help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2004-0924
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Skurk, T.
Right arrow Articles by Kolb, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Skurk, T.
Right arrow Articles by Kolb, H.
Endocrinology Vol. 146, No. 3 1006-1011
Copyright © 2005 by The Endocrine Society

Production and Release of Macrophage Migration Inhibitory Factor from Human Adipocytes

Thomas Skurk1, Christian Herder1, Ilka Kräft, Sylvia Müller-Scholze, Hans Hauner and Hubert Kolb

Else Kröner-Fresenius Centre for Nutritional Medicine (T.S., H.H.), Technical University Munich, D-85350 Weihenstephan; and German Diabetes Center (C.H., I.K., S.M.-S., H.K.), Leibniz Institute at the Heinrich-Heine-University Düsseldorf, D-40225 Düsseldorf, Germany

Address all correspondence and requests for reprints to: Thomas Skurk, M.D., Technical University Munich, Else Kröner-Fresenius Centre for Nutritional Medicine, Hochfeldweg 1, D-85350 Freising/Weihenstephan. E-mail: skurk{at}wzw.tum.de.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Background and aim of the study: Macrophage migration inhibitory factor (MIF) has been identified as a critical mediator of inflammatory responses. Because of its potent migration inhibition activity, it regulates macrophage accumulation in tissues. We therefore analyzed whether human adipocytes produce MIF, in the search of candidate mediators of macrophage infiltration of obese adipose tissue. Methods: Human adipose tissue samples were obtained from various depots. The precursor cells were allowed to differentiate under defined adipogenic culture conditions. MIF expression was analyzed by RT-PCR, ELISA, and immunocytochemistry. Results: Human preadipocytes secreted MIF in a differentiation-dependent fashion with maximum concentrations at d 12, whereas MIF mRNA was detected in both undifferentiated and differentiated cells at relatively constant levels. Immunocytochemical analysis showed that MIF protein was present in preadipocytes and more pronounced in differentiated adipocytes. Freshly isolated mature adipocytes from sc, omental, and mammary depots released MIF at rates of up to 10,000 pg/ml·24 h. Most importantly, MIF production was positively correlated with donor body mass index. Secretion of MIF was not influenced by lipopolysaccharide, interferon-{gamma}, or IL-4. The rates of MIF release from sc and omental adipocytes were similar but approximately 10 times higher compared with mammary adipocytes. Conclusions: Human preadipocytes and mature adipocytes from different depots spontaneously release substantial amounts of MIF. Expression levels were positively associated with donor body mass index. Hence, MIF may be an obesity-dependent mediator of macrophage infiltration of adipose tissue.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THERE IS GROWING evidence that adipose tissue is not an inert lipid-storing organ but instead represents a multifunctional tissue that secretes a variety of factors that may directly contribute to obesity-related diseases such as atherosclerosis and type 2 diabetes mellitus (1, 2). Recent studies showed that obesity is associated with elevated serum levels of a wide range of inflammatory markers including C-reactive protein (CRP), IL-6, IL-18, and TNF-{alpha} and that elevated serum levels of these proteins are reduced after weight loss (3, 4, 5, 6, 7). Because it has been hypothesized that low-grade chronic inflammation may be etiologically related to the development of atherosclerosis and type 2 diabetes, obesity and adipose tissue-derived inflammatory mediators may play a crucial role in the pathogenesis of these diseases. In vitro studies established that both adipocytes and stromal cells of adipose tissue express and secrete cytokines and chemokines such as IL-6 and TNF-{alpha} (8, 9, 10, 11, 12).

MIF is a pleiotropic cytokine that participates in the immune and stress response. It is a key mediator for the septic shock syndrome and also exerts proinflammatory activities (13). MIF was found to prolong the lifespan of macrophages by protecting them from apoptosis, thus maintaining inflammatory processes. Additional proinflammatory activity is generated by counteracting glucocorticoid-induced suppression of the immune system (14, 15) and by up-regulating TNF-{alpha} expression in peripheral immune cells (16).

MIF is expressed in both immune and nonimmune cells including various peripheral tissues (17, 18, 19, 20). Recently, MIF was also identified as a product of mouse 3T3-L1 adipocytes (21, 22). In addition, MIF serum levels are elevated in patients with type 2 diabetes (23), and MIF expression is regulated by insulin and may be associated with insulin resistance (24, 25, 26). Recently, obese adipose tissue has been reported to exhibit severe macrophage infiltration (27, 28). Therefore, MIF may serve as a link between obesity and insulin resistance and may promote the development of type 2 diabetes.

The aim of this study, therefore, was to test the hypothesis that MIF is secreted by human adipose tissue and to investigate which factors regulate its expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Subjects
Adipose tissue samples (5–10 g) were obtained from young, healthy, normal-weight females [age < 40 yr, body mass index (BMI) < 27 kg/m2] undergoing elective mammary reduction or from the visceral and sc depot of patients undergoing abdominal surgery [age 49 ± 18 yr (range 22–91 yr), BMI 37 ± 15 kg/m2 (range 21–70 kg/m2)]. All subjects were free of metabolic or endocrine diseases as assessed by routine laboratory investigations. The procedure for obtaining human adipose tissue was approved by the Ethical Committee of the Heinrich-Heine-Universität Düsseldorf.

Cell culture
Adipose tissue samples were prepared as described previously (29). Briefly, connective tissue and visible blood vessels were removed with scissors, and fat lobules were cut into small pieces. The minced tissue was then digested in PBS (10 mmol/liter) containing 250 U/ml collagenase (Biochrom, Berlin, Germany) and 2% BSA (Sigma, Munich, Germany) for 90 min at 37 C in a shaking water bath. Stromal cells were collected by a 10-min centrifugation at 200 x g. The supernatants with the adipocytes were discarded. The sedimented cells were incubated in an erythrocyte lyzing buffer (154 mmol/liter NH4Cl, 5.7 mmol/liter K2HPO4, and 0.1 mmol/liter EDTA) for 10 min to remove red blood cells. Then, cells were filtered through a nylon mesh with a pore size of 150 µm to separate undigested material. To obtain a pure stromal cell fraction the cell suspension was filtered again through a cell strainer with a pore size of 70 µm. Finally, cells were resuspended in DMEM/Ham’s F-12 medium (vol/vol, 1:1) supplemented with 10% fetal bovine serum (Biochrom, Berlin, Germany) and seeded into 12-well culture plates (Biochrom) at a density of approximately 3 x 104/cm2. The serum-containing medium was replaced after 16 h by serum-free DMEM/F-12 medium supplemented with 10 mg/ml human transferrin (Sigma), 66 nmol/liter human insulin (Sigma), 100 nmol/liter cortisol (Aventis Pharma, Frankfurt, Germany), 0.2 nmol/liter T3 (Sigma) and 0.05 g/liter gentamycin (Invitrogen Life Technologies, Gaithersburg, MD). To induce adipose differentiation, cells were exposed to 1 µg/ml troglitazone (Sankyo Europe, Düsseldorf, Germany) and 0.5 mM isobutyl-methylxanthine (Serva, Heidelberg, Germany) for the first 4 d. Medium was changed every other day. On d 16, approximately 50–70% of the cells had acquired an adipocyte phenotype detectable by multiple cytoplasmatic lipid inclusions. Such cultures were incubated for 24 h with either 1 µg/ml lipopolysaccharide (Sigma) or 1 ng/ml interferon (IFN)-{gamma} or 50 ng/ml IL-4 (R&D Systems, Minneapolis, MN), respectively.

Suspension culture of human adipocytes
In parallel experiments, mature adipocytes were isolated. In contrast to the before mentioned protocol a shorter collagenase digestion of only 60 min in Krebs-Ringer buffer (pH 7.4) containing 4% BSA was performed. Cells were carefully centrifuged and washed twice with Krebs-Ringer buffer, supplemented with 0.1% BSA. After a filtration step through a 250-µm nylon mesh (VWR International, Darmstadt, Germany) cells were allowed to recover from preparation for 24 h in DMEM/F12 supplemented with 2% BSA. After this period, 400 µl packed adipocytes in 4 ml DMEM/F12 + 0,25% BSA were incubated for 24 h either with IFN-{gamma} (0.1 ng/ml) or IL-4 (5 ng/ml). Cells and the buffer medium were separately stored at –20 C for later analyses.

Real-time RT-PCR
All PCR reagents were purchased either from Applied Biosystems (ABI, Foster City, CA) and used according to the instructions of the manufacturer. Total RNA from 0.5 x 106 cells were isolated with the NucleoSpin RNA II kit from Machery-Nagel (Düren, Germany) and transcribed with the iSpricpt Synthesis kit (Bio-Rad, München, Germany). Quantitative PCR was performed in 20-µl reactions using an amount of 7.5 ng mRNA equivalent. 18S RNA was used to normalize for the starting amount of cDNA. Amplification was performed with the ABI 7000 sequence detection system using the following protocol: amplification was performed during 40 cycles (PCR initial activation step: 15 min, 95 C; denaturation: 30 sec, 95 C; annealing: 30 sec, 55 C; extension: 45 sec, 72 C).

FAM (6-carboxylfluorescein)-labeled probes were used in the Assay on Demand platform from ABI. The following reference sequences were provided by the company: AGCCCGGACAGGGTCTACATCAACT for MIF (accession no: NM_002415) (catalog no. Hs00236988_g1) and TGGAGGGCAAGTCTGGTGCCAGCAG for 18S RNA (accession no. x03205) (catalog no. Hs99999901_s1).

Measurement of MIF protein
Concentrations of MIF protein in cell culture supernatants were measured by using a highly sensitive sandwich ELISA (R&D Systems, Wiesbaden, Germany) with a detection limit of 20 pg/ml. All supernatants were analyzed in duplicates. Mean intra- and interassay variations were less than 5% and 20%, respectively.

Immunohistochemistry
For immunohistochemical detection a monoclonal mouse antihuman MIF antibody (R&D Systems, Minneapolis, MN) was used. Positive signals were detected using the horseradish peroxidase-diaminobenzidine system (R&D Systems) according to the instructions of the manufacturer. Stromal cells isolated from adipose tissue were cultured under the conditions mentioned before. For immunohistochemistry, cells were washed with PBS and fixed with pure methanol for 2 h at –20 C. For isotype control, cells were treated in the same manner and incubated with a monoclonal IgG1 antibody (R&D Systems).

Measurement of glycerol-3-phosphate dehydrogenase (GPDH) activity
GPDH activity was determined as a marker of adipose differentiation according to an established procedure (30). Briefly, cells were washed twice in PBS and harvested in a Tris-buffer (0.05 mol/liter Tris/HCl, 1 mmol/liter EDTA, 1 mmol/liter mercaptoethanol, pH at 7.4). After sonification of cells for complete cell lysis and centrifugation GPDH activity was assessed spectrophotometrically by addition of reduced nicotinamide adenine dinucleotide and dihydroxyacetone phosphate (Sigma). Specific activity was calculated and expressed as milliunits per milligrams of protein. For protein determination an established method including protein precipitation with trichloroacetic acid was used (31).

Statistical analysis
Results were expressed as mean ± SD of at least three experiments in triplicate. For comparisons ANOVA was used. P < 0.05 was considered to be statistically significant. Possible associations between BMI and sc and omental MIF expression was described by Spearman’s rank correlation test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MIF production and mRNA expression in cultured preadipocytes
In the first set of experiments, MIF secretion into the culture medium was measured in cultured stromal cells from human adipose tissue undergoing in vitro adipose differentiation. To relate the course of MIF secretion with the differentiation process, GPDH activity was measured at defined time points. GPDH activity as a marker of adipose differentiation was undetectable on d 0 but increased continuously throughout the culture time until d 16 (Fig. 1AGo). During this time period, the original fibroblast-like cells acquired an adipocyte phenotype as assessed by multiple large lipid droplets.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1. MIF secretion into the culture medium of in vitro-differentiating human adipocytes compared with control cells without adipogenic factors. A, Time-course of adipose differentiation assessed by the development of GPDH activity in human preadipocytes in primary culture (*, P < 0.05; **, P < 0.01). B, MIF concentrations in culture supernatants 24 h after addition of fresh medium. Data are given as mean ± SD of three experiments performed in duplicate. C, MIF mRNA expression during the course of differentiation compared with undifferentiated control cultures. Data are given as mean ± SD of four independent experiments in triplicates.

 
After inoculation, human preadipocytes secreted substantial amounts of MIF into the culture medium. During the course of adipose differentiation, there was no significant increase in the release of MIF into the culture medium, although there was a trend toward higher MIF levels at d 12 and 16 (400–600 pg/ml) (Fig. 1BGo).

Additional experiments were performed to assess the expression of MIF mRNA in fat cells differentiating in vitro. During the differentiation process (between d 4 and 24), we detected substantial MIF mRNA expression in both undifferentiated and differentiated cells (Fig. 1CGo). 18S RNA was used for normalization.

MIF release from freshly isolated human adipocytes
In addition, MIF release from freshly isolated adipocytes from different fat depots was assessed. As shown in Fig. 2Go, mature fat cells secreted substantial amounts of MIF over a 24-h incubation period. Interestingly, sc abdominal adipocytes exhibited a much greater potency of MIF release compared with mammary fat cells (Fig. 2Go). On a per cell basis, freshly isolated fat cells from the abdominal region produced approximately 10 times more MIF than in vitro differentiated preadipocytes (data not shown).



View larger version (8K):
[in this window]
[in a new window]
 
FIG. 2. Comparison of MIF release into the culture medium from mature human adipocytes maintained in DMEM/F12 medium supplemented with 2% BSA. Cells were kept in suspension culture for 24 h in a 1:10 dilution. MIF concentrations in supernatants from sc abdominal and mammary adipocytes after 24 h.

 
When sc and omental adipocytes from single donors were compared, there was no difference between the two depots. There was a close positive correlation of MIF release into the culture medium (r = 0.7273, P = 0.0074; n = 12) (Fig. 3AGo). The secretion of MIF from adipocytes depended on the donor BMI. As shown in Fig. 3BGo, MIF release from adipocytes and BMI were positively correlated in sc (r = 0.80; P = 0.002) and omental (r = 0.56; P = 0.057) fat cells.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3. A, Comparison of MIF release from omental and sc adipocytes after 24 h of suspension culture from 12 individual donors. Results reveal a high correlation among both depots (Spearman’s rank correlation: r = 0.73, P = 0.007). B, Effect of BMI on MIF release from omental (om) and sc adipocytes after 24 h of culture (Pearson correlation, om: r = 0.56, P = 0.057 (n = 12); sc: r = 0.80, P = 0.002 (n = 12).

 
Immunocytochemistry
To further demonstrate MIF expression by adipocytes, immunohistochemistry was performed. These experiments revealed a specific cytoplasmatic staining for MIF in preadipocytes and, even more pronounced, in in vitro-differentiated adipocytes (Fig. 4Go, C and F). The finding that adipocytes demonstrate a positive staining for MIF protein is arguing against the possibility that contaminating cells of the stromal fraction are responsible for MIF production in the supernatants.



View larger version (118K):
[in this window]
[in a new window]
 
FIG. 4. Detection of MIF protein in adipocytes by immunocytochemistry: cultures of undifferentiated preadipocytes (A–C) and moderately differentiated human preadipocytes after 12 d (D–F) without primary antibody (A and D), with isotype IgG (B and E) and with monoclonal MIF antibody (C and F) (magnification, x100). The strongest staining was observed in cells containing lipid droplets (F).

 
Effect of lipopolysaccharide (LPS), IFN-{gamma}, IL-4, and insulin on MIF release
The possible immunoregulation of MIF secretion from fat cells was analyzed by exposing in vitro differentiated human adipocytes to either LPS, or to the antagonistic cytokines IFN-{gamma} and IL-4. As demonstrated in Fig. 5Go, MIF secretion was not affected upon exposure to 1 µg/ml LPS. MIF production was also not modified by the addition of 1 ng/ml IFN-{gamma}, an inducer of a Th-1 response, or of 50 ng/ml IL-4, a stimulator of a Th-2 response. This was true for in vitro differentiated adipocytes from the sc, the omental, and the mammary adipose tissue depot. Similar data were obtained when freshly isolated mature adipocytes were exposed to these stimuli for 24 h (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 5. Effect of LPS, IFN-{gamma}, and IL-4 on MIF secretion from in vitro-differentiated adipocytes from sc, omental and mammary adipose tissue. Adipocytes were exposed to 1 µg/ml LPS, 1 ng/ml IFN-{gamma}, or 50 ng/ml IL-4 for 24 h. Data are given as mean concentrations of MIF in the supernatants from individual donors. C, Control.

 
In addition, because insulin has been shown to be a possible regulator of MIF secretion, administration to the cells was tested at a supraphysiological concentration of 66 nM. Incubation with insulin for 24 h neither increased MIF mRNA expression (mean increase 1.42-fold, range 0.2- to 4.4-fold, n = 8, P > 0.05) nor MIF production by mature adipocytes (mean ratio of MIF levels in insulin vs. control cultures 1.0, range 0.6–1.4, n = 12, P > 0.05 for sc adipocytes; mean ratio 0.9, range 0.7–1.0, n = 4, P > 0.05 for omental adipocytes.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we investigated the capacity of primary human adipocytes to produce and secrete MIF by using ELISA, quantitative RT-PCR and immunohistochemical staining. Our experiments clearly indicate that cultures of preadipocytes from human adipose tissue express MIF spontaneously. The adipose differentiation process of the cells was paralleled by an increase of MIF secretion. Analyses by quantitative RT-PCR revealed the presence of MIF mRNA in cultures of differentiating human preadipocytes. Cultures of preadipocytes may contain a small fraction of contaminating monocytes/macrophages that are known to be an important production site for MIF (13). We therefore conducted immunocytochemical studies using MIF-specific antibodies and isotype controls. MIF-specific staining was detectable and was more prominent in cells from differentiated vs. control cultures. Most importantly, the strongest staining for MIF was observed in mature adipocytes, recognizable by the accumulation of lipid droplets.

Freshly isolated mature adipocytes also spontaneously secreted substantial amounts of MIF during a 24-h culture period. Interestingly, comparative experiments also demonstrated that sc and omental adipocytes from the same donors exhibit a similar extent of MIF secretion into the culture medium, whereas mammary fat cells produced MIF at approximately 10-fold lower levels. Although donors of mammary adipose tissue and sc or omental adipose tissue differed in their BMI, it is unlikely that the 10-fold difference in MIF secretion could solely be explained by this fact. Regional differences in adipokine production and secretion could be of high clinical importance because the pattern of body fat distribution is known to be a powerful determinant of the clinical consequences of obesity (32, 33). However, one has to keep in mind that sc abdominal adipose tissue represents by far the biggest depot. Our data significantly extend the findings of previous studies reporting MIF release from mouse 3T3-L1 adipocytes (21, 22) by investigating both human preadipocytes and mature adipocytes. Furthermore, we also analyzed the effects of fat depot and donor BMI on MIF secretion, which have not been investigated before.

Another novel and important finding of this study is that MIF secretion from both sc and omental adipocytes was closely correlated with the BMI of the individual donor. This could be of particular significance in view of the recently demonstrated association of obesity with macrophage infiltration in adipose tissue (27, 28). Therefore, MIF may qualify as a candidate adipocyte product contributing to macrophage infiltration of fat tissue in obesity. Monocyte chemoattractant protein-1 (MCP-1) is another mediator that has been discussed in the context of macrophage infiltration in obesity (27, 28). Interestingly, MIF has been reported to counteract MCP-1-mediated chemotaxis of human peripheral blood monocytes (34). Because adipocytes cosecrete MIF and MCP-1 (our unpublished data), MIF is a potential candidate that may contribute to macrophage accumulation in obese fat tissue. This aspect merits further attention.

Another interesting finding of our study was the lack of responsiveness of mature adipocytes from sc, omental, and mammary to LPS, IFN-{gamma}, or IL-4. Although sufficiently high concentrations of these immunostimulatory compounds were used in the culture models that potently induced or modulated cytokine secretion in monocytes/macrophages, dendritic cells and endothelial cells (35, 36) (and unpublished data), the release of MIF into the culture medium remained unaffected. This observation is important from a technical point of view because it confirms the absence of monocytes/macrophages in our culture system. The latter cells are well known to secrete increased amounts of MIF upon stimulation with LPS or IFN-{gamma} (37, 38, 39). In addition, these data also suggest that the immunological properties of adipocytes may be different from those of innate immune cells with respect to the regulation of MIF expression. To date, little is known about the functional role of MIF in metabolic disorders such as type 2 diabetes and in atherosclerosis. As recent findings in murine cells suggest, insulin seems to be a potential regulator of MIF expression and secretion (24). In contrast to these findings insulin didn’t seem to have an intrinsic effect on neither mRNA nor protein level in the human model arguing for the constitutive character of MIF secretion from fat cells. However, recent studies indicated that MIF serum concentrations are elevated in subjects with type 2 diabetes mellitus (23) or insulin resistance (26). Whether MIF is directly involved in the pathophysiological processes leading to insulin resistance and atherosclerosis or simply an innocent bystander remains to be determined.

Taken together, our experiments show that adipocytes spontaneously express and secrete MIF protein. Differences in the amounts of MIF secretion were observed between adipocytes from different fat depots. An intriguing observation was that constitutive MIF secretion from adipocytes increased with increasing BMI of the donor. From this observation and the known physiological function of MIF, it is tempting to speculate that this cytokine contributes to macrophage infiltration into adipose tissue in obesity.


    Acknowledgments
 
We are indebted to Mrs. Karin Röhrig for excellent technical assistance.


    Footnotes
 
The work was supported by the Federal Ministry of Health and Social Security and the Ministry of Science and Research of the State of North Rhine-Westphalia and by the Else Kröner-Fresenius Foundation (Bad Homburg, Germany).

First Published Online December 2, 2004

1 T.S. and C.H. contributed equally to this work. Back

Abbreviations: BMI, Body mass index; CRP, C-reactive protein; GPDH, glycerol-3-phosphate dehydrogenase; IFN, interferon; LPS, lipopolysaccharide; MCP-1, monocyte chemoattractant protein-1; MIF, macrophage migration inhibitory factor.

Received July 16, 2004.

Accepted for publication November 23, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lyon CJ, Law RE, Hsueh WA 2003 Minireview: adiposity, inflammation, and atherogenesis. Endocrinology 144:2195–2200[Abstract/Free Full Text]
  2. Rajala MW, Scherer PE 2003 Minireview: the adipocyte—at the crossroads of energy homeostasis, inflammation, and atherosclerosis. Endocrinology 144:3765–3773[Abstract/Free Full Text]
  3. Yudkin JS, Stehouwer CD, Emeis JJ, Coppack SW 1999 C-reactive protein in healthy subjects: associations with obesity, insulin resistance, and endothelial dysfunction: a potential role for cytokines originating from adipose tissue? Arterioscler Thromb Vasc Biol 19:972–978[Abstract/Free Full Text]
  4. Bastard JP, Jardel C, Bruckert E, Blondy P, Capeau J, Laville M, Vidal H, Hainque B 2000 Elevated levels of interleukin 6 are reduced in serum and subcutaneous adipose tissue of obese women after weight loss. J Clin Endocrinol Metab 85:3338–3342[Abstract/Free Full Text]
  5. Esposito K, Pontillo A, Ciotola M, Di Palo C, Grella E, Nicoletti G, Giugliano D 2002 Weight loss reduces interleukin-18 levels in obese women. J Clin Endocrinol Metab 87:3864–3866[Abstract/Free Full Text]
  6. Tchernof A, Nolan A, Sites CK, Ades PA, Poehlman ET 2002 Weight loss reduces C-reactive protein levels in obese postmenopausal women. Circulation 105:564–569[Abstract/Free Full Text]
  7. Esposito K, Pontillo A, Di Palo C, Giugliano G, Masella M, Marfella R, Giugliano D 2003 Effect of weight loss and lifestyle changes on vascular inflammatory markers in obese women: a randomized trial. JAMA 289:1799–1804[Abstract/Free Full Text]
  8. Kern PA, Saghizadeh M, Ong JM, Bosch RJ, Deem R, Simsolo RB 1995 The expression of tumor necrosis factor in human adipose tissue. Regulation by obesity, weight loss, and relationship to lipoprotein lipase. J Clin Invest 95:2111–2119
  9. Hotamisligil GS, Arner P, Caro JF, Atkinson RL, Spiegelman BM 1995 Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J Clin Invest 95:2409–2415
  10. Hube F, Birgel M, Lee YM, Hauner H 1999 Expression pattern of tumour necrosis factor receptors in subcutaneous and omental human adipose tissue: role of obesity and non-insulin-dependent diabetes mellitus. Eur J Clin Invest 29:672–678[CrossRef][Medline]
  11. Fried SK, Bunkin DA, Greenberg AS 1998 Omental and subcutaneous adipose tissues of obese subjects release interleukin-6: depot difference and regulation by glucocorticoid. J Clin Endocrinol Metab 83:847–850[Abstract/Free Full Text]
  12. Path G, Bornstein SR, Gurniak M, Chrousos GP, Scherbaum WA, Hauner H 2001 Human breast adipocytes express interleukin-6 (IL-6) and its receptor system: increased IL-6 production by ß-adrenergic activation and effects of IL-6 on adipocyte function. J Clin Endocrinol Metab 86:2281–2288[Abstract/Free Full Text]
  13. Bernhagen J, Calandra T, Bucala R 1998 Regulation of the immune response by macrophage migration inhibitory factor: biological and structural features. J Mol Med 76:151–161[CrossRef][Medline]
  14. Calandra T, Bernhagen J, Metz CN, Spiegel LA, Bacher M, Donnelly T, Cerami A, Bucala R 1995 MIF as a glucocorticoid-induced modulator of cytokine production. Nature 377:68–71[CrossRef][Medline]
  15. Calandra T, Bucala R 1997 Macrophage migration inhibitory factor (MIF): a glucocorticoid counter-regulator within the immune system. Crit Rev Immunol 17:77–88[Medline]
  16. Roger T, Glauser MP, Calandra T 2001 Macrophage migration inhibitory factor (MIF) modulates innate immune responses induced by endotoxin and Gram-negative bacteria. J Endotoxin Res 7:456–460[CrossRef]
  17. Imamura K, Nishihira J, Suzuki M, Yasuda K, Sasaki S, Kusunoki Y, Tochimaru H, Takekoshi Y 1996 Identification and immunohistochemical localization of macrophage migration inhibitory factor in human kidney. Biochem Mol Biol Int 40:1233–1242[Medline]
  18. Nishihira J, Koyama Y, Mizue Y 1998 Identification of macrophage migration inhibitory factor (MIF) in human vascular endothelial cells and its induction by lipopolysaccharide. Cytokine 10:199–205[CrossRef][Medline]
  19. Ogata A, Nishihira J, Suzuki T, Nagashima K, Tashiro K 1998 Identification of macrophage migration inhibitory factor mRNA expression in neural cells of the rat brain by in situ hybridization. Neurosci Lett 246:173–177[CrossRef][Medline]
  20. Nishio Y, Minami A, Kato H, Kaneda K, Nishihira J 1999 Identification of macrophage migration inhibitory factor (MIF) in rat peripheral nerves: its possible involvement in nerve regeneration. Biochim Biophys Acta 1453:74–82[Medline]
  21. Hirokawa J, Sakaue S, Tagami S, Kawakami Y, Sakai M, Nishi S, Nishihira J 1997 Identification of macrophage migration inhibitory factor in adipose tissue and its induction by tumor necrosis factor-{alpha}. Biochem Biophys Res Commun 235:94–98[CrossRef][Medline]
  22. Hirokawa J, Sakaue S, Furuya Y, Ishii J, Hasegawa A, Tagami S, Kawakami Y, Sakai M, Nishi S, Nishihira J 1998 Tumor necrosis factor-alpha regulates the gene expression of macrophage migration inhibitory factor through tyrosine kinase-dependent pathway in 3T3–L1 adipocytes. J Biochem (Tokyo) 123:733–739[Abstract/Free Full Text]
  23. Yabunaka N, Nishihira J, Mizue Y, Tsuji M, Kumagai M, Ohtsuka Y, Imamura M, Asaka M 2000 Elevated serum content of macrophage migration inhibitory factor in patients with type 2 diabetes. Diabetes Care 23:256–258[Medline]
  24. Sakaue S, Nishihira J, Hirokawa J, Yoshimura H, Honda T, Aoki K, Tagami S, Kawakami Y 1999 Regulation of macrophage migration inhibitory factor (MIF) expression by glucose and insulin in adipocytes in vitro. Mol Med 5:361–371[Medline]
  25. Benigni F, Atsumi T, Calandra T, Metz C, Echtenacher B, Peng T, Bucala R 2000 The proinflammatory mediator macrophage migration inhibitory factor induces glucose catabolism in muscle. J Clin Invest 106:1291–1300[Medline]
  26. Vozarova B, Stefan N, Hanson R, Lindsay RS, Bogardus C, Tataranni PA, Metz C, Bucala R 2002 Plasma concentrations of macrophage migration inhibitory factor are elevated in Pima Indians compared to Caucasians and are associated with insulin resistance. Diabetologia 45:1739–1741[CrossRef][Medline]
  27. Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante Jr AW 2003 Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 112:1796–1808[CrossRef][Medline]
  28. Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, Sole J, Nichols A, Ross JS, Tartaglia LA, Chen H 2003 Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J Clin Invest 112:1821–1830[CrossRef][Medline]
  29. Hauner H, Skurk T, Wabitsch M 2001 Cultures of human adipose precursor cells. Methods Mol Biol 155:239–247[Medline]
  30. Pairault J, Green H 1979 A study of the adipose conversion of suspended 3T3 cells by using glycerophosphate dehydrogenase as differentiation marker. Proc Natl Acad Sci USA 76:5138–5142[Abstract/Free Full Text]
  31. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ 1951 Protein measurement with the folin phenol reagent. J Biol Chem 93:265–275
  32. Kissebah AH, Krakower GR 1994 Regional adiposity and morbidity. Physiol Rev 74:761–811[Free Full Text]
  33. Wajchenberg BL 2000 Subcutaneous and visceral adipose tissue: their relation to the metabolic syndrome. Endocr Rev 21:697–738[Abstract/Free Full Text]
  34. Hermanowski-Vosatka A, Mundt SS, Ayala JM, Goyal S, Hanlon WA, Czerwinski RM, Wright SD, Whitman CP 1999 Enzymatically inactive macrophage migration inhibitory factor inhibits monocyte chemotaxis and random migration. Biochemistry 38:12841–12849[CrossRef][Medline]
  35. Burkart V, Kim YE, Hartmann B, Ghiea I, Syldath U, Kauer M, Fingberg W, Hanifi-Moghaddam P, Muller S, Kolb H 2002 Cholera toxin B pretreatment of macrophages and monocytes diminishes their proinflammatory responsiveness to lipopolysaccharide. J Immunol 168:1730–1737[Abstract/Free Full Text]
  36. Rose B, Herder C, Loffler H, Kolb H, Martin S 2004 Combined activation of innate and T cell immunity for recognizing immunomodulatory properties of therapeutic agents. J Leukoc Biol 75:624–630[Abstract/Free Full Text]
  37. Calandra T, Bernhagen J, Mitchell RA, Bucala R 1994 The macrophage is an important and previously unrecognized source of macrophage migration inhibitory factor. J Exp Med 179:1895–1902[Abstract/Free Full Text]
  38. Calandra T, Spiegel LA, Metz CN, Bucala R 1998 Macrophage migration inhibitory factor is a critical mediator of the activation of immune cells by exotoxins of Gram-positive bacteria. Proc Natl Acad Sci USA 95:11383–11388[Abstract/Free Full Text]
  39. Martiney JA, Sherry B, Metz CN, Espinoza M, Ferrer AS, Calandra T, Broxmeyer HE, Bucala R 2000 Macrophage migration inhibitory factor release by macrophages after ingestion of Plasmodium chabaudi-infected erythrocytes: possible role in the pathogenesis of malarial anemia. Infect Immun 68:2259–2267[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
DiabetesHome page
E. Ortega Martinez de Victoria, X. Xu, J. Koska, A. M. Francisco, M. Scalise, A. W. Ferrante Jr., and J. Krakoff
Macrophage Content in Subcutaneous Adipose Tissue: Associations With Adiposity, Age, Inflammatory Markers, and Whole-Body Insulin Action in Healthy Pima Indians
Diabetes, February 1, 2009; 58(2): 385 - 393.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Herder, S. Schneitler, W. Rathmann, B. Haastert, H. Schneitler, H. Winkler, R. Bredahl, E. Hahnloser, and S. Martin
Low-Grade Inflammation, Obesity, and Insulin Resistance in Adolescents
J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4569 - 4574.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Ye, Z. Gao, J. Yin, and Q. He
Hypoxia is a potential risk factor for chronic inflammation and adiponectin reduction in adipose tissue of ob/ob and dietary obese mice
Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E1118 - E1128.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Y. Kim, K. Tillison, S. Zhou, Y. Wu, and C. M. Smas
The major facilitator superfamily member Slc37a2 is a novel macrophage- specific gene selectively expressed in obese white adipose tissue
Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E110 - E120.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Skurk, C. Alberti-Huber, C. Herder, and H. Hauner
Relationship between Adipocyte Size and Adipokine Expression and Secretion
J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1023 - 1033.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. N. Lumeng, S. M. DeYoung, J. L. Bodzin, and A. R. Saltiel
Increased Inflammatory Properties of Adipose Tissue Macrophages Recruited During Diet-Induced Obesity
Diabetes, January 1, 2007; 56(1): 16 - 23.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. N. Lumeng, S. M. Deyoung, and A. R. Saltiel
Macrophages block insulin action in adipocytes by altering expression of signaling and glucose transport proteins
Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E166 - E174.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Chung, K. LaPoint, K. Martinez, A. Kennedy, M. Boysen Sandberg, and M. K. McIntosh
Preadipocytes Mediate Lipopolysaccharide-Induced Inflammation and Insulin Resistance in Primary Cultures of Newly Differentiated Human Adipocytes
Endocrinology, November 1, 2006; 147(11): 5340 - 5351.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. Schaffler, U. Muller-Ladner, J. Scholmerich, and C. Buchler
Role of Adipose Tissue as an Inflammatory Organ in Human Diseases
Endocr. Rev., August 1, 2006; 27(5): 449 - 467.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
C. Herder, H. Kolb, W. Koenig, B. Haastert, S. Muller-Scholze, W. Rathmann, R. Holle, B. Thorand, and H.-E. Wichmann
Association of Systemic Concentrations of Macrophage Migration Inhibitory Factor With Impaired Glucose Tolerance and Type 2 Diabetes: Results from the Cooperative Health Research in the Region of Augsburg, Survey 4 (KORA S4)
Diabetes Care, February 1, 2006; 29(2): 368 - 371.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. Cinti, G. Mitchell, G. Barbatelli, I. Murano, E. Ceresi, E. Faloia, S. Wang, M. Fortier, A. S. Greenberg, and M. S. Obin
Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans
J. Lipid Res., November 1, 2005; 46(11): 2347 - 2355.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Trayhurn
Adipose Tissue in Obesity--An Inflammatory Issue
Endocrinology, March 1, 2005; 146(3): 1003 - 1005.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Skurk, T.
Right arrow Articles by Kolb, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Skurk, T.
Right arrow Articles by Kolb, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals