| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Else Kröner-Fresenius Centre for Nutritional Medicine (T.S., H.H.), Technical University Munich, D-85350 Weihenstephan; and German Diabetes Center (C.H., I.K., S.M.-S., H.K.), Leibniz Institute at the Heinrich-Heine-University Düsseldorf, D-40225 Düsseldorf, Germany
Address all correspondence and requests for reprints to: Thomas Skurk, M.D., Technical University Munich, Else Kröner-Fresenius Centre for Nutritional Medicine, Hochfeldweg 1, D-85350 Freising/Weihenstephan. E-mail: skurk{at}wzw.tum.de.
| Abstract |
|---|
|
|
|---|
, or IL-4. The rates of MIF release from sc and omental adipocytes were similar but approximately 10 times higher compared with mammary adipocytes. Conclusions: Human preadipocytes and mature adipocytes from different depots spontaneously release substantial amounts of MIF. Expression levels were positively associated with donor body mass index. Hence, MIF may be an obesity-dependent mediator of macrophage infiltration of adipose tissue. | Introduction |
|---|
|
|
|---|
and that elevated serum levels of these proteins are reduced after weight loss (3, 4, 5, 6, 7). Because it has been hypothesized that low-grade chronic inflammation may be etiologically related to the development of atherosclerosis and type 2 diabetes, obesity and adipose tissue-derived inflammatory mediators may play a crucial role in the pathogenesis of these diseases. In vitro studies established that both adipocytes and stromal cells of adipose tissue express and secrete cytokines and chemokines such as IL-6 and TNF-
(8, 9, 10, 11, 12).
MIF is a pleiotropic cytokine that participates in the immune and stress response. It is a key mediator for the septic shock syndrome and also exerts proinflammatory activities (13). MIF was found to prolong the lifespan of macrophages by protecting them from apoptosis, thus maintaining inflammatory processes. Additional proinflammatory activity is generated by counteracting glucocorticoid-induced suppression of the immune system (14, 15) and by up-regulating TNF-
expression in peripheral immune cells (16).
MIF is expressed in both immune and nonimmune cells including various peripheral tissues (17, 18, 19, 20). Recently, MIF was also identified as a product of mouse 3T3-L1 adipocytes (21, 22). In addition, MIF serum levels are elevated in patients with type 2 diabetes (23), and MIF expression is regulated by insulin and may be associated with insulin resistance (24, 25, 26). Recently, obese adipose tissue has been reported to exhibit severe macrophage infiltration (27, 28). Therefore, MIF may serve as a link between obesity and insulin resistance and may promote the development of type 2 diabetes.
The aim of this study, therefore, was to test the hypothesis that MIF is secreted by human adipose tissue and to investigate which factors regulate its expression.
| Materials and Methods |
|---|
|
|
|---|
Cell culture
Adipose tissue samples were prepared as described previously (29). Briefly, connective tissue and visible blood vessels were removed with scissors, and fat lobules were cut into small pieces. The minced tissue was then digested in PBS (10 mmol/liter) containing 250 U/ml collagenase (Biochrom, Berlin, Germany) and 2% BSA (Sigma, Munich, Germany) for 90 min at 37 C in a shaking water bath. Stromal cells were collected by a 10-min centrifugation at 200 x g. The supernatants with the adipocytes were discarded. The sedimented cells were incubated in an erythrocyte lyzing buffer (154 mmol/liter NH4Cl, 5.7 mmol/liter K2HPO4, and 0.1 mmol/liter EDTA) for 10 min to remove red blood cells. Then, cells were filtered through a nylon mesh with a pore size of 150 µm to separate undigested material. To obtain a pure stromal cell fraction the cell suspension was filtered again through a cell strainer with a pore size of 70 µm. Finally, cells were resuspended in DMEM/Hams F-12 medium (vol/vol, 1:1) supplemented with 10% fetal bovine serum (Biochrom, Berlin, Germany) and seeded into 12-well culture plates (Biochrom) at a density of approximately 3 x 104/cm2. The serum-containing medium was replaced after 16 h by serum-free DMEM/F-12 medium supplemented with 10 mg/ml human transferrin (Sigma), 66 nmol/liter human insulin (Sigma), 100 nmol/liter cortisol (Aventis Pharma, Frankfurt, Germany), 0.2 nmol/liter T3 (Sigma) and 0.05 g/liter gentamycin (Invitrogen Life Technologies, Gaithersburg, MD). To induce adipose differentiation, cells were exposed to 1 µg/ml troglitazone (Sankyo Europe, Düsseldorf, Germany) and 0.5 mM isobutyl-methylxanthine (Serva, Heidelberg, Germany) for the first 4 d. Medium was changed every other day. On d 16, approximately 5070% of the cells had acquired an adipocyte phenotype detectable by multiple cytoplasmatic lipid inclusions. Such cultures were incubated for 24 h with either 1 µg/ml lipopolysaccharide (Sigma) or 1 ng/ml interferon (IFN)-
or 50 ng/ml IL-4 (R&D Systems, Minneapolis, MN), respectively.
Suspension culture of human adipocytes
In parallel experiments, mature adipocytes were isolated. In contrast to the before mentioned protocol a shorter collagenase digestion of only 60 min in Krebs-Ringer buffer (pH 7.4) containing 4% BSA was performed. Cells were carefully centrifuged and washed twice with Krebs-Ringer buffer, supplemented with 0.1% BSA. After a filtration step through a 250-µm nylon mesh (VWR International, Darmstadt, Germany) cells were allowed to recover from preparation for 24 h in DMEM/F12 supplemented with 2% BSA. After this period, 400 µl packed adipocytes in 4 ml DMEM/F12 + 0,25% BSA were incubated for 24 h either with IFN-
(0.1 ng/ml) or IL-4 (5 ng/ml). Cells and the buffer medium were separately stored at 20 C for later analyses.
Real-time RT-PCR
All PCR reagents were purchased either from Applied Biosystems (ABI, Foster City, CA) and used according to the instructions of the manufacturer. Total RNA from 0.5 x 106 cells were isolated with the NucleoSpin RNA II kit from Machery-Nagel (Düren, Germany) and transcribed with the iSpricpt Synthesis kit (Bio-Rad, München, Germany). Quantitative PCR was performed in 20-µl reactions using an amount of 7.5 ng mRNA equivalent. 18S RNA was used to normalize for the starting amount of cDNA. Amplification was performed with the ABI 7000 sequence detection system using the following protocol: amplification was performed during 40 cycles (PCR initial activation step: 15 min, 95 C; denaturation: 30 sec, 95 C; annealing: 30 sec, 55 C; extension: 45 sec, 72 C).
FAM (6-carboxylfluorescein)-labeled probes were used in the Assay on Demand platform from ABI. The following reference sequences were provided by the company: AGCCCGGACAGGGTCTACATCAACT for MIF (accession no: NM_002415) (catalog no. Hs00236988_g1) and TGGAGGGCAAGTCTGGTGCCAGCAG for 18S RNA (accession no. x03205) (catalog no. Hs99999901_s1).
Measurement of MIF protein
Concentrations of MIF protein in cell culture supernatants were measured by using a highly sensitive sandwich ELISA (R&D Systems, Wiesbaden, Germany) with a detection limit of 20 pg/ml. All supernatants were analyzed in duplicates. Mean intra- and interassay variations were less than 5% and 20%, respectively.
Immunohistochemistry
For immunohistochemical detection a monoclonal mouse antihuman MIF antibody (R&D Systems, Minneapolis, MN) was used. Positive signals were detected using the horseradish peroxidase-diaminobenzidine system (R&D Systems) according to the instructions of the manufacturer. Stromal cells isolated from adipose tissue were cultured under the conditions mentioned before. For immunohistochemistry, cells were washed with PBS and fixed with pure methanol for 2 h at 20 C. For isotype control, cells were treated in the same manner and incubated with a monoclonal IgG1 antibody (R&D Systems).
Measurement of glycerol-3-phosphate dehydrogenase (GPDH) activity
GPDH activity was determined as a marker of adipose differentiation according to an established procedure (30). Briefly, cells were washed twice in PBS and harvested in a Tris-buffer (0.05 mol/liter Tris/HCl, 1 mmol/liter EDTA, 1 mmol/liter mercaptoethanol, pH at 7.4). After sonification of cells for complete cell lysis and centrifugation GPDH activity was assessed spectrophotometrically by addition of reduced nicotinamide adenine dinucleotide and dihydroxyacetone phosphate (Sigma). Specific activity was calculated and expressed as milliunits per milligrams of protein. For protein determination an established method including protein precipitation with trichloroacetic acid was used (31).
Statistical analysis
Results were expressed as mean ± SD of at least three experiments in triplicate. For comparisons ANOVA was used. P < 0.05 was considered to be statistically significant. Possible associations between BMI and sc and omental MIF expression was described by Spearmans rank correlation test.
| Results |
|---|
|
|
|---|
|
Additional experiments were performed to assess the expression of MIF mRNA in fat cells differentiating in vitro. During the differentiation process (between d 4 and 24), we detected substantial MIF mRNA expression in both undifferentiated and differentiated cells (Fig. 1C
). 18S RNA was used for normalization.
MIF release from freshly isolated human adipocytes
In addition, MIF release from freshly isolated adipocytes from different fat depots was assessed. As shown in Fig. 2
, mature fat cells secreted substantial amounts of MIF over a 24-h incubation period. Interestingly, sc abdominal adipocytes exhibited a much greater potency of MIF release compared with mammary fat cells (Fig. 2
). On a per cell basis, freshly isolated fat cells from the abdominal region produced approximately 10 times more MIF than in vitro differentiated preadipocytes (data not shown).
|
|
|
, IL-4, and insulin on MIF release
and IL-4. As demonstrated in Fig. 5
, an inducer of a Th-1 response, or of 50 ng/ml IL-4, a stimulator of a Th-2 response. This was true for in vitro differentiated adipocytes from the sc, the omental, and the mammary adipose tissue depot. Similar data were obtained when freshly isolated mature adipocytes were exposed to these stimuli for 24 h (data not shown).
|
| Discussion |
|---|
|
|
|---|
Freshly isolated mature adipocytes also spontaneously secreted substantial amounts of MIF during a 24-h culture period. Interestingly, comparative experiments also demonstrated that sc and omental adipocytes from the same donors exhibit a similar extent of MIF secretion into the culture medium, whereas mammary fat cells produced MIF at approximately 10-fold lower levels. Although donors of mammary adipose tissue and sc or omental adipose tissue differed in their BMI, it is unlikely that the 10-fold difference in MIF secretion could solely be explained by this fact. Regional differences in adipokine production and secretion could be of high clinical importance because the pattern of body fat distribution is known to be a powerful determinant of the clinical consequences of obesity (32, 33). However, one has to keep in mind that sc abdominal adipose tissue represents by far the biggest depot. Our data significantly extend the findings of previous studies reporting MIF release from mouse 3T3-L1 adipocytes (21, 22) by investigating both human preadipocytes and mature adipocytes. Furthermore, we also analyzed the effects of fat depot and donor BMI on MIF secretion, which have not been investigated before.
Another novel and important finding of this study is that MIF secretion from both sc and omental adipocytes was closely correlated with the BMI of the individual donor. This could be of particular significance in view of the recently demonstrated association of obesity with macrophage infiltration in adipose tissue (27, 28). Therefore, MIF may qualify as a candidate adipocyte product contributing to macrophage infiltration of fat tissue in obesity. Monocyte chemoattractant protein-1 (MCP-1) is another mediator that has been discussed in the context of macrophage infiltration in obesity (27, 28). Interestingly, MIF has been reported to counteract MCP-1-mediated chemotaxis of human peripheral blood monocytes (34). Because adipocytes cosecrete MIF and MCP-1 (our unpublished data), MIF is a potential candidate that may contribute to macrophage accumulation in obese fat tissue. This aspect merits further attention.
Another interesting finding of our study was the lack of responsiveness of mature adipocytes from sc, omental, and mammary to LPS, IFN-
, or IL-4. Although sufficiently high concentrations of these immunostimulatory compounds were used in the culture models that potently induced or modulated cytokine secretion in monocytes/macrophages, dendritic cells and endothelial cells (35, 36) (and unpublished data), the release of MIF into the culture medium remained unaffected. This observation is important from a technical point of view because it confirms the absence of monocytes/macrophages in our culture system. The latter cells are well known to secrete increased amounts of MIF upon stimulation with LPS or IFN-
(37, 38, 39). In addition, these data also suggest that the immunological properties of adipocytes may be different from those of innate immune cells with respect to the regulation of MIF expression. To date, little is known about the functional role of MIF in metabolic disorders such as type 2 diabetes and in atherosclerosis. As recent findings in murine cells suggest, insulin seems to be a potential regulator of MIF expression and secretion (24). In contrast to these findings insulin didnt seem to have an intrinsic effect on neither mRNA nor protein level in the human model arguing for the constitutive character of MIF secretion from fat cells. However, recent studies indicated that MIF serum concentrations are elevated in subjects with type 2 diabetes mellitus (23) or insulin resistance (26). Whether MIF is directly involved in the pathophysiological processes leading to insulin resistance and atherosclerosis or simply an innocent bystander remains to be determined.
Taken together, our experiments show that adipocytes spontaneously express and secrete MIF protein. Differences in the amounts of MIF secretion were observed between adipocytes from different fat depots. An intriguing observation was that constitutive MIF secretion from adipocytes increased with increasing BMI of the donor. From this observation and the known physiological function of MIF, it is tempting to speculate that this cytokine contributes to macrophage infiltration into adipose tissue in obesity.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online December 2, 2004
1 T.S. and C.H. contributed equally to this work. ![]()
Abbreviations: BMI, Body mass index; CRP, C-reactive protein; GPDH, glycerol-3-phosphate dehydrogenase; IFN, interferon; LPS, lipopolysaccharide; MCP-1, monocyte chemoattractant protein-1; MIF, macrophage migration inhibitory factor.
Received July 16, 2004.
Accepted for publication November 23, 2004.
| References |
|---|
|
|
|---|
. Biochem Biophys Res Commun 235:9498[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. Kos, S. Wong, B. Tan, A. Gummesson, M. Jernas, N. Franck, D. Kerrigan, F. H. Nystrom, L. M.S. Carlsson, H. S. Randeva, et al. Regulation of the Fibrosis and Angiogenesis Promoter SPARC/Osteonectin in Human Adipose Tissue by Weight Change, Leptin, Insulin, and Glucose Diabetes, August 1, 2009; 58(8): 1780 - 1788. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ortega Martinez de Victoria, X. Xu, J. Koska, A. M. Francisco, M. Scalise, A. W. Ferrante Jr., and J. Krakoff Macrophage Content in Subcutaneous Adipose Tissue: Associations With Adiposity, Age, Inflammatory Markers, and Whole-Body Insulin Action in Healthy Pima Indians Diabetes, February 1, 2009; 58(2): 385 - 393. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Herder, S. Schneitler, W. Rathmann, B. Haastert, H. Schneitler, H. Winkler, R. Bredahl, E. Hahnloser, and S. Martin Low-Grade Inflammation, Obesity, and Insulin Resistance in Adolescents J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4569 - 4574. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ye, Z. Gao, J. Yin, and Q. He Hypoxia is a potential risk factor for chronic inflammation and adiponectin reduction in adipose tissue of ob/ob and dietary obese mice Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E1118 - E1128. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Kim, K. Tillison, S. Zhou, Y. Wu, and C. M. Smas The major facilitator superfamily member Slc37a2 is a novel macrophage- specific gene selectively expressed in obese white adipose tissue Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E110 - E120. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Skurk, C. Alberti-Huber, C. Herder, and H. Hauner Relationship between Adipocyte Size and Adipokine Expression and Secretion J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1023 - 1033. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. N. Lumeng, S. M. DeYoung, J. L. Bodzin, and A. R. Saltiel Increased Inflammatory Properties of Adipose Tissue Macrophages Recruited During Diet-Induced Obesity Diabetes, January 1, 2007; 56(1): 16 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. N. Lumeng, S. M. Deyoung, and A. R. Saltiel Macrophages block insulin action in adipocytes by altering expression of signaling and glucose transport proteins Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E166 - E174. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chung, K. LaPoint, K. Martinez, A. Kennedy, M. Boysen Sandberg, and M. K. McIntosh Preadipocytes Mediate Lipopolysaccharide-Induced Inflammation and Insulin Resistance in Primary Cultures of Newly Differentiated Human Adipocytes Endocrinology, November 1, 2006; 147(11): 5340 - 5351. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schaffler, U. Muller-Ladner, J. Scholmerich, and C. Buchler Role of Adipose Tissue as an Inflammatory Organ in Human Diseases Endocr. Rev., August 1, 2006; 27(5): 449 - 467. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Herder, H. Kolb, W. Koenig, B. Haastert, S. Muller-Scholze, W. Rathmann, R. Holle, B. Thorand, and H.-E. Wichmann Association of Systemic Concentrations of Macrophage Migration Inhibitory Factor With Impaired Glucose Tolerance and Type 2 Diabetes: Results from the Cooperative Health Research in the Region of Augsburg, Survey 4 (KORA S4) Diabetes Care, February 1, 2006; 29(2): 368 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cinti, G. Mitchell, G. Barbatelli, I. Murano, E. Ceresi, E. Faloia, S. Wang, M. Fortier, A. S. Greenberg, and M. S. Obin Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans J. Lipid Res., November 1, 2005; 46(11): 2347 - 2355. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Trayhurn Adipose Tissue in Obesity--An Inflammatory Issue Endocrinology, March 1, 2005; 146(3): 1003 - 1005. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |