2x), 0.5 µM forward and reverse specific primer, and 5 µl of the sample (RT products) or standard. The following primers were used for PCR amplification: PMR{alpha}, ctggaagccgtacatctatgc and gaagctgtaatgccagaactc; PMRß, aagaaggccagccctgctggtac and tttgtggaggcaggggcatt; PMR{gamma}, agttccgccactgcctgcat and ccggggcttctggagttcaa; PRMC1, atgtggcaaggcccctggat and ggcgggctgcttcaagagattt; Rda288, cggcccagaccaactccaac and gaccacctcggcctcggata; ß-actin, ggccgggacctgacagacta and aggaagaggatgcggcagtg; and glyceraldehyde-3-phosphate dehydrogenase, tcaccagggctgccttctct and agtggcagtgatggcatgga. The following PCR thermocycling program was used: 95 C for 3 min followed by 35 cycles of 95 C for 10 sec, 62 C for 10 sec, and 72 C for 10 sec. Fluorescence was measured after each cycle and displayed graphically (iCycler iQ Real-time Detection System Software, version 2.3; Bio-Rad). The software determined the cycle threshold (Ct) values for each sample and standard. Standard curve Ct values and starting standard cDNA copies per reaction were used to determine the initial quantity of each PMR or that of the internal standard ß-actin based on the Ct values of each sample. Finally, the number of copies per nanogram of total RNA was calculated for each gene. The ratio between copies per nanogram of total RNA of the target genes and ß-actin is reported in each figure. Expression levels of 20{alpha}-HSD and {alpha}2-macroglobulin are reported as {Delta}ct values (29).

Subcellular fractionation and measurement of [3H]progesterone binding to rat luteal fractions
To examine whether luteal membranes contain specific binding for progestins, corpora lutea were isolated from d-14 pregnant rats pretreated with aminoglutethimide (25 mg/kg), an inhibitor of steroid synthesis, for 6 h to decrease the endogenous levels of progesterone. Corpora lutea were homogenized at 4 C with 10 strokes of the loose pestle B of a Dounce homogenizer (Weaton, Millville, NJ), followed by 10 strokes of the tight pestle A in a hypotonic buffer (0.25 M sucrose, 1 mM MgCl2, 20 mM HEPES-KOH, pH 7.4) supplemented with a mixture of protease inhibitors (Roche Applied Science, Indianapolis, IN). Homogenates were centrifuged at 2000 x g for 10 min to remove nuclei. Supernatants were centrifuged at 20,000 x g for 15 min to pellet the mitochondria. Cytosol and membranes were separated by centrifugation of the last supernatant at 105,000 x g for 60 min at 4 C in a T45 rotor (Beckman Instruments, Palo Alto, CA). Pellets were washed twice and then resuspended in a TEMGD binding buffer (see below). Protein concentration was determined using BSA as a standard.

Duplicate aliquots of rat luteal fractions were incubated at 4 C for 16 h (except where indicated) in a 0.5-ml TEMGD buffer containing 10 mM Tris-HCl (pH 7.4), 1.5 mM EDTA, 10% glycerol, 25 mM sodium molybdate, and 1 mM dithiothreitol in the presence of 5 nM of 3H-labeled progesterone and digitonin. The final digitonin concentration was 250 µM, except where indicated. The bound and free tracers were separated by the addition of 0.1 ml ice-cold, vigorously stirred dextran-coated charcoal [25 g Norit A activated charcoal (250–350 mesh) and 2.5 g dextran (Sigma) in 100 ml TEMGD buffer]. After centrifugation at 3000 x g for 10 min at 4 C, the supernatants were carefully decanted, mixed with 5 ml scintillant, and counted by using liquid scintillation spectrometry. Nonspecific binding was measured in duplicate in the presence of 5 µM unlabeled progesterone. Additional controls included tubes without luteal membranes but with digitonin, and tubes with membranes but without digitonin. Saturation binding experiments were performed using increasing concentrations of 3H-labeled progesterone (10–1600 nM). Data from the saturation experiments were analyzed by nonlinear regression analysis using GraphPad Prism (GraphPad Software Inc., San Diego, CA). [3H]Progesterone binding was also measured in the absence or presence of increasing concentrations of several steroids. Tested steroids were dissolved in ethanol and added to the assay tubes; the final ethanol concentration in the assay was always 0.2%. Half-maximal inhibitory concentrations (IC50) were obtained by nonlinear fitting of inhibition curves (GraphPad Software).

Northern blot analysis
Ten micrograms of total RNA were fractionated by electrophoresis in 1% agarose gels and blotted to nylon membranes. Ethidium bromide staining was used to determine RNA quality, loading, and transfer. Full-length rat PMR{alpha}, PMRß, and PRMC1 cDNA were labeled with [{alpha}-32P]deoxy-CTP using random hexamer primers and Klenow DNA polymerase (Stratagene, Cedar Creek, TX). Blots were prehybridized for 5 h at 42 C in a solution containing 40% formamide, 6x SSPE (sodium chloride, sodium phosphate, EDTA), 5x Denhardt’s (pH 7.0), 0.2% SDS, and 150 µg/ml heterologous DNA. Hybridization was completed in the same solution containing 32P-labeled cDNA probe (3 x 106 cpm/ml) at 42 C overnight. Blots were washed and then exposed to Kodak X-AR film (Eastman Kodak, Rochester, NY) with an intensifying screen at –70 C.

Western blot analysis
A polyclonal antibody against the oligonucleotide KYRYRRPYPVMRKIC derived from PMRß was generated in a rabbit. For Western blot analysis, corpora lutea were homogenized in an ice-cold lysis buffer (10 mM Tris-Cl, pH 8.0; 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 40 µM phenylmethylsulfonyl fluoride, 0.3 µM aprotinin, and 1 µM leupeptin). This was followed by incubation for 30 min on ice and centrifugation at 10,000 x g for 20 min at 4 C. The supernatant was transferred to new tubes, aliquoted, and stored at –70 C until electrophoresis was performed. An aliquot of the supernatant was kept for protein measurement using BSA as the standard. Samples were denatured by adding sample buffer [62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, and 0.01% bromophenol blue], followed by boiling for 10 min. Thirty micrograms of protein were separated on 12% SDS-PAGE gels in Tris-glycine, 0.1% SDS buffer, and transferred into nitrocellulose membranes in 25 mM Tris, 192 mM glycine, and 20% methanol at 250 mA for 1.5 h. Blots were incubated for 2 h at room temperature in 5% nonfat dry milk to block nonspecific binding. Blots were then incubated overnight at 4 C with an anti-PMRß, an anti-PRMC1 (30, 31), or an anti-ß-actin antibody (Santa Cruz Biotechnology, Santa Cruz, CA). After washing, protein-antibody complexes were visualized using Western blotting Luminol reagent following the manufacturer’s protocol (Santa Cruz Biotechnology).

Statistical analysis
The one-way ANOVA, followed by the Tukey test, was carried out for the statistical analysis of mRNA expression levels using Prism software (GraphPad Software). Values were considered statistically significant at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Binding of [3H]progesterone to luteal subcellular fractions
[3H]Progesterone binding was determined in luteal subcellular fractions obtained from d-14 pregnant rats pretreated with aminoglutethimide. As shown in Fig. 1AGo, [3H]progesterone binding was observed in the luteal membrane fraction, but no or low binding was observed when the cytosolic or the nuclear fractions were examined (Fig. 1AGo). Binding to microsomal fractions was observed only in the presence of digitonin. Other detergents such as CHAPS, DTAB, Tween 20, Tween 80, Triton X-100, Triton X-114, MP-40, and Brj35 did not reveal [3H]progesterone binding, even at concentrations well in excess of their critical micellar concentrations (Fig. 1BGo). Nonspecific binding was observed in the presence of 10 times the critical micellar concentration of CHAPS and DTAB detergents, but this effect was also observed in the absence of luteal membranes.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. A, Effect of digitonin on progesterone binding to subcellular fractions of CL from d-14 pregnant rats. Duplicate aliquots of each subcellular fraction were incubated overnight at 4 C in the presence or absence of 250 µM digitonin. Values are means ± SEM. The experiment was repeated four times. 1, Nuclei; 2, microsome; 3, cytosol. B, Effect of a number of detergents on progesterone binding to rat luteal membranes. Luteal membranes were incubated in the presence or absence of either 1x or 10x each detergent critical micellar concentration (CMC). Only digitonin specifically stimulated progesterone binding. The experiment was repeated twice.

 
The addition of 1000-fold unlabeled progesterone completely displaced the binding of [3H]progesterone to rat luteal membranes, whereas incubation of luteal membranes for 10 min at 96 C completely abolished their progesterone-binding activity (Fig. 2AGo). Furthermore, treatment of membranes with proteinase K at 37 C for 1 h significantly reduced progesterone-binding activity (Fig. 2AGo), but incubation at 37 C in the absence of the protease had no significant effect on tracer binding. In the presence of digitonin (250 µM), [3H]progesterone binding increased linearly with the protein concentration (Fig. 2BGo). Digitonin increased [3H]progesterone binding in a dose-dependent manner, reaching a plateau at 1500 µM (Fig. 2CGo). Binding increased rapidly, reaching 80% of maximal binding within 1 h of incubation (Fig. 2DGo). In Fig. 2EGo, a representative saturation curve of [3H]progesterone binding to luteal membranes is shown. The average Bmax and Kd values of three separated experiments were 270.5 ± 15 nmol/mg protein and 162 ± 20 nM, respectively.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2. Characteristics [3H]progesterone binding in luteal membranes from rats on d 14 of pregnancy. A, Specific binding (SB) and nonspecific binding (NSB) determined in the presence of 1000-fold unlabeled progesterone. Luteal microsomal fractions were also preincubated at 96 C for 10 min (boiled) or at 37 C for 30 min in the presence of proteinase K (Prot K). B, Binding in the presence of increasing concentration of microsome or 80 µg of cytosol and 250 µM digitonin; C, binding in the presence of increasing concentrations of digitonin and 10 µg microsomal proteins; D, binding in the presence of 10 µg microsomal proteins and 250 µM digitonin for an increasing duration of incubation; E, representative saturation curve in the presence of increasing concentration of [3H]progesterone and 5 µg microsomal proteins. The Bmax and Kd values of [3H]progesterone binding were 290.5 ± 9 nmol/mg protein and 162 ± 20 nM, respectively. The inset shows Scatchard analysis of the same data.

 
A range of steroids was tested for their abilities to displace the binding of radiolabeled progesterone to rat luteal membranes (Fig. 3Go). Low levels of unlabeled progesterone (IC50 = 114 ± 15 nM) and 20{alpha}-dihydroprogesterone (20{alpha}-DH-Pg) (IC50 = 283 ± 45 nM) competed for binding of the tracer in a dose-dependent manner (Fig. 3Go), whereas much higher concentrations of 17{alpha}-OH-progesterone (IC50 = 1820 ± 145 nM), androstenedione (IC50 = 3687 ± 341 nM), or pregnenolone (IC50 = 9171 ± 465 nM) were required to reduce binding by 50%. 17ß-Estradiol, corticosterone, and the progesterone antagonist RU486 failed to inhibit binding even at micromolar concentrations (Fig. 3Go).



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. Specificity of rat luteal progestin-binding sites. Left, Binding of [3H]progesterone was measured in the absence or in the presence of increasing concentrations of unlabeled steroids. E2, 17ß-Estradiol; RU486, mifepristone; H, corticosterone; P5, pregnenolone; A2, androstenedione; Pg, progesterone. Each point represents the average ± SD. Right, Fitted curves of [3H]progesterone displacement obtained using Prism software (GraphPad).

 
Rat PMRs
Next, we sought to examine whether the presence of progesterone binding in luteal membranes correlates with the expression of proteins previously postulated to be membrane-bound progesterone receptors. As mentioned in the Introduction, rat Prmc1 and Rda288 cDNA have already been cloned (17, 18, 21); however, Pmr{alpha}, Pmrß, and Pmr{gamma} have not been identified in the rat. Using BLASTN, a rat coding sequence, accession number XM_233551, with a homology of 98% to the mouse Pmr{alpha} cDNA and a homology of 59% to the sea trout mPR cDNA was found. Two matches were found for Pmrß (accession numbers NM_001014099 and BC079247). The former is a predicted coding sequence; the latter is a full cDNA sequence obtained from rat testis (32). One match was found for Pmr{gamma}, accession number BC087040, a cDNA clone from a rat kidney library (32).

Expression of Pmr{alpha}, Pmrß, Pmr{gamma}, Prmc1, and Rda288 mRNA in different rat tissues
We determined whether predicted Pmr cDNA sequences are present in rat tissues using RT-PCR. This analysis showed a distinct distribution of all putative receptors.

Pmr{alpha}.
Pmr{alpha} mRNA was found in the adrenal gland, kidney, brain, lung, and ovary of an adult nonpregnant rat. We found the highest expression of Pmr{alpha} mRNA in CL of d-15 pregnant rats (Fig. 4AGo).



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 4. A, Relative RT-PCR analysis showing mRNA expression of Pmr{alpha}, Pmrß, Pmr{gamma}, Prmc1, Rda288, and Gapdh in several tissues of adult female rats. B, Binding of [3H]progesterone to the microsomal fraction of different tissues in the presence or absence of digitonin. Determinations were repeated three times. A representative set is shown. GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.

 
Pmrß.
The mRNA for Pmrß was found to be highly expressed in the brain, with lower expression levels in the ovary, kidney, lung, heart, and CL. No Pmrß expression was detected in the CL of d-22 pregnant rats. Identical results were observed by Northern blot analysis for Pmr{alpha} and Pmrß (data not shown).

Pmr{gamma}.
For Pmr{gamma}, PCR results indicate high levels of expression in kidney, but low expression was found in brain and CL of d-22 pregnant rats (Fig. 4AGo). No signal for Pmr{alpha}, Pmrß, or Pmr{gamma} was detected in muscle.

In addition to Pmr, we examined the expression of Prmc1 and Rda288 in different tissues.

Prmc1.
PRmc1 mRNA was found to be expressed in the adrenal gland, ovary, liver, and CL. No expression was observed in skeletal or heart muscles (Fig. 4BGo).

Rda288.
In contrast to the tissue-specific pattern of expression observed for Pmr{alpha}, Pmrß, Pmr{gamma}, and Prmc1, Rda288 transcript was expressed ubiquitously (Fig. 4BGo).

Because PMRs are expressed in a tissue-specific manner, we compared [3H]progesterone binding in 1) the CL, which expresses Pmr{alpha} and PRMC1, 2) the brain and kidney (Pmrß and Pmr{gamma}), and 3) muscle (only Rda288). In the presence of digitonin, highly specific [3H]progesterone binding was observed in luteal, kidney, and brain membranes but not in muscle membranes. [3H]Progesterone binding was significantly higher in the CL when compared with that of kidney and brain.

Cloning and analysis of the rat PMR{alpha}, PMRß, and PMR{gamma} coding sequence
To further characterize rat Pmr{alpha}, Pmrß, and Pmr{gamma}, we cloned the full coding sequence of these receptors from CL. The full cDNA sequences of rat Pmr{alpha}, Pmrß, and Pmr{gamma} was submitted to GenBank (accession nos. DQ027002, DQ088964, and DQ088965, respectively). A 49.2% homology between rat Pmr{alpha} and Pmrß cDNA was found in annealing studies, whereas a 33% homology and a 31% homology were found between the rat Pmr{alpha} and Pmr{gamma} and the rat Pmrß and Pmr{gamma}, respectively. The coding region of each Pmr gene was subjected to a BLAST homology search against the Rat Genome database of the National Center for Biotechnology Information. This analysis placed the sequence of Pmr{alpha} in chromosome 5q36, Pmrß in chromosome 9q13, and Pmr{gamma} in chromosome 8q24. Thus, the three Pmr are on separate chromosomes.

The rat Pmr{alpha}, Pmrß, and Pmr{gamma} mRNA were predicted to encode proteins with 345, 354, and 330 amino acids with molecular masses of 39.2, 40.5, and 38 kDa, respectively (Fig. 5AGo). The amino acid sequences of these proteins showed a 45% homology between rat PMR{alpha} and PMRß, whereas a 24% homology and a 26% homology were observed between PMR{alpha} and PMR{gamma} and PMRß and PMR{gamma}, respectively. Computational analyses (DAS-domain prediction, Topology, TMAP, TmPRED, PredTMR, HMMTOP, and SOSUI) and hydrophilicity studies of the deduced amino acid sequences indicated that rat PMR{alpha}, PMRß, and PMR{gamma} proteins are transmembrane proteins with several putative transmembrane domains (Fig. 5AGo). These analyses consistently predicted the presence of seven transmembrane domains in PMR{alpha}. The predicted transmembrane domains ranged from 5–8 for PMRß and PMR{gamma}. Although the overall homology between PMR{alpha} and PMRß was 45%, the homology of the transmembrane regions ranged from 48–74% (Fig. 5BGo). The same tendency was observed between the transmembrane domains of PMR{alpha} and PMR{gamma}.



View larger version (74K):
[in this window]
[in a new window]
 
FIG. 5. A, The deduced amino acid sequences of the rat PMR{alpha}, PMRß, and PMR{gamma} with identities between the three receptors indicated by black boxes. Amino acids are numbered on the right. Predicted transmembrane domains for PMR{alpha} are indicated by roman numerals. B, Hydrophilicity profile according to Kyte and Doolittle (57 ). A scheme of each PMR protein indicates predicted transmembrane domains. Numbers in transmembrane domains of PMRß and PMR{gamma} indicate percent sequence identity to the corresponding region of PMR{alpha}.

 
Developmental expression of Pmr{alpha}, Pmrß, Pmr{gamma}, and Prmc1 mRNA in the rat CL
Because transcripts of Pmr{alpha}, Pmrß, Pmr{gamma}, Prmc1, and Rda288 were found in the CL of pregnant rats, we examined the expression levels of these genes throughout pregnancy using Northern blot analysis (Fig. 6Go) and real-time quantitative PCR (Fig. 7Go).



View larger version (110K):
[in this window]
[in a new window]
 
FIG. 6. Northern blot analysis of rat Pmr{alpha}, Pmrß, and Prmc1 mRNA in the CL throughout pregnancy. Ten micrograms of total RNA were separated by electrophoresis in formaldehyde gels and blotted onto nylon membranes. Blots were probed with cDNA probes for PRmc1, Pmr{alpha}, and Pmrß. A photograph of the blot membrane after transfer showing S28 and S18 ribosomal RNA as control for loading and transfer is shown. A representative autoradiograph from three experiments is shown.

 


View larger version (49K):
[in this window]
[in a new window]
 
FIG. 7. Developmental relative expression of Pmr{alpha} (A) Pmrß (B), Pmr{gamma} (C), and Prmc (D) in the rat CL. Quantitative real-time PCR was used to determine copies per nanogram of total RNA of Pmr{alpha}, Pmrß, Pmr{gamma}, Prmc1, and ß-actin transcripts. The ratio between copies per nanogram of each receptor and that of ß-actin is shown. Each bar represents the average ± SEM of three animals. Bars with different letters are statistically different at a P < 0.05 (ANOVA-Tukey test). E, Relative expression of PMR{alpha}, PMRß, PMR{gamma}, and PRmc1 mRNA was plotted along with serum progesterone levels throughout pregnancy.

 
PMR{alpha}.
Northern blot analysis revealed the presence of two Pmr{alpha} transcripts of 5 and 1.7 kb. Northern blot (Fig. 6Go, top, upper band) and PCR data (Fig. 7AGo) demonstrated that luteal Pmr{alpha} mRNA content is low on d 4 of pregnancy but progressively increases from d 4–12. Maximal levels of Pmr{alpha} mRNA were found between d 12 and 20 of gestation. A significant (P < 0.01) decrease in Pmr{alpha} mRNA levels was observed between d 20 and 21 of gestation; mRNA levels remained low until d 22. The lower band (1.7 kb) detected by Northern blot showed a similar decrease toward the end of pregnancy, but its expression did not change between d 4 and 15.

PMRß.
Northern blot showed the presence of two transcripts of approximately 6 and 2 kb (Fig. 6Go). In contrast to Pmr{alpha}, Pmrß mRNA levels (Northern and PCR) were much lower and remained constant between d 4 and 20 of gestation. A 4-fold decrease in Pmrß expression was observed on d 21 (Fig. 7BGo).

PMR{gamma}.
Pmr{gamma} mRNA levels detected by RT-PCR were very low and increased progressively throughout pregnancy with no changes on d 21 (Fig. 7CGo). Northern blot analysis failed to detect Pmr{gamma} mRNA when 10 µg of total mRNA were used.

PRmc1.
Prmc1 expression increased from d 4–12 of pregnancy (Figs. 6Go and 7DGo), reaching its highest levels on d 12 and 15. Thereafter, a progressive decrease that reached statistical significance on d 20 was observed.

Rda288.
No changes in the expression levels of Rda288 mRNA were observed at any stage of pregnancy (data not shown). No changes in the expression of ß-actin or ribosomal proteins S28 and S18 were observed throughout pregnancy. A summary of the relative expression levels of Prm{alpha}, Pmrß, Pmr{gamma}, and Prmc1, along with serum progesterone levels throughout pregnancy, is displayed in Fig. 7EGo.

PMRß and PRMC1 protein levels in the rat CL
Next, we examined the expression of PMRß and PRMC1 in nuclear, microsomal, and cytosolic fractions obtained from corpora lutea of d-14 pregnant rats. PMRß and PRMC1 proteins were exclusively found in the microsomal fraction (Fig. 8AGo). As expected from the mRNA levels, developmental studies showed a significant decrease in the expression of PMRß protein on d 17 and 22 of pregnancy when compared with d 12 (Fig. 8BGo). Again, in good agreement with mRNA levels (Fig. 6Go), high levels of PRMC1 protein were found on d 12 and 17 of pregnancy, followed by a large decrease on d 22 (Fig. 8BGo). No changes in ß-actin protein levels were observed throughout pregnancy (Fig. 8BGo).



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 8. A, PMRß and PRMC1 protein levels in luteal subcellular fractions of d-14 pregnant rats. Fractions were separated by SDS-PAGE, transferred to nitrocellulose, and immunoblotted with anti-PMRß or anti-PRMC1 antiserum. B, Luteal PMRß, PRMC1, and ß-actin protein expression levels on d 12, 17, and 22 of pregnancy. Whole ovarian proteins were separated by SDS-PAGE, transferred to nitrocellulose, and immunoblotted with anti-PMRß, anti-PRMC1, or anti-ß-actin antiserum. Blots are representative of two different experiments.

 
Regulation of Pmr{alpha}, Pmrß, Pmr{gamma}, and Prmc1 mRNA expression by PRL
Thus far, the results presented indicate that significant changes in Pmr{alpha}, Pmrß, Pmr{gamma}, and Prmc1 expression take place throughout pregnancy. Because, in rats, the CL of gestation is directly under the control of PRL or PRL-like hormones (33), we determined whether PRL affects the expression of Pmr and Prmc1. Rats on d 5 of gestation were treated with ERGO, ERGO plus PRL, or vehicle. Animals were killed 24 h after PRL treatment. Luteal expression of all receptors was quantified using real-time PCR. The expression of {alpha}2-macroglobulin ({alpha}2MG) and 20{alpha}-HSD, two genes known to be regulated by PRL (34, 35), was also studied.

As shown in Fig. 9Go, Pmr{alpha}, Pmrß, and Prmc1 mRNA levels were significantly lower in ERGO-treated animals when compared with those of control animals. PRL treatment prevented the inhibitory effect of ERGO on the expression of Pmrß and Prmc1 but only partially blocked the inhibitory effect of ERGO on the expression of Pmr{alpha}. In contrast, a significant increase in the expression of PMR{gamma} was observed in ERGO-treated animals. PRL treatment attenuated the increase in PMR{gamma} induced by ERGO; however, because of the large variability, this effect was not statistically significant. As expected, ERGO treatment significantly inhibited the expression of {alpha}2MG and stimulated the expression of 20{alpha}-HSD, whereas cotreatment with PRL completely reversed these effects (Fig. 9Go).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 9. Regulation of Pmr{alpha}, Pmrß, Pmr{gamma}, and Prmc1 expression by PRL. Day-5 pregnant rats were treated with dimethylsulfoxide (control), ERGO, or ERGO plus PRL. Real-time PCR was used to determine the number of copies per nanogram of total RNA of Pmr{alpha}, Pmrß, Pmr{gamma}, Prmc1, and ß-actin transcripts 24 h after PRL treatment. The ratio between the number of copies per nanogram of each receptor and ß-actin is shown. 20{alpha}-HSD and {alpha}2MG expression is reported as a {Delta}ct value. Each bar represents the average ± SEM of three animals. Bars with different letters are statistically different at P < 0.05 (ANOVA-Tukey test).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our studies demonstrate that rat luteal membranes specifically bind progesterone and that the rat CL expresses proteins previously identified as putative membrane progesterone receptors. We showed that two of these proteins localize on luteal membranes and that their expression is regulated during pregnancy in a manner that coincides with the capacity of the CL to synthesize progesterone. It was also demonstrated herein that PRL, the major luteotrophic hormone in the rat, regulates the expression of these putative membrane progesterone receptors in the CL.

The presence of binding sites in particulate fractions of the CL have been described in several species, including pigs (36), cows (37), sheep (38), and humans (39). We have extended these observations to show that similar binding sites are present in the rat CL. Although the mechanism by which digitonin acts to uncover the binding of progesterone is not known, as shown in this and previous studies (40), its action is not mimicked by other detergents. Moreover, the binding uncovered by digitonin is saturable and specific for progesterone, increases linearly with protein concentration, and is denatured by proteases and high heat. In addition, digitonin does not increase binding when added to nuclear fractions but does stimulate [3H]progesterone binding in microsomal fractions, which we showed contain at least two progesterone-binding proteins. Digitonin-stimulated binding to luteal membranes cannot be displaced by P450scc or 3ß-HSD inhibitors (37), two membrane-bound enzymes, which suggests that the [3H]progesterone binding observed in this study is unlikely to be a result of binding of the tracer to steroidogenic enzymes.

The apparent dissociation constant of 162 nM derived from saturation experiments is well within the range of values reported for other membrane progesterone-binding sites, including those found in the bovine CL [197 nM (37)], the rat and porcine liver [170 nM (41) and 11–286 nM (16)], and the rat brain [160 nM (42)]. The dissociation constant of progesterone in rat luteal membranes is 40 times higher than the Kd reported for cytosolic progesterone receptors in the rat uterus [4 nM (43)]. Despite the relatively low affinity, it is probable that luteal membrane progesterone-binding sites are completely saturated because of the high concentration of progesterone present in the CL. The binding of progesterone to luteal membranes is specific, and the only steroid that can compete for binding of [3H]progesterone with an affinity close to that of progesterone is 20{alpha}-DH-Pg. The other steroids tested either competed poorly (17{alpha}-DH-Pg, androstenedione, and pregnenolone) or not at all (corticosterone, estradiol, and RU486). The binding of 20{alpha}-DH-Pg to CL membranes and the lack of binding of RU486 is strikingly different from the classical PR that does not bind 20{alpha}-DH-Pg (44) but avidly binds RU486 (45). After progesterone, 20{alpha}-DH-Pg is the second most abundant C21 steroid produced by the rat CL. It is synthesized only at the end of pregnancy, and its production, through metabolism of progesterone, is thought to be a mechanism for the initiation of parturition by eliminating the progestagenic activity of progesterone. Although 20{alpha}-DH-Pg binds to the CL membranes, it is possible that this steroid could act in this manner as an antagonist. However, this needs to be determined.

It has been previously shown that RU486 does not compete for binding of progesterone to other nongenomic sites, including human spermatozoa (46), human PMR{gamma} (25), and granulosa cells (22). Despite the failure of RU486 to compete for binding of [3H]progesterone to luteal membranes in this study, RU486 has been shown to act locally within the CL to regulate progesterone production (5, 47, 48). However, it is well known that RU486 is an antagonist of the glucocorticoid receptor. This protein is present in the CL (49, 50), and it is possible that RU486 is acting on the glucocorticoid receptor.

We cloned in the rat three PMRs homologous to the recently reported sea trout PMR. RT-PCR analysis showed a distinct tissue distribution of rat Pmr, with only a few tissues expressing significant amounts of more than one subtype. In the CL, we observed that the expression of Pmr mRNA and protein is regulated during pregnancy. Notably, developmental studies indicate that each PMR seems to be regulated independently. Whereas Pmrß remains almost constant throughout pregnancy, Pmr{alpha} and Pmr{gamma} expression increases with advancing gestation. In contrast, a different pattern was observed toward the end of pregnancy when a dramatic decrease in Pmr{alpha} and Pmrß expression takes place just before parturition, but PMR{gamma} mRNA levels remained constant. Quantification of mRNA levels demonstrated that Pmr{gamma} is expressed at very low levels, suggesting that it may not contribute physiologically to regulate luteal function. Developmental analysis also revealed that Pmr{alpha} and Prmc1 expression closely mimics serum progesterone concentration during pregnancy in the rat, suggesting that these genes have a central role in the regulation of luteal function. Obviously, a significant amount of work is necessary to determine the function of these progesterone-binding proteins in the rat CL.

Analyses of the rat PMR amino acid sequences indicate that these receptors are transmembrane proteins. We found that rat PRM{alpha} and PMRß share homology to a great degree, whereas much less homology exists between these receptors and PMR{gamma}. Similar findings have been reported for the human and mouse PMRs (25). Although expression of mouse and human PMRs in E. coli clearly indicates that they bind progesterone (25), a computational analysis of rat PMRs failed to predict possible steroid-binding domains. Additional studies on the structure and subcellular localization of these receptors are necessary to understand their mechanism of action, binding characteristics, and activation.

We also report for the first time the expression and regulation of PRMC1 (protein and mRNA) in the rat CL during pregnancy. Prmc1 cDNA was isolated and cloned from pig liver membranes (15, 16); an antibody against rat PRMC1 was produced much earlier in an effort to identify molecules specifically expressed in different zones of the rat adrenal gland (30). It was found that the antigen for this antibody is expressed exclusively in the adrenal inner zone; correspondingly, it was named the inner zone antigen (IZA). Later, IZA was identified as PRMC1 (31). The tissue distribution of Prmc1 mRNA agrees with the distribution of PRMC1 (IZA) protein previously reported (51). Thus, Prmc1 was found to be expressed at high levels in the adrenal gland, liver, and ovary of adult rats. Interestingly, we found the highest expression of Prmc1 in the CL of pregnant rats. Using immunohistochemical analysis, PRMC1 was found in the CL and the theca interna of preovulatory follicles but not in granulosa cells, the oocyte, theca externa, or in early stages of follicle development (51). These findings suggest that PRMC1 becomes expressed in granulosa cells after ovulation and remains highly expressed in the CL. We are currently investigating whether the expression of this protein is induced by LH. In the adrenal gland, PRMC1 is induced by cAMP (52), suggesting that in the ovary, PRMC1 could also respond to the LH/cAMP system. We have demonstrated that Prmc1 mRNA expression is regulated by PRL in the rat CL (see below), which suggests that multiple mechanisms may be involved in the regulation of this gene.

We found that the rat CL also expresses the mRNA for a protein named RDA288. This protein was proposed as a membrane-bound progesterone receptor (22) and to mediate the antiapoptotic effects of progesterone in granulosa cells (23). In our studies of the rat CL, [3H]progesterone binding was seen solely in membrane fractions. RDA288, however, does not contain transmembrane domains (23). Moreover, we found that Rda288 expression is not affected by the progress of the gestation and is expressed in all tissues examined, including those that do not bind progesterone. Consequently, it does not appear likely to us that RDA288 is an important mediator of progesterone action in the CL. It is possible that RDA288 may regulate luteal function in a progesterone-dependent manner through an association with a membrane-bound protein.

A key finding presented in this report is the regulation of Pmr and Prmc1 mRNA expression by PRL. In rodents, the CL of pregnancy is highly dependent upon the action of PRL and PRL-like hormones to maintain CL’s structure and to produce progesterone needed for the maintenance of gestation. Accordingly, the main cause of infertility in PRL receptor knockout mice is a defect in CL formation and the absence of progesterone support for implantation and placental development (53). It is known that the inhibition of PRL secretion in vivo by ERGO treatment causes demise of the CL and abortion (27). We showed that ERGO causes a significant inhibition of Pmr{alpha}, Pmrß, and Prmc1 mRNA expression in the CL, and an increase in the expression of Pmr{gamma} was observed. The effects of ERGO were prevented by cotreatment with PRL. These results suggest that PRL is involved in the regulation of the expression of these receptors and that the PMRs and PRMC1 expression correlates with CL function. It is noteworthy that a decrease in PRL levels throughout ERGO treatment causes changes in the expression of Pmr and Prmc1 mRNA similar to those observed at the end of pregnancy. It is known that a decrease in the expression of PRL receptors takes place before parturition (54), which is induced by the luteolytic factor prostaglandin F2{alpha} (55). It is likely that the decrease in Pmr and Prmc1 expression observed on d 21 of pregnancy may be related to the decrease in PRL receptor expression throughout the luteolytic effect of prostaglandin F2{alpha}.

The intracellular signaling and specific functions of PMR{alpha}, PMRß, PMR{gamma}, and PRMC1 in luteal cells remain to be investigated. Because rat luteal cells do not express nuclear progesterone receptors, these cells are an ideal model for studying the effect of progesterone mediated by nonclassical receptors. In mouse knockout models of the classical progesterone receptors, despite the lack of ovulation, luteinization is normal (56), suggesting the classical progesterone receptor affects neither CL formation nor its function. This further implies an important role for nonclassical progesterone receptors in the maintenance of luteal function in rodents. In summary, our results represent the first report on the expression and regulation of putative membrane progesterone receptors in the rat CL.


    Acknowledgments
 
We thank Dr. Vinson for providing us with the IZA antibody and Drs. Harold Behrman and Richard Hochberg for their critical review of the manuscript.


    Footnotes
 
1 Following the guidelines of The Mouse Genome Database (http://www.informatics.jax.org), we propose the following names and symbols for the mammalian membrane-bound progesterone receptors homologous to the sea trout mPR proteins (progestin membrane receptor): Pmr for gene and mRNA transcripts and PMR for the protein. Back

This work was supported by a Startup fund from the Department of Obstetrics Gynecology, and Reproductive Science, Yale School of Medicine.

First Published Online August 25, 2005

Abbreviations: CL, Corpus luteum; Ct, cycle threshold; 20{alpha}-DH-Pg, 20{alpha}-dihydroprogesterone; ERGO, ergocriptine; 20{alpha}-HSD, 20{alpha}-hydroxysteroid dehydrogenase; IZA, inner zone antigen; {alpha}2MG, {alpha}2-macroglobulin; PMR, progestin membrane receptor; PR, progesterone receptor; PRL, prolactin; PRMC1, progesterone membrane component 1.

Received June 22, 2005.

Accepted for publication August 19, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Svensson EC, Markstrom E, Andersson M, Billig H 2000 Progesterone receptor-mediated inhibition of apoptosis in granulosa cells isolated from rats treated with human chorionic gonadotropin. Biol Reprod 63:1457–1464[Abstract/Free Full Text]
  2. Conneely OM, Mulac-Jericevic B, DeMayo F, Lydon JP, O’Malley BW 2002 Reproductive functions of progesterone receptors. Recent Prog Horm Res 57:339–355[Abstract/Free Full Text]
  3. Stouffer RL 2003 Progesterone as a mediator of gonadotrophin action in the corpus luteum: beyond steroidogenesis. Hum Reprod Update 9:99–117[Abstract/Free Full Text]
  4. Rueda BR, Hendry IR, Hendry IW, Stormshak F, Slayden OD, Davis JS 2000 Decreased progesterone levels and progesterone receptor antagonists promote apoptotic cell death in bovine luteal cells. Biol Reprod 62:269–276[Abstract/Free Full Text]
  5. Arakawa S, Kambegawa A, Okinaga S, Arai K 1990 Luteolytic effect of the antiprogestin and antiglucocorticoid agent RU486 in rats. J Steroid Biochem 36:479–483[CrossRef][Medline]
  6. Telleria CM, Stocco CO, Stati AO, Deis RP 1999 Progesterone receptor is not required for progesterone action in the rat corpus luteum of pregnancy. Steroids 64:760–766[CrossRef][Medline]
  7. Stocco CO, Deis RP 1998 Participation of intraluteal progesterone and prostaglandin F2{alpha} in LH-induced luteolysis in pregnant rat. J Endocrinol 156:253–259[Abstract]
  8. Kuranaga E, Kanuka H, Hirabayashi K, Suzuki M, Nishihara M, Takahashi M 2000 Progesterone is a cell death suppressor that downregulates Fas expression in rat corpus luteum. FEBS Lett 466:279–282[CrossRef][Medline]
  9. Goyeneche AA, Deis RP, Gibori G, Telleria CM 2003 Progesterone promotes survival of the rat corpus luteum in the absence of cognate receptors. Biol Reprod 68:151–158[Abstract/Free Full Text]
  10. Park-Sarge OK, Parmer TG, Gu Y, Gibori G 1995 Does the rat corpus luteum express the progesterone receptor gene? Endocrinology 136:1537–1543[Abstract]
  11. Grazzini E, Guillon G, Mouillac B, Zingg HH 1998 Inhibition of oxytocin receptor function by direct binding of progesterone. Nature 392:509–512[CrossRef][Medline]
  12. Maller JL 2003 Signal transduction: fishing at the cell surface. Science 300:594–595[Abstract/Free Full Text]
  13. Thomas P, Zhu Y, Pace M 2002 Progestin membrane receptors involved in the meiotic maturation of teleost oocytes: a review with some new findings. Steroids 67:511–517[CrossRef][Medline]
  14. Luconi M, Francavilla F, Porazzi I, Macerola B, Forti G, Baldi E 2004 Human spermatozoa as a model for studying membrane receptors mediating rapid nongenomic effects of progesterone and estrogens. Steroids 69:553–559[CrossRef][Medline]
  15. Falkenstein E, Meyer C, Eisen C, Scriba PC, Wehling M 1996 Full-length cDNA sequence of a progesterone membrane-binding protein from porcine vascular smooth muscle cells. Biochem Biophys Res Commun 229:86–89[CrossRef][Medline]
  16. Meyer C, Schmid R, Scriba PC, Wehling M 1996 Purification and partial sequencing of high-affinity progesterone-binding site(s) from porcine liver membranes. Eur J Biochem 239:726–731[Medline]
  17. Selmin O, Lucier GW, Clark GC, Tritscher AM, Vanden Heuvel JP, Gastel JA, Walker NJ, Sutter TR, Bell DA 1996 Isolation and characterization of a novel gene induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin in rat liver. Carcinogenesis 17:2609–2615[Abstract/Free Full Text]
  18. Krebs CJ, Jarvis ED, Chan J, Lydon JP, Ogawa S, Pfaff DW 2000 A membrane-associated progesterone-binding protein, 25-Dx, is regulated by progesterone in brain regions involved in female reproductive behaviors. Proc Natl Acad Sci USA 97:12816–12821[Abstract/Free Full Text]
  19. Gerdes D, Wehling M, Leube B, Falkenstein E 1998 Cloning and tissue expression of two putative steroid membrane receptors. Biol Chem 379:907–911[Medline]
  20. Falkenstein E, Heck M, Gerdes D, Grube D, Christ M, Weigel M, Buddhikot M, Meizel S, Wehling M 1999 Specific progesterone binding to a membrane protein and related nongenomic effects on Ca2+-fluxes in sperm. Endocrinology 140:5999–6002[Abstract/Free Full Text]
  21. Peluso JJ, Pappalardo A 1998 Progesterone mediates its anti-mitogenic and anti-apoptotic actions in rat granulosa cells through a progesterone-binding protein with {gamma}-aminobutyric acid receptor-like features. Biol Reprod 58:1131–1137[Abstract/Free Full Text]
  22. Peluso JJ, Fernandez G, Pappalardo A, White BA 2001 Characterization of a putative membrane receptor for progesterone in rat granulosa cells. Biol Reprod 65:94–101[Abstract/Free Full Text]
  23. Peluso JJ, Pappalardo A, Fernandez G, Wu CA 2004 Involvement of an unnamed protein, RDA288, in the mechanism through which progesterone mediates its antiapoptotic action in spontaneously immortalized granulosa cells. Endocrinology 145:3014–3022[Abstract/Free Full Text]
  24. Zhu Y, Rice CD, Pang Y, Pace M, Thomas P 2003 Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci USA 100:2231–2236[Abstract/Free Full Text]
  25. Zhu Y, Bond J, Thomas P 2003 Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci USA 100:2237–2242[Abstract/Free Full Text]
  26. Fernandes MS, Pierron V, Michalovich D, Astle S, Thornton S, Peltoketo H, Lam E, Gellersen B, Huhtaniemi L, Allen J, Brosens JJ Expression and regulation of the membrane progestin receptor homologues in human endometrium and pregnancy tissues. Program of the 87th Annual Meeting of The Endocrine Society, San Diego, CA, 2005, p 416 (Abstract P2-249)
  27. Morishige WK, Rothchild I 1974 Temporal aspects of the regulation of corpus luteum function by luteinizing hormone, prolactin, and placental luteotrophin during the first half of pregnancy in the rat. Endocrinology 95:260–274[Medline]
  28. Mitaku S, Hirokawa T, Tsuji T 2002 Amphiphilicity index of polar amino acids as an aid in the characterization of amino acid preference at membrane-water interfaces. Bioinformatics 18:608–616[Abstract/Free Full Text]
  29. Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45
  30. Laird SM, Vinson GP, Whitehouse BJ 1988 Monoclonal antibodies against rat adrenocortical cell antigens. Acta Endocrinol (Copenh) 119:420–426[Medline]
  31. Raza FS, Takemori H, Tojo H, Okamoto M, Vinson GP 2001 Identification of the rat adrenal zona fasciculata/reticularis specific protein, inner zone antigen (IZAg), as the putative membrane progesterone receptor. Eur J Biochem 268:2141–2147[Medline]
  32. Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T, Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin GM, Hong L, et al. 2002 Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA 99:16899–16903[Abstract/Free Full Text]
  33. Gibori G 1993 The corpus luteum of pregnancy. In: Adashi EY, Leung PCK, eds. The ovary. New York: Raven Press; 261–317
  34. Gaddy-Kurten D, Richards JS 1991 Regulation of {alpha}2-macroglobulin by luteinizing hormone and prolactin during cell differentiation in the rat ovary. Mol Endocrinol 5:1280–1291[Abstract]
  35. Zhong L, Parmer TG, Robertson MC, Gibori G 1997 Prolactin-mediated inhibition of 20{alpha}-hydroxysteroid dehydrogenase gene expression and the tyrosine kinase system. Biochem Biophys Res Commun 235:587–592[CrossRef][Medline]
  36. Menzies GS, Bramley TA 1994 Specific binding sites for progesterone in subcellular fractions of the porcine corpus luteum. J Endocrinol 142:101–110[Abstract]
  37. Rae MT, Menzies GS, McNeilly AS, Woad K, Webb R, Bramley TA 1998 Specific non-genomic, membrane-localized binding sites for progesterone in the bovine corpus luteum. Biol Reprod 58:1394–1406[Abstract/Free Full Text]
  38. Bramley TA, Menzies GS 1994 Particulate binding sites for steroid hormones in subcellular fractions of the ovine corpus luteum: properties and hormone specificity. Mol Cell Endocrinol 103:39–48[CrossRef][Medline]
  39. Bramely TA, Menzies GS 1988 Association of progesterone with a unique particulate fraction of the human corpus luteum. J Endocrinol 116:307–312[Abstract]
  40. Menzies GS, Howland K, Rae MT, Bramley TA 1999 Stimulation of specific binding of [3H]-progesterone to bovine luteal cell-surface membranes: specificity of digitonin. Mol Cell Endocrinol 153:57–69[CrossRef][Medline]
  41. Haukkamaa M 1976 Progesterone-binding properties of microsomes from rat liver. J Steroid Biochem 7:345–350[CrossRef][Medline]
  42. Tischkau SA, Ramirez VD 1993 A specific membrane binding protein for progesterone in rat brain: sex differences and induction by estrogen. Proc Natl Acad Sci USA 90:1285–1289[Abstract/Free Full Text]
  43. Walters MR, Clark JH 1977 Cytosol progesterone receptors of the rat uterus: assay and receptor characteristics. J Steroid Biochem 8:1137–1144[CrossRef][Medline]
  44. Ogle TF, Beyer BK 1982 Steroid-binding specificity of the progesterone receptor from rat placenta. J Steroid Biochem 16:147–150[CrossRef][Medline]
  45. Schreiber JR, Hsueh AJ, Baulieu EE 1983 Binding of the anti-progestin RU-486 to rat ovary steroid receptors. Contraception 28:77–85[CrossRef][Medline]
  46. Ambhaikar M, Puri C 1998 Cell surface binding sites for progesterone on human spermatozoa. Mol Hum Reprod 4:413–421[Abstract/Free Full Text]
  47. Yamabe S, Katayama K, Mochizuki M 1989 [The effect of RU486 and progesterone on luteal function during pregnancy]. Nippon Naibunpi Gakkai Zasshi 65:497–511 (Japanese)[Medline]
  48. Telleria CM, Deis RP 1994 Effect of RU486 on ovarian progesterone production at pro-oestrus and during pregnancy: a possible dual regulation of the biosynthesis of progesterone. J Reprod Fertil 102:379–384
  49. Towns R, Menon KM, Brabec RK, Silverstein AM, Cohen JM, Bowen JM, Keyes PL 1999 Glucocorticoids stimulate the accumulation of lipids in the rat corpus luteum. Biol Reprod 61:416–421[Abstract/Free Full Text]
  50. Sugino N, Telleria CM, Gibori G 1997 Progesterone inhibits 20{alpha}-hydroxysteroid dehydrogenase expression in the rat corpus luteum through the glucocorticoid receptor. Endocrinology 138:4497–4500[Abstract/Free Full Text]
  51. Ho MM, Barker S, Vinson GP 1994 Distribution of the adrenocortical inner zone antigen. J Endocrinol 141:459–466[Abstract]
  52. Barker S, Laird SM, Ho MM, Vinson GP, Hinson JP 1992 Characterization of a rat adrenocortical inner zone-specific antigen and identification of its putative precursor. J Mol Endocrinol 9:95–102[Abstract]
  53. Binart N, Helloco C, Ormandy CJ, Barra J, Clement-Lacroix P, Baran N, Kelly PA 2000 Rescue of preimplantatory egg development and embryo implantation in prolactin receptor-deficient mice after progesterone admini