| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Medical Pharmacology (O.C.M., S.v.d.L., P.J.S., S.H.H., T.F.D., E.R.d.K.), Leiden/Amsterdam Center for Drug Research and Leiden University Medical Center, Leiden University, 2300 RA Leiden, The Netherlands; Department of Metabolic and Endocrine Diseases (E.K.), University Medical Center Utrecht, 3508 AB Utrecht, The Netherlands; and Division of Nephrology (D.P.), Department of Medicine, University of California, San Francisco, California 94143
Address all correspondence and requests for reprints to: O. C. Meijer, Division of Medical Pharmacology, Leiden/Amsterdam Center for Drug Research, P.O. Box 9503, 2300 RA Leiden, The Netherlands. E-mail: o.meijer{at}lacdr.leidenuniv.nl.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In some tissues the two receptor types mediate in a coordinate fashion signaling by cortisol and corticosterone, the most important glucocorticoids in man and rodents, respectively. In cells expressing both receptor types, MRs and GRs mediate different and at times opposite effects on cellular physiology, underscoring the importance of differential transcriptional properties of these two receptors (7). Besides receptor specificity, there are many instances of cell-specific gene regulation by corticosteroids, unexplained by receptor expression. For instance, in the rat brain, CRH mRNA is down-regulated by corticosterone via GRs in the hypothalamus but up-regulated in the amygdala nucleus, presumably via cell specific transcriptional effects (8). The mechanisms underlying such cell and receptor specificity are as yet largely unknown.
Over the last several years, a large number of coregulatory proteins that influence transcriptional responses of nuclear receptors has been discovered (9). The family of p160 steroid receptor coactivators (SRCs) consists of three genes (10), and each of their products can bind to the activation function (AF)-2 of nuclear receptors through interactions with LxxLL motifs or nuclear receptor (NR) boxes (11). In addition, SRCs may also interact with the less conserved N-terminal domains of steroid receptors (12, 13). The actual stimulation of transcription depends on direct histone acetyl transferase activity and recruitment of cointegrators such as cAMP response element-binding protein (CBP)/p300 (14) or the methyl transferase CARM-1 (15). The interaction with at least one of the SRCs, which are expressed in a cell-specific manner (16, 17), is thought to be necessary for transcriptional stimulation to occur (18, 19). The interaction between the SRC variant and the specific NR is thought to determine the nature of the interaction and magnitude of coactivation.
Five different splice variants of SRC-1 were originally reported (20), of which SRC-1a and 1e have been consistently found (21, 22). These differ only at their carboxy terminus, which is shorter in SRC-1e. The SRC-1a-specific 56 amino acids contain an extra NR box and a potential suppressor domain. These splice variants were shown to differ in their interactions with the (isolated) ligand-binding domains (LBDs) of NRs (21) and their functional interactions with the estrogen receptor-
(22). In addition, the expression of SRC-1a and 1e mRNA is cell specific. In crucial corticosteroid-sensitive cell populations in the brain, considerable differences in the expression of the splice variants were observed (23).
In view of the observed differences between SRC-1a and -1e, we tested, using cultured cells as a model, the hypothesis that there are differential interactions between SRC-1 splice variants and corticosteroid receptors, which may contribute to cell- and receptor-specific corticosteroid effects. Hence, we tested the functional and physical interactions of SRC-1a and 1e with MRs and GRs, using transient reporter assays and mammalian 1-hybrid studies. We also tested the hypothesis that the abundance of SRC1a and SRC-1e mRNA is differentially regulated. We find that these splice variants differentially affect transcription in a receptor-, promoter-, and ligand-dependent fashion and that there can be specific physical interactions between SRC-1 and the MR N-terminal fragments. In addition, we show that the relative abundance of SRC-1a and SRC-1e mRNA is subject to regulation in the pituitary in vivo.
| Materials and Methods |
|---|
|
|
|---|
All conditions were tested at least in triplicate, and each experiment was repeated three times with essentially similar results. Data are expressed as average ± SEM. All results were analyzed by ANOVA and statistically tested with post hoc Tukey Kramer test. For the ligand-activated receptors, statistical significance (P < 0.05) was attributed based on differences in fold induction by hormone (i.e. all luciferase values from glucocorticoid response element (GRE)-containing reporters were normalized to Renilla luciferase. Induction was calculated for each steroid-treated sample as signal in the presence of hormone divided by the average signal from the same condition in absence of hormone).
Plasmids
Most plasmids we used have been described previously. Human MR and GR expression plasmids (3) were kindly provided by Dr D. Spengler, with permission of Dr. R. Evans (Salk Institute, San Diego, CA). For rat MRs and GRs, and truncations and chimeras thereof, we used the 6RMR and 6RGR-based plasmids (5, 24). These and the p
ODLO-based reporter plasmids TAT-1-TATA and TAT3-TATA were described earlier (25), as were the reporters driven by rat phenylethanolamine-N-methyltransferase (PNMT) promoter fragment containing multiple GREs and endogenous TAT 5' regulatory region (26). pSG-5 based expression vectors for full-length and mutant SRC-1a and SRC-1e were also described (22). The SRC-1 plasmids used in this study contain a 2x FLAG-tag at the 5' end of the cDNA. The
Q plasmid (SRC-1e
10531123) was kindly provided by Dr. C. Bevan (Imperial College, London, UK). The pPRE1-tk-Luc and pPRE2-tk-Luc, and mouse mammary tumor virus (MMTV)-luciferase (LUC) plasmids were kindly provided by Dr. G. Jenster (Rotterdam University Medical Center, Rotterdam, The Netherlands). The pPRE2-tk-Luc reporter was constructed by inserting the XhoI-digested (PRE)2TK fragment from pBL2(PRE)2TK-CAT plasmid (27) into the XhoI-digested pGL3basic vector (Promega). The p(PRE)1-tk-Luc reporter was generated by deleting one progesterone response element (PRE) (AGAACAtccTGTACA) from the p(PRE)2-tk-Luc plasmid using the two flanking BsrGI sites. The expression vectors for SRC-1 fragments fused to the VP16-AD were generated by excision of EcoRI fragments from the pSG424 constructs (21) and cloning them into pSG5-VP16 (28).
Western blots
Cells from wells parallel to luciferase experiments were lysed in 0.5 x radioimmunoprecipitation assay and subjected to SDS-PAGE. Proteins were transferred onto Immobilon membranes (Millipore Corp., Bedford, MA) and processed as described (29). Blots were blocked in 10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.05% Tween 20 containing 5% nonfat dried milk powder and subsequently incubated with the M2 primary anti-FLAG antibody (1:4000, Sigma, St. Louis, MO), the M-20 GR antibody (1:500, Santa-Cruz Biotechnology, Santa Cruz, CA), or the monoclonal anti-
-tubulin antibody (Sigma, 1:1000). After a wash, blots were incubated with peroxidase-conjugated antibodies (1:10,000; Jackson ImmunoResearch Laboratories, West Grove, PA). Blots were washed again, and immunoreactive bands were visualized by enhanced chemiluminescence.
Quantitative PCR quantification of PNMT mRNA
Neuroscreen-1 cells (Cellomics Europe) were grown in RPMI 1640 medium with L-glutamine (Life Technologies, Inc., Grand Island, NY), supplemented with 10% horse serum, and 5% fetal bovine serum. Cells were transfected with 3 µg of SRC-1A or 1E plasmid per 2 million cells or mock transfected, using a Nucleofector and electroporation buffer V (Amaxa Biosystems). Cells were plated at 106 per well in collagen-coated 6-well plates and after 1 d were exposed to dexamethasone (106 M) or vehicle for 18 h. Total RNA was isolated using an RNeasy kit (Qiagen, Hilden, Germany) according to the manufacturers instructions. During RNA extraction, samples were treated on-column with RNase-free DNase I (Qiagen). Total RNA required for standard curves was obtained from the rat adrenal and isolated with Trizol reagent (GIBCO BRL). Potential genomic DNA was degraded with DNase I (Invitrogen Corp., Carlsbad, CA). The purity and concentration of isolated total RNA was measured by the ND-1000 spectrophotometer (NanoDrop Technology) where the ratio of absorption at 260 and 280 nm for all samples was at least 1.9. First-strand cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen) and Oligo(dT)1218 (Invitrogen) in accordance with the manufacturers specifications. Real-time PCR was performed on a LightCycler 2.0 (Roche Diagnostics, Indianapolis, IN) using LightCycler FastStart DNA Masterplus SYBR Green I (Roche Diagnostics). The expression of PNMT was normalized against ß-actin. The sequences of the used primers are: Actb forward, tgaccgagcgtggctaca; Actb reverse, cagcttctctttaatgtcacgca; PNMT forward, gcgagggtgaagcgagtcttgcc; and PNMT reverse, tacccccgggcctcagcagc. Statistical significance of differences in normalized mRNA levels (four wells per condition) was determined by the Kruskal-Wallis test followed by the Mann-Whitney U test.
In situ hybridization
For determination of pituitary mRNA levels of SRC-1a and 1e, male rats (240 g Wistar rats, Charles River, Germany) were adrenalectomized or sham operated (n = 6) under gas anesthesia using the dorsal approach. Six animals per group were sc implanted with a 100-mg pellet containing 100% cholesterol, 20% corticosterone, or 100% corticosterone. All adrenalectomized animals had access to saline. After 1 wk the animals were decapitated, and pituitaries were collected and frozen at 80 C. The animal experiments were performed in accordance with the European Communities Council Directive 86/609/EEC and with approval from the animal care committee of the Faculty of Medicine, Leiden University (UDEC no. 99062). The tissue was cut at 14 µm on a cryostat and thaw mounted on poly-L-lysine-coated slides, each slide containing two sections from four rats, each rat belonging to a different treatment group. In situ hybridization with SRC-1a- and 1e-specific end-labeled oligonucleotide probes was performed as described (23). The signal was quantified from film (X-OMAT AR, Kodak, Rochester, NY) using an automated image analysis system (Paes Nederland, Zoeterwoude). The signals were in the linear range of gray values according to the [14C] RPA 504 microscales (Amserham, Aylesbury, UK). Four sections per animal, i.e. 24 sections per treatment group, were analyzed by ANOVA and post hoc Tukey-Kramer test.
| Results |
|---|
|
|
|---|
|
The p
ODLO backbone of the TAT-1 and TAT-3 plasmids was not influenced by corticosterone activation of either corticosteroid receptor and/or overexpression of SRC-1a and SRC-1e (Fig. 1
, E and F). Furthermore, SRC-1a and SRC-1e were expressed at similar levels under our experimental conditions (Fig. 1G
), Also, the expression vector of the receptors was not affected by coactivator expression or hormone treatment (shown for GR in Fig. 1H
). Human MRs and GRs showed the same promoter dependence in coactivation as the rat receptors in transient transfection studies in CV-1 cells (data not shown).
The results suggested that the number of GREs may be a critical parameter that determines differential coactivation by SRC-1a and -1e. Hence, we tested in CV-1 cells, in parallel to the TAT-1 and TAT-3 reporters, a number of other reporters that differ only in the number of GREs (Table 1
). PRE-1-tk-Luc and PRE-2-tk-Luc contain one and two GREs upstream of a minimal tk promoter, respectively. The rat PNMT has a multiple GRE-containing fragment of the rat PNMT gene 5' flanking region upstream of a SV40 basal promoter. The PNMT
3 reporter contains mutations in three GRE half-sites and behaves like a single GRE-containing promoter (26). As shown in Table 1
, in all cases the coactivation by SRC-1a was stronger on the single response element-containing reporter, whereas SRC-1e coactivated more strongly at the multiple GREs. Also shown is the ratio of coactivation by SRC-1a and SRC-1e. For the TAT-3 reporter, this ratio is consistently higher for coactivation of the MR, compared with the GR. Coactivation of GR at the often-used GRE-containing MMTV reporter was not different between SRC-1a and SRC-1e (data not shown).
|
|
We next studied whether differential coactivation by the splice variants would hold in the context of an endogenous gene. As a model we took induction of the PNMT gene via GR by dexamethasone in neuroscreen-1 cells, a subclone of the PC-12 cell line for which the phenomenon was reported (32). Without addition of dexamethasone to the medium, no PNMT mRNA could be measured by quantitative PCR (data not shown). After treatment with 1 µM dexamethasone, there was a clear induction of PNMT mRNA in mock-transfected cells (Fig. 2C
). Overexpression of SRC-1A and 1E both led to lower levels of PNMT mRNA, but expression was modestly, but significantly, higher in cells overexpressing SRC-1E than in cells overexpressing SRC-1A, as hypothesized based on the results with the PNMT GRE-containing region in the context of a reporter plasmid.
Thus, the promoter-dependent coactivation in relation to the presence of multiple GREs was observed using overexpressed as well as (for GR) endogenous receptors, in the contexts of simple and more complex regulatory regions, and held for induction of the endogenous PNMT gene.
Input domains of the SRCs
The promoter-dependent coactivation by SRC-1 splice variants may reflect differential recruitment of the coactivators by the receptors. To test this possibility, we studied the interactions between MR and GR with different domains of the SRC-1 protein at the TAT-1 and TAT-3 reporter, coexpressing in CV-1 cells MR or GR with hybrids of SRC-1 fragments and the VP16 activation domain (AD) as shown in Figure 3A
. The hypothesis of preferential coactivator recruitment as the basis for promoter-specific effects would be supported by, for example, a higher degree of receptor interaction of the SRC-1a-specific fragment at the TAT-1 reporter, compared with the TAT-3 reporter. At both reporters the expression of the central LxxLL (NR box) containing fragment SRC-1570780 fused to VP16-AD led to increased reporter activity after activation of either MR and GR by 107 M corticosterone, compared with expression of the VP16-AD alone (Fig. 3
). Also, the other NR box-containing fragment SRC-1A12411441 led to increased reporter activity at both reporters. The SRC-1e C-terminal region (12411399) or that of SRC-1a from which the NR box was deleted (12411385) showed no sign of interaction with the steroid receptors. These data provide no evidence for promoter-specific recruitment of SRC-1 splice variants as the cause of promoter-specific coactivation because there was no difference in recruitment of the splice variant-specific carboxy-terminal parts of SRC-1. The only other notable difference was a decreased activation for the fragment SRC-19881240 at the TAT-3 reporter, which was specific for GR, but did not reach significance in the ANOVA post hoc test (Fig. 3C
; also see below).
|
GG and
MM were strongly and comparably coactivated by SRC-1e and not by SRC-1a at this reporter (Fig. 4
and GG
are constitutively active transcription factors (Fig. 4
was not influenced by overexpression of SRC-1 splice variants (Fig. 4D
we observed a modest but consistent (approximately 2-fold) coactivation by SRC-1e (Fig. 4B
|
Q construct; (12)]. In case of the full-length receptors as well as for the AF-2-driven N-terminal truncations of the MR and GR, deletion of the NR boxes abolished coactivation by SRC-1e (Fig. 5
|
protein.
Thus, besides pronounced reporter specificity, the SRC-1 splice variants also showed a degree of receptor specificity, apparent from selective coactivation of MR AF-1 by SRC-1e and the interaction observed in the 1-hybrid assay. In the context of the full-length receptor (Fig. 3C
), no interaction between the MR and SRC-19881240 fragment is apparent. However, the observed lower reporter induction for full-length GR at the TAT-3 reporter in Fig. 3
does suggest a degree of receptor specificity for full-length receptors in their interaction with SRC-19881240, which may be related to the apparent stronger coactivation of MR at multiple response elements.
Ligand dependence
We further tested in CV-1 cells whether, besides the strong promoter and modest receptor specificity for SRC-1a and 1e, different ligands may also determine coactivation by these splice variants. Because the effect of antagonists is thought to depend on relative coactivator to corepressor ratio, we tested the coactivation by SRC-1a and -1e for the partial agonistic effects of the GR antagonist RU486 (Fig. 6
). The transactivation on the TAT3 Luc reporter induced by 107 M RU486 was consistently around 15%, compared with corticosterone in absence of overexpressed coactivator (16 ± 4% over all experiments). The coactivation of RU486-activated GR by SRC-1 splice variants was strikingly different from corticosterone-activated GR: similar to our earlier experiments, SRC-1e but not -1a coactivated in the presence of 107 M corticosterone (Fig. 6B
), but in presence of 107 M RU486, SRC-1a rather than -1e coactivated GR at the TAT3 reporter (Fig. 6A
). When the MR was incubated with 107 M of the antagonist spironolactone, a modest partial agonism was also observed, but in this case the coactivation by SRC-1a and -1e was similar to that of corticosterone-activated MR (data not shown). Also, the coactivation of MR in the presence of 5 x 109 M of the full agonist aldosterone was not different from what was observed with corticosterone (not shown).
|
|
The relative partial agonistic/antagonistic effect of 107 M RU486 in the presence of different concentrations of corticosterone is summarized in Table 2
. SRC-1a overexpression leads to stronger partial agonistic effects of RU486 at low corticosterone levels and much weaker antagonist effect at higher levels of corticosterone, when compared with SRC-1e. Thus, variations of SRC-1 splice variant abundance may lead to differences in transactivation on binding of full agonists but also to different efficacy of some antagonists.
|
|
|
| Discussion |
|---|
|
|
|---|
The CV-1 cells in which we performed most of our experiments have their pros and cons. MR AF-1 is inherently weak in CV-1 cells, which may affect our results. On the other hand, they lack endogenous MRs and GRs and therefore allow the corticosteroid receptor status to be defined. Transactivation via the endogenous GR of A549 cells showed effects of SRC-1a and -1e that were very similar to those observed in CV-1 cells. Whereas the choice of these cells is to some extent arbitrary, we can conclude that the specific interactions are not the consequence of overexpression of the receptor protein, although we did not test cell lines expressing endogenous MRs. CV-1 cells do express endogenous p160 coactivators (14), but for lack of slice variant-specific antibodies, we do not know the relative abundance of endogenous SRC-1a and -1e protein. Because the observed effects in these cells are all in the context of overexpressed coactivators, the in vivo importance of the outcome of the differential interactions remains to be determined. However, differential interaction with nuclear receptors between SRC-1 and SRC-2 have been shown to have large functional consequences for fat tissue (37), despite a degree of functional redundancy between these coactivators (38). Similarly, the differences between SRC-1 splice variants may well bear functional relevance because pronounced differences in SRC-1a and -1e mRNA expression occurs among different glucocorticoid target cells in vivo, in some instances in an all-or-nothing fashion (23). In addition, the differential down-regulation of mRNA we observed in the pituitary (Fig. 8
) suggests that the ratio between the splice variants may even be physiologically regulated in certain cell types.
One of the most striking differences we observed between the SRC-1 splice variants was the specific strong coactivation by SRC-1e at multiple GRE-containing regulatory regions in the context of different minimal promoters. It is important to note that this dichotomy did not apply to the often-used MMTV-Luc reporter, which was coactivated by both SRC-1a and -1e (data not shown), but was found for two 5' regulatory regions involved in regulation of endogenous genes, tyrosine aminotransferase and PNMT. Recent data show that multiple GRE-containing promoters are also highly interesting because DNA binding of GRs for such promoters does not require the dimerization interface localized in the second Zn finger of the GR DNA-binding domain (DBD) (25, 26). We consider the MMTV promoter as atypical, in that it does contain several GR binding sites, but in the context of the DBD dimer mutants does not behave as containing multiple GREs (26, 39). Thus, it is difficult to interpret in terms of the single vs. multiple GRE phenotype that we observed for the other promoters that were tested.
The promoter-specific effects seem to be unrelated to recruitment of the coactivators by the receptors but rather to differences in output of SRC-1a and SRC-1e, once bound to the single or multiple receptor dimers. The preferential coactivation of synergistic transactivation may point to a role of small ubiquitin-like modifier (SUMO)-ylation sites, which have been implicated in synergistic activation via NRs (4), particularly in the MR (40), and which are also present in p160 coactivators (41).
Differential effects of SRC-1a and -1e overexpression was observed in the context of induction of the endogenous PNMT mRNA in neuroscreen cells. Because PNMT is a direct target for GRs, this likely reflects differential action on an endogenous promoter. The decreased rather than increased expression that was observed for both splice variants relative to the no-coactivator condition may be caused by competition between overexpressed SRC-1 and other coactivators that may be preferred by this promoter. However, as hypothesized based on analysis of the GR-responsive fragment of this gene (Fig. 2B
), SRC-1e led to higher PNMT mRNA levels than SRC-1a. Few other endogenous promoters that function as multiple GRE containing are known. Identification of the different types of GRE constellations of corticosteroid-responsive promoters is a relevant challenge for future studies, i.e. to predict those genes for which differential coactivator expression as studied here can bear in vivo relevance.
In most reporter studies, MRs typically stimulate transcription substantially less than GRs at synergizing promoters (3, 42). At the TAT-3 promoter, SRC-1e seemed to coactivate MRs stronger than GRs. This is probably not due to saturation of transactivation for GRs because the hybrid receptor MMG (5) was strongly coactivated despite significantly higher basal transcription levels than GRs (data not shown). The only other experimental setting we are aware of that causes such a pronounced MR-mediated transcriptional synergy is the phenotype observed after the above-mentioned disruption of the DBD dimer interface of the receptor (25). However, when we tested such dimer mutants, they were coactivated in a manner similar to that of wild-type receptors, suggesting distinct mechanisms (data not shown). We would argue that the high transactivation via MRs we observed after overexpression of an endogenous factor may be indicative of cellular settings in which MRs can act, at least at some promoters, more potently than often assumed (irrespective of the agonist that is used).
The specific coactivation of MR AF-1 may contribute to the somewhat larger stimulatory effect of SRC-1e on MRs, when compared with GRs on the TAT-3 reporter. It has been shown earlier to be potentially coactivated via glucocorticoid receptor-interacting protein/SRC-2 (13) and, in a ligand-dependent way, a complex containing CBP and RNA Helicase A (43). Our data also suggest that SRC-1e can interact, directly or indirectly, with the MR N terminus, leading to coactivation of MR AF-1. Our SRC-1-VP16 hybrid data suggest that this interaction depends on SRC-1 amino acids 988-1240 but not on the Q-rich domain (residues 10531123) that has been shown to mediate the interaction between SRCs and the AR N terminus (12) because deletion of this domain did not lead to loss of coactivation. The lack of effect of mutation of the LxxLL motifs in SRC-1 is consistent with SRC-19881240 as the dominant interaction surface between SRC-1 and MR-N terminus (Fig. 5
). The MR AF-1 coactivation did not occur when the SRC-1e AD-1 was deleted, which suggests that recruitment of CBP/p300 mediates the increased transcription activation that was observed.
Ligand-dependent coactivation by p160 SRCs was earlier shown for the vitamin D receptor, which can engage in preferential interaction in SRC-2/glucocorticoid interacting protein-1 (44) but to our knowledge not for splice variants. We saw no differences in coactivation between aldosterone- and corticosterone-activated MRs, despite the fact that these ligands induce different conformations and molecular interactions of the receptor (43, 45). We tested the effect of the SRC-1 splice variants on antagonists action because the ratio of coactivators and corepressors is thought to determine the extent of antagonism/partial agonism of this antagonist (46, 47, 48). Coactivation of RU486-activated GRs by SRC-1a and -1e was reciprocal to that of corticosterone-activated GRs. The potential functional relevance of this finding is underscored by the different dose-response curves for corticosterone in the absence and presence of 107 M RU486: in cells that mainly express SRC-1a [as are present in hypothalamus of the rat brain (23) or to a lesser extent in the pituitary after exposure to elevated concentrations of corticosterone (present study and Fig. 8
)], certain promoters may be less potently transactivated, but RU486 treatment is expected to have relatively little effect in such a setting. This is all the more relevant because RU486 has recently been shown to have powerful antidepressant properties in a group of psychotic depressed patients (49). Regional differences for RU486 action may be part of the mechanism by which this drug acts in a clinical setting.
The observed differential expression of SRC-1a and -1e may have implications for cell-specific effects of corticosteroid and other NRs. Also, the functional differences that we observed in cell lines may also be relevant in the context of differential regulation of SRC-1 splice variant activity by posttranslation modifications. Further relevance of the functional differences between SRC-1 splice variants also depends on whether activity or expression of the splice variants is differentially regulated, i.e. whether the ratio between the variants may change. In pituitary, strong hormonal regulation of SRC-1 mRNA has been reported after estrogen and thyroid hormone treatment (34), but no distinction between splice variants has been made. Our data from the anterior pituitary show that differential regulation of the splice variants can take place. The magnitude of down-regulation of SRC-1e mRNA after modest elevations of circulating plasma corticosterone was 17%. This is similar to what we have observed for total SRC-1 mRNA in estradiol-treated ovariectomized female rats (conform Ref. 27 ; our unpublished data). Whether the splice variant-specific regulation reflects effects at the level of transcription, splicing, or mRNA stability is at present not clear. The data do suggest that the ratio between SRC-1a and -1e may not be a constant in some tissues, which may affect the corticosteroid responsiveness of such cells in a promoter-specific fashion. However, it is not a general phenomenon because we did not observe regulation of SRC-1 mRNA in hippocampus after manipulation of corticosteroid levels. We do not know in which cell type(s) of the pituitary this effect takes place; if in all cell types, then the effect would qualify as modest. We also lack important information at the protein level because there are no splice variant-specific antibodies.
In summary, we have observed a number of functional differences between SRC-1a and SRC-1e in their interactions with GRs and MRs, which involve and may in part explain promoter-, receptor-, and ligand-specific effects. We have also shown that the mRNA abundance of SRC-1a and -1e can be differentially regulated in vivo. It is obvious that other promoter elements and cellular proteins constitute a superimposed context that determines the extent to which the SRC-1a/1e differences become manifest. Further studies should address the mechanisms that cause the functional differences we have seen, e.g. dependence on histone acetylation activity, recruitment of cointegrators CBP/p300, histone methyl transferases, or other factors that finally lead to increased transactivation through modification of histone structure and/or recruitment of transcription machinery (19). A major challenge for future studies is to address the relevance of these effects for the transcriptional regulation of endogenous promoters in relevant target tissues in vivo. This should involve specific manipulation of expression of the splice variants by knockdown methods and the identification of relevant GRE-containing regulatory regions in the genome.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online November 24, 2004
Abbreviations: AD, Activation domain; AF, activation function; CBP, cAMP response element binding protein-binding protein; CMV, cytomegalovirus; DBD, DNA-binding domain; GR, glucocorticoid receptor; GRE, glucocorticoid response element; LBD, ligand-binding domain; LUC, luciferase; MMTV, mouse mammary tumor virus; MR, mineralocorticoid receptor; NR, nuclear receptor; PNMT, phenylethanolamine-N-methyltransferase; PRE, progesterone response element; SRC, steroid receptor coactivator.
Received March 30, 2004.
Accepted for publication November 15, 2004.
| References |
|---|
|
|
|---|
directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751763[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. Yang and M. J Young The mineralocorticoid receptor and its coregulators J. Mol. Endocrinol., August 1, 2009; 43(2): 53 - 64. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lachize, E. M. Apostolakis, S. van der Laan, A. M. I. Tijssen, J. Xu, E. R. de Kloet, and O. C. Meijer Steroid receptor coactivator-1 is necessary for regulation of corticotropin-releasing hormone by chronic stress and glucocorticoids PNAS, May 12, 2009; 106(19): 8038 - 8042. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Fitzsimons, S. Ahmed, C. F. W. Wittevrongel, T. G. Schouten, T. F. Dijkmans, W. J. J. M. Scheenen, M. J. M. Schaaf, E. Ronald de Kloet, and E. Vreugdenhil The Microtubule-Associated Protein Doublecortin-Like Regulates the Transport of the Glucocorticoid Receptor in Neuronal Progenitor Cells Mol. Endocrinol., February 1, 2008; 22(2): 248 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. van der Laan, S. B. Lachize, E. Vreugdenhil, E. R. de Kloet, and O. C. Meijer Nuclear Receptor Coregulators Differentially Modulate Induction and Glucocorticoid Receptor-Mediated Repression of the Corticotropin-Releasing Hormone Gene Endocrinology, February 1, 2008; 149(2): 725 - 732. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Newton and N. S. Holden Separating Transrepression and Transactivation: A Distressing Divorce for the Glucocorticoid Receptor? Mol. Pharmacol., October 1, 2007; 72(4): 799 - 809. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. DeRijk, S. Wust, O. C. Meijer, M.-C. Zennaro, I. S. Federenko, D. H. Hellhammer, G. Giacchetti, E. Vreugdenhil, F. G. Zitman, and E. R. de Kloet A Common Polymorphism in the Mineralocorticoid Receptor Modulates Stress Responsiveness J. Clin. Endocrinol. Metab., December 1, 2006; 91(12): 5083 - 5089. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Baldwin, K.-W. Huh, and K. Munger Human papillomavirus e7 oncoprotein dysregulates steroid receptor coactivator 1 localization and function. J. Virol., July 1, 2006; 80(13): 6669 - 6677. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Winnay, J. Xu, B. W. O'Malley, and G. D. Hammer Steroid Receptor Coactivator-1-Deficient Mice Exhibit Altered Hypothalamic-Pituitary-Adrenal Axis Function Endocrinology, March 1, 2006; 147(3): 1322 - 1332. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Grenier, A. Trousson, A. Chauchereau, J. Cartaud, M. Schumacher, and C. Massaad Differential Recruitment of p160 Coactivators by Glucocorticoid Receptor between Schwann Cells and Astrocytes Mol. Endocrinol., February 1, 2006; 20(2): 254 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Russcher, P. Smit, E. F. C. van Rossum, E. L. T. van den Akker, A. O. Brinkmann, L. J. M. de Heide, F. H. de Jong, J. W. Koper, and S. W. J. Lamberts Strategies for the Characterization of Disorders in Cortisol Sensitivity J. Clin. Endocrinol. Metab., February 1, 2006; 91(2): 694 - 701. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Pascual-Le Tallec and M. Lombes The Mineralocorticoid Receptor: A Journey Exploring Its Diversity and Specificity of Action Mol. Endocrinol., September 1, 2005; 19(9): 2211 - 2221. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |