Endocrinology, doi:10.1210/en.2004-0409
Endocrinology Vol. 146, No. 4 2031-2047
Copyright © 2005 by The Endocrine Society
Regulation of the Estrogen-Inducible Gene Expression Profile by the Breast Cancer Susceptibility Gene BRCA1
Jingwen Xu,
Saijun Fan and
Eliot M. Rosen
Department of Oncology, Lombardi Cancer Center, Georgetown University, Washington, D.C. 20057
Address all correspondence and requests for reprints to: Dr. Eliot M. Rosen, Department of Oncology, Lombardi Cancer Center, Georgetown University, 3970 Reservoir Road Northwest, Box 571469, Washington, D.C. 20057-1469. E-mail: emr36{at}georgetown.edu.
 |
Abstract
|
|---|
The tumor suppressor gene BRCA1 functions in part as a caretaker in preserving the integrity of the genome, but also exhibits tissue-specific function by inhibiting estrogen receptor activity. Because estrogen (E2) induces a wide range of gene expression changes (by nongenomic and several transcriptional pathways), we sought to determine how comprehensive is the BRCA1-mediated inhibition of E2-induced gene expression alterations. Using cDNA-spotted microarrays, we identified a relatively large number of gene expression alterations (both increased and decreased expression) in MCF-7 cells caused by E2, some of which have been reported in previous studies. However, in the presence of exogenous wild-type BRCA1 (wtBRCA1), the response to E2 was severely blunted, with only about 10% the number of gene expression changes as that found in the absence of wtBRCA1. Examples of these findings were confirmed by semiquantitative and quantitative RT-PCR assays. In contrast to wtBRCA1, the induction by E2 of several E2-responsive genes was not inhibited by a full-length tumor-associated mutant BRCA1 protein [T300G (or 61Cys
Gly)]. For three E2-responsive genes whose induction by E2 was inhibited by wtBRCA1, wtBRCA1 had little or no effect on the mRNA half-life in the presence of E2. Consistent with these findings, wtBRCA1 inhibited E2-stimulated proliferation of MCF-7 cells, but wtBRCA1 failed to inhibit the proliferation of MCF-7 cells stimulated by IGF-I. Our findings suggest that BRCA1 globally inhibits the response to estrogen in a dose- and time-dependent fashion. The implications of these findings for understanding how BRCA1 may act to restrain E2 action in vivo are considered.
 |
Introduction
|
|---|
BRCA1 WAS IDENTIFIED as a tumor suppressor gene on human chromosome 17q21, inactivation of which leads to the development of breast and ovarian cancers in women (1). Subsequent studies suggest that members of BRCA1 cancer families have a substantially increased risk for other hormone-responsive tumor types, including cervical and endometrial cancers in women and prostate cancer in men younger than 65 yr of age (2). The role of BRCA1 in hormone-responsive cancer types has been reviewed previously (3).
Some of the tumor suppressor activity of BRCA1 is due to its ability to orchestrate DNA damage responses and to act as a caretaker gene to protect the genome. Thus, BRCA1 is required for several cell cycle checkpoints, including the DNA damage-responsive intra-S and G2/M checkpoints and the G2 decatenation checkpoint (4, 5, 6). BRCA1 also participates in double-strand DNA break repair, homologous recombination, Fanconi-type repair, and other DNA repair pathways, and BRCA1 is a phosphorylation target for the nuclear DNA damage-signaling kinases ATM (ataxia-telangiectasia mutated) and ATR (ATM and Rad3 related) (reviewed in Ref. 7). Although these findings suggest how BRCA1 may function as a tumor suppressor, they do not explain the specific association of BRCA1 mutations with estrogen-responsive tumor types, such as breast cancer. This association is also supported by the finding that prophylactic oophorectomy protects against the development of breast cancer in women with inherited mutations of BRCA1 (8). These conditions suggest that in addition to its role(s) in protecting the genome, BRCA1 has tissue-specific or selective actions.
In this regard, it has been demonstrated that BRCA1 inhibits estrogen (E2)-stimulated estrogen receptor
(ER
) activity (9). This inhibition is due in part to a direct interaction between the BRCA1 and ER
proteins and in part to down-regulation of the expression of a transcriptional coactivator for ER-
, p300 (10, 11, 12). BRCA1 was also found to participate in ligand-independent repression of ER-
(i.e. to prevent activation of the receptor in the absence of E2) (12) and to inhibit the E2-inducible secretion of vascular endothelial growth factor (13). Exogenous BRCA1 inhibited the E2-inducible expression of two endogenous E2-responsive genes, pS2 (trefoil factor) and cathepsin D (10). Both of these genes are regulated by the estrogen receptor through classical estrogen response elements (EREs) in their regulatory regions (14). These studies do not tell us whether BRCA1 inhibits the widespread alterations in gene expression induced by E2, many of which may involve nongenomic mechanisms or transcriptional pathways not dependent upon classical EREs (15, 16).
In this study we used DNA microarray assays to 1) identify the spectrum of gene expression alterations caused by E2 in an estrogen-responsive human breast cancer cell line (MCF-7), and 2) determine whether BRCA1 causes selective or generalized inhibition of E2-induced changes in gene expression.
 |
Materials and Methods
|
|---|
Cell lines and culture
Human breast cancer (MCF-7) cells were originally obtained from American Type Culture Collection (Manassas, VA) and cultured as described previously (10, 11). Cells were grown in DMEM supplemented with 10% (vol/vol) fetal calf serum, L-glutamine (5 mM), nonessential amino acids (5 mM), penicillin (100 U/ml), and streptomycin (100 µg/ml; all obtained from BioWhittaker, Walkersville, MD).
Sources of reagents
17ß-Estradiol (E2) was obtained from Sigma-Aldrich Corp. (St. Louis, MO). Actinomycin D, an inhibitor of transcription used to examine mRNA stability, was purchased from Sigma-Aldrich Corp. The sources of transfection reagents, PCR reagents, and antibodies for Western blotting are provided below.
BRCA1 expression vectors and transfections
The FLAG-tagged wild-type BRCA1 (FLAG-wtBRCA1) expression vector was described previously (17). Cells in 100-mm plastic dishes were transfected overnight (using Lipofectamine, Invitrogen Life Technologies, Inc., Gaithersburg, MD) with FLAG-wtBRCA1 or empty pcDNA3 vector (10 µg plasmid DNA/100-mm dish), washed to remove the excess plasmid and transfection reagent, and allowed to recover for 23 h before exposure to estrogen. The BRCA1-T300G expression vector encodes a cancer-associated point mutant BRCA1 (61Cys
Gly) defective in the RING domain, within the pcDNA3 vector (17). The expression of BRCA1 was confirmed by Western blotting.
E2 treatment
Subconfluent cultures of MCF-7 cells were incubated in serum-free medium (DMEM) for 3 d before exposure to E2. An E2 dose of 1 µM and an exposure time of 24 h were used for the microarray experiments; a dose of 100 nM E2 was used for time-course studies (with exposure times of 324 h).
Isolation of RNA
The total cellular RNA was extracted using TRIzol reagent (Invitrogen Life Technologies, Inc.) according to the manufacturers instructions. The RNA was additionally purified with chloroform and was precipitated using 95% ethanol before cDNA synthesis. The quality of isolated RNA was verified by electrophoresis through 1.0% agarose-formaldehyde gels, and its quantity was determined from absorbance measurements at 260 and 280 nm.
cDNA spotted microarrays
cDNA synthesis and microarray hybridization assay.
One hundred micrograms of total cellular RNA from one of the two cell populations to be compared was annealed to oligo(deoxythymidine) and reverse transcribed in the presence of Cy5 (red dye)-labeled deoxy-UTP (Amersham Biosciences, Piscataway, NJ), using SuperScript II reverse transcriptase (Invitrogen Life Technologies, Inc.). Meanwhile, Cy3-labeled deoxy-UTP (green dye) from the other cell population was prepared. To separate cDNA from RNA, ribonuclease 1 was added in reaction tubes and incubated at 37 C for 10 min. Then, both probes were combined and passed through Microcon filters (Millipore Corp., Bedford, MA). The purified probes were incubated in a prehybridization solution for 1 h. Before hybridization, microarray chip slides were activated by boiling, UV cross-linking, and soaking in 100% ethanol. For human samples, the combined probes were competitively hybridized to microarray slides containing 9216 immobilized human cDNAs [including established sequence tags (ESTs)] with cDNA lengths of 500-5000 bp. The unbound probes were washed off using washing buffers with various concentrations of standard saline citrate/sodium dodecyl sulfate. Human cDNA chips were prepared at the Albert Einstein College of Medicine microarray facility. A detailed description of protocol of cDNA microarray hybridization can be found at the following website: www.aecom.yu.edu/cancer/new/cores/microarray.
Scanning, griding, and analysis.
The microarray slides were placed in a dark box, and the fluorescence intensities of the Cy3 and Cy5 fluorophores were imaged individually. The normalized ratios of the Cy3/Cy5 fluorescence at a given spot on the microarray were used to quantitate the relative abundance of mRNA levels in the two cell populations. The chips were scanned using a GenePix 4000A scanner (Axon Instruments, Union City, CA), and the primary data were analyzed using Genepix 3.02 software. The data were flagged using four default parameters set in the Genepix 3.0 program. Intensity data for both channels were normalized by a local background correction to compensate for variations in the background in different portions of the array. Means and SEs were only calculated for nonflagged genes.
Semiquantitative RT-PCR analysis
Rigorously controlled semiquantitative RT-PCR assays were performed as described previously (17, 18). The PCR primers, reaction conditions, and cycle numbers are shown in Tables 1
and 2
. The PCR conditions and cycle numbers were individually optimized so that each reaction fell within the linear range of product amplification. The first strand cDNA template was generated from 1 µg total RNA in a final volume of 20 µl using SuperScript II reverse transcriptase (Invitrogen Life Technologies, Inc.) and oligo(deoxythymidine) primers. For PCRs, 1 µl (of 20 µl) of 1:2.5 diluted cDNA template was amplified in a total volume of 50 µl containing 200 µM of each of all four deoxy-NTPs, 2 µM of each specific primer, and 1 U Taq DNA polymerase (PerkinElmer, Foster City, CA). ß-Actin, which is not affected by BRCA1, was used as a control for loading. The PCR products were analyzed by electrophoresis through a 1.0% agarose gel containing 0.1 mg/ml ethidium bromide. The gels were photographed under UV illumination.
Quantitative real-time RT-PCR (qRT-PCR) analysis
The RT reaction was carried out using ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA) with standard temperature protocol and 2x SYBR Green PCR Master Mix reagent (Applied Biosystems) in a 20-µl volume in triplicate. A primer optimization step was performed for each set of primers to determine the ideal primer concentrations. After the optimal primer concentrations were determined, 10 ng cDNA samples were used for the PCR and analyzed using the ABI PRISM 7900HT Sequence Detection System. SYBR Green was used as a detector for monitoring the amplified double-stranded DNA fragments. Cycle threshold values were obtained from the ABI PRISM 7900 software, and the fold change was determined. As a control, the mRNA level of the glyceraldehyde-3-phosphate dehydrogenase gene (probes provided) or ß-actin was also determined in the real-time PCR assay for each RNA sample and was used to correct for experimental variations. All PCR amplifications were carried out in a 384-well, clear optical reaction plate with optical adhesive covers (Applied Biosystems).
The sense and antisense primers for these studies were as follows: metallothionein-1F (MT1F): sense, gcaaatgggtcaaggrggta; antisense, aaaggggcgtcaagagaagt; CHL1-like helicase (CHL1): sense, aggatgaaacatgggcatc; antisense, aaaatatccctcccacctgc; von Hippel-Lindau syndrome (VHL): sense, tgaccttctcacctcagcct; antisense, ccttatcctagcctttgggc; and ß-actin: sense, gatgagattggcatggctt; antisense, caccttcaccgttccagttt.
Cell proliferation assays
Subconfluent proliferating MCF-7 cells were seeded into six-well dishes in DMEM containing 2% fetal calf serum (d 1), incubated for 24 h to allow attachment, transfected overnight in serum-free DMEM using Lipofectamine (Invitrogen Life Technologies, Inc.) with wtBRCA1 or empty pcDNA3 vector (2.5 µg plasmid DNA/well in six-well dishes; d 0), washed to remove excess vector and Lipofectamine, and postincubated in DMEM plus 2% fetal calf serum to allow the cells to recover. On d 1, for each transfection condition, vehicle only, 17ß-estradiol (10 nM), 17ß-estradiol (100 nM), or IGF-I (Sigma-Aldrich Corp.; 100 nM) was added to the culture medium. The cells were counted each day in duplicate using a Coulter counter (Beckman Coulter, Fullerton, CA). Each experiment was performed three times to assure reproducibility of the findings.
Western blotting
Preparation of cell lysates and Western blotting procedures have been described previously (10, 11, 19). Equal aliquots of total protein (50 µg/lane) were electrophoresed on a 413% SDS-PAGE gradient gel, transferred to nitrocellulose membranes (Millipore Corp.), and blotted using primary antibodies directed against human BRCA1 (C-20, rabbit polyclonal, Santa Cruz Biotechnology, Inc.; 1:200) and
-actin (I-19, goat polyclonal, Santa Cruz Biotechnology, Inc.; 1:500). After incubation with the appropriate horseradish peroxidase-conjugated secondary antibody (Amersham Biosciences), immune complexes were visualized by using an enhanced chemiluminescence detection system (Amersham Biosciences), with colored markers (Bio-Rad Laboratories, Inc., Hercules, CA) as molecular size standards.
 |
Results
|
|---|
DNA microarray assays to identify effects of BRCA1 on E2-regulated gene expression
We used DNA microarrays to determine the effects of a FLAG-tagged wtBRCA1 on E2-stimulated gene expression in an E2-responsive human breast cancer cell line. The experimental design was as follows. MCF-7 cells were incubated in serum-free medium for 48 h, then transfected overnight with a FLAG-wtBRCA1 expression vector (17), empty pcDNA3 vector, or no vector; washed; allowed to recover for several hours; and postincubated with or without E2 (1 µM, 24 h). The cells were then harvested for RNA extraction, cDNA synthesis, and microarray analysis, as described in Materials and Methods. We performed the following microarray comparisons using cDNA spotted slides containing a total of 9216 annotated genes plus ESTs: 1) (pcDNA3 + E2) vs. (pcDNA3 E2) (E2-stimulated gene expression, pcDNA3 transfected); 2) (control (CON) + E2) vs. (CON E2) (E2-stimulated gene expression, no vector transfected); and 3) (wtBRCA1 + E2) vs. (wtBRCA1 E2) (E2-stimulated gene expression, wtBRCA1 transfected). For each comparison, three independent experiments (separate cell treatments and RNA isolations) were performed. In our experience, cDNA spotted microarrays may underestimate the extent and degree of gene expression changes (18). We used the following filtering criteria based on our experience with regard to the ability to confirm microarray-based findings via independent mRNA analyses. Thus, findings were considered potentially significant if the ratios were 1.5 or greater (increased) and less than 0.75 (decreased) in at least two out of three independent experiments. We found that when these criteria are met, the gene expression changes can be confirmed in more than 80% of the cases by independent mRNA analyses. Although false positives are uncommon, these arrays frequently yield false negative results. Thus, the requirement for significant gene expression changes in all three experiments would be too restrictive, in that it would exclude legitimate gene expression alterations.
The first comparison, (pcDNA3 + E2) vs. (pcDNA3 E2), yielded lists of genes up- or down-regulated by E2 in MCF-7 cells at the 24 h point. Examples of genes whose expression was increased or decreased by E2 are provided in Tables 3
and 4
, respectively. Using the above filtering criteria, we noted a total of 146 genes (excluding ESTs) up-regulated and 73 genes (excluding ESTs) down-regulated by E2. As an additional control for the methodology, we examined gene expression alterations in CON (untransfected) MCF-7 cells treated with E2 (CON+E2) vs. without E2 (CON-E2). Examples of genes up- or down-regulated by E2 in untransfected MCF-7 cells are provided in Tables 5
and 6
, respectively. This experiment revealed a total of 96 genes up-regulated and 80 genes down-regulated, using the criteria described above.
We compared the gene expression changes caused by E2 in pcDNA3-transfected vs. CON cells, and we found significant agreement; at least 26 genes were concordantly up-regulated by E2 in CON and pcDNA3-transfected cells, and at least 18 genes were concordantly down-regulated by E2 in CON and pcDNA3-transfected cells. Genes concordantly regulated by E2 in CON and pcDNA3-transfected cells are indicated by an asterisk in Tables 36



. The lack of more extensive agreement between the two experimental conditions probably simply reflects the high false negative rates of the cDNA spotted microarrays. In support of this explanation, we noted that a large number of genes that were up (or down-)-regulated in cells treated with pcDNA3 with or without E2 in at least two experiments were correspondingly up (or down-)-regulated in CON with or without E2 cells in one experiment and vice versa. Nevertheless, the agreement found suggests that the transfection procedure itself does not abrogate the ability of the cells to respond appropriately to estrogen.
We next compared our lists of E2-regulated genes in MCF-7 cells vs. published lists of E2-regulated genes in cultured cells, mouse tissues, or human breast cancers (i.e. genes differentially expressed in ER-positive vs. ER-negative cancers) (20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36). We found 22 examples of concordant regulation of gene expression (21 increased and one decreased) in our studies vs. other published studies (see Table 7
). (The concordantly regulated genes in our study vs. published studies are indicated by a double asterisk in Tables 36



.) There were also five genes for which we found discordant regulation in our vs. other studies (GATA3, S100P, HMGIY, LDLR, and HSPCA). However, only one of these five examples involved a previous study of MCF-7 cells; the others used human or mouse tissues. These findings indicate that the methodology used in this study has identified a number of known (or suspected) E2-regulated genes. We note here that our literature search may not have been complete, so there may be additional examples of concordance (or discordance) between our studies and those previously completed.
The lists of genes up- or down-regulated by E2 in the presence of exogenous wtBRCA1 were very short. Excluding ESTs, there were a total of 16 genes that were increased and seven genes that were decreased in the DNA microarray experiments (see Table 8
). These numbers correspond to 11% and 10% of the corresponding numbers of genes up-regulated (n = 146) and down-regulated (n = 73), respectively, by E2 in the presence of the empty pcDNA3 vector. Eleven of the 16 genes up-regulated and five of the seven genes down-regulated by E2 in the presence of wtBRCA1 were correspondingly up- and down-regulated by E2 in the presence of pcDNA3 vector. The very small number of genes regulated by E2 in the presence (as opposed to absence) of exogenous wtBRCA1 suggests that overexpression of BRCA1 globally represses E2-induced transcription.
Confirmation of selected microarray findings by independent RNA analyses
We used rigorously controlled semiquantitative RT-PCR analyses to confirm some of the DNA microarray findings. The PCR conditions and cycle numbers were individually adjusted so that each reaction fell within the linear range of product amplification, as described previously (10, 17, 18). We used ß-actin (which is unaffected by BRCA1 or E2) as a control gene. For 11 genes, we confirmed the expected E2-induced changes in gene expression by RT-PCR (illustrated for six genes in Fig. 1
). These included eight genes predicted to be up-regulated by DNA microarrays (CAV1, OLFM1, PIGH, HMOX1, NP, MT1F, CSE1L, and VHL) and three genes predicted to be down-regulated by E2 (AIP, PPP1CC, and EIF4E). Note that most of these genes have not been described previously as E2-regulated genes.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1. Confirmation of E2-stimulated gene expression changes by semiquantitative RT-PCR analysis. Subconfluent MCF-7 cells were incubated in serum-free medium for 3 d, then treated without (CONTROL) or with E2 (100 nM) for 24 h. The cells were harvested for rigorously controlled semiquantitative RT-PCR assays for four genes found to be up-regulated by E2 in microarray assays and two genes found to be down-regulated by E2. ß-Actin, which is unaffected by E2 in our assays, was used as a control gene. The bar graphs at the right show the ratios of mRNA/ß-actin, expressed as a percentage of that for untreated (CONTROL) cells. The full names of the genes corresponding to the gene symbols used in this figure are provided in Table 1 .
|
|
For nine E2-regulated genes identified by DNA microarray assays in this study, we examined the effects of wtBRCA1 (vs. empty pcDNA3 vector) on the ability of E2 to stimulate gene expression in MCF-7 cells. For this purpose, the cells were harvested at different times after the addition of E2 (100 nM; 0, 3, 6, 12, 18, and 24 h); in the microarray studies, a single time point (24 h) was tested. The time course for E2-induced gene expression changes in the cells transfected with pcDNA3 vector and with wtBRCA1 are illustrated for four genes in Figs. 2
and 3
, respectively. In interpreting these results, we noted that at zero time (after an overnight transfection with pcDNA3 or wtBRCA1 vector), the BRCA1 protein levels were higher in wtBRCA1- than in pcDNA3-transfected cells, by about 3-fold (Fig. 4
). However, the BRCA1 mRNA (Fig. 3
) and protein (Fig. 4
) levels continued to rise until 1824 h after the addition of E2 to the culture medium. For genes up-regulated by E2, the mRNA levels in pcDNA3-transfected cells reached a maximum or were nearly maximum by the first time point (3 h) and remained relatively stable between 3 and 24 h (see Fig. 2
). As predicted from the microarray studies, PPP1CC was down-regulated by E2, with the lowest levels reached by 12 h (data not shown).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 2. Time course for estrogen stimulation of gene expression in empty vector (pcDNA3)-transfected cells. Subconfluent cultures of MCF-7 cells were preincubated in serum-free medium for 48 h, transfected overnight with empty pcDNA3 vector (see Materials and Methods), allowed to recover for 23 h, then incubated with E2 (100 nM). At various times from 024 h after the addition of E2, the cultures were harvested for rigorously controlled semiquantitative RT-PCR assays. The ratios of mRNA/ß-actin were determined by densitometry and expressed relative to the 0 h point for each gene studied.
|
|

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 3. Time course for E2 stimulation of gene expression in wtBRCA1-transfected cells. Assays were performed as described in Fig. 2 , except that the cells were transfected with FLAG-wtBRCA1 expression vector.
|
|
For the wtBRCA1-transfected cells, the same time-course studies revealed somewhat unexpected results. Thus, even though the BRCA1 protein levels in wtBRCA1-transfected cells were significantly elevated (
3-fold) compared with those in pcDNA3-transfected cells at 0 h, there was still an initial up-regulation of gene expression in the presence of wtBRCA1 (Fig. 3
). Maximal E2-stimulated gene expression was observed at 36 h. However, instead of reaching a plateau, as in the case of the pcDNA3-transfected cells, the gene expression levels fell approximately back to baseline by 24 h.
To substantiate these findings, we performed similar estrogen time-course experiments in which expression of three E2-induced genes [VHL, MT1F, and CHL1-like helicase (CHL1, also called DDX11)] was measured using qRT-PCR. ß-Actin was used as the control gene, and the mRNA abundance for each gene was expressed relative to the value observed at 0 h. The qRT-PCR results were essentially similar to those from the semiquantitative RT-PCR studies. Results are shown for VHL and MT1F in Fig. 5
; CHL1 gave very similar findings. Thus, in each case, the pcDNA3- plus E2-treated cells showed maximal E2 stimulation of gene expression of about 3- to 4-fold by 36 h, followed by a relatively stable plateau out to 24 h (illustrated for Fig. 5
). In contrast, wtBRCA1- plus E2-treated cells showed an initial induction of gene expression of about 2.5- to 3.5-fold, followed by a gradual reduction to near baseline levels by 24 h. These data emphasize the idea that under the experimental conditions tested, BRCA1 did not block or only slightly attenuated the initial induction of gene expression by E2. However, BRCA1 did inhibit the ability of E2 to cause a sustained induction of gene expression. The significance of these findings is considered further in Discussion.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5. Confirmation of selected findings using qRT-PCR. Subconfluent MCF-7 cells were preincubated in serum-free medium for 48 h, transfected overnight with wtBRCA1 (B and D) or empty pcDNA3 vector (A and C), allowed to recover for 23 h, then incubated with E2 (100 nM). At various times from 024 h after the addition of E2, the cultures were harvested, and qRT-PCR assays were performed to quantitate mRNAs for two E2-inducible genes: VHL (A and B) and MT1F (C and D). See Materials and Methods for details. The mRNA values were corrected for differences in levels of the control gene (ß-actin) and normalized to 0 h. The values plotted represent the mean ± SEM of three independent experiments. qRT-PCR experiments for a third E2-inducible gene, CHL1 (also called DDX11), yielded similar results.
|
|
Mutant BRCA1 fails to inhibit E2-stimulated gene expression
To evaluate the specificity of these findings, we compared the ability of wtBRCA1 vs. that of a full-length cancer-associated point mutant BRCA1 (T300G) to inhibit E2-induced expressed of the same three genes (VHL, CHL1, and MT1F). BRCA1-T300G encodes a mutation within the amino-terminus of BRCA1 (61Cys
Gly) that disrupts the RING finger domain and results in a functionally defective protein (17). Here, mRNA expression was determined using rigorously controlled semiquantitative RT-PCR and densitometry. For each of the three genes, BRCA1-T300G failed to block E2-stimulated gene expression, whereas wtBRCA1 strongly inhibited gene expression between 36 and 24 h, as observed previously (illustrated for VHL in Fig. 6
, A and B). In fact, E2-induced gene expression in cells transfected with BRCA1-T300G was similar to that observed in cells transfected with empty pcDNA3 vector. As a control, the Western blot in Fig. 6C
confirms that the BRCA1-T300G protein was well expressed.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 6. Effect of mutant BRCA1 (T300G) on E2-stimulated gene expression. Experiments were performed exactly as described in previous figures, except that the cells were transfected with BRCA1-T300G, wtBRCA1 (positive control), or pcDNA3 vector (negative control). E2-induced expression of VHL1 was assessed by semiquantitative RT-PCR and quantitated by densitometry. A, Representative RT-PCR assays. B, mRNA abundance relative to 0 h. Values are the mean ± SEM for three independent experiments. C, Western blots for BRCA1 for cells transfected with BRCA1-T300G, wtBRCA1, or empty pcDNA3 vector and treated as in A. Similar results were obtained for two other E2-inducible genes, CHL1 and MT1F.
|
|
Effect of BRCA1 on half-life of E2-induced mRNA transcripts
To determine whether the ability of BRCA1 to block the sustained induction of E2-inducible genes was due to an alteration of mRNA half-life, we performed similar E2 time-course studies in the absence vs. the presence of actinomycin D (AMD), an inhibitor of transcription. Typically, the mRNA half-life is determined in the presence of 510 µg/ml AMD, which is sufficient to abrogate new gene transcription (37, 38, 39). MCF-7 cells were transfected overnight with wtBRCA1 or empty pcDNA3 vector, exposed to E2 (100 nM) plus AMD (10 µg/ml) for different times up to 24 h, and harvested for qRT-PCR analysis of VHL (Fig. 7A
) and MT1F (Fig. 7B
). A third gene (CHL1) was also studied (data not shown). In each case, a semilogarithmic plot of mRNA abundance (relative to that at time zero, when AMD was added) yielded roughly a straight line, allowing estimation of the mRNA half-life (t1/2). In E2-treated MCF-7 cells, the half-lives of these three genes were very similar in cells transfected with pcDNA3 vs. wtBRCA1: VHL t1/2 = 5.1 vs. 4.7 h, MT1F t1/2 = 6 vs. 6.8, and CHL1 t1/2 = 7 vs. 6.5 h, respectively. Based on these findings, it is unlikely that wtBRCA1-mediated alterations in the mRNA expression of these three genes in E2-treated cells are due primarily to changes in the mRNA half-lives.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7. Effect of wtBRCA1 on mRNA half-life of E2-induced transcripts. Subconfluent proliferating MCF-7 cells were transfected overnight with either empty pcDNA3 vector or wtBRCA1, washed, allowed to recover for 23 h, then incubated with E2 (100 nM) in the presence of AMD (10 µg/ml), an inhibitor of RNA synthesis. At various times from 024 h after the addition of E2 plus AMD, the cultures were harvested for qRT-PCR assays to measure the levels of VHL (A) and MT1F (B). The mRNA abundance for each gene was normalized to the value at 0 h. The assays were standardized by isolating RNA from the same number of cells for each assay condition and time point. The values plotted in the graphs are the mean ± SEM of three independent experiments (i.e. separate cell treatments and RT-PCR determinations). The mRNA half-lives were calculated from the slope of the best straight line fit for the AMD-treated cells. See text for mRNA half-life values.
|
|
Effect of BRCA1 on the cell growth rate of MCF-7 cells
In this study we tested the effect of wtBRCA1 on the response of MCF-7 cells to two different mitogenic stimuli: E2 (10 or 100 nM) and IGF-I (100 nM), a well established mitogen for MCF-7 cells (40, 41, 42). Briefly, the cells were transfected overnight with wtBRCA1 or empty pcDNA3 vector (on d 0), washed, postincubated for 24 h to allow the cells to recover, and incubated in low serum (2%) medium with or without 10 or 100 nM E2 or IGF-I (100 nM; starting on d 1). The cell growth responses are shown in Fig. 8
, AC, respectively. Although the cells continued to grow in medium containing 2% serum, there was no difference in the growth rates between wtBRCA1 vs. pcDNA3-transfected cells in the absence of an additional mitogen. In pcDNA3-transfected cells, the addition of mitogens E2 and IGF-I caused a significant increase in cell counts (1.7- to 2.5-fold) by d 4 and 5. For wtBRCA1-transfected cells, E2 (10 or 100 nM) gave a smaller stimulation or no stimulation of growth by d 45 (Fig. 8
, A and B). In contrast, transfection of wtBRCA1 had no effect on the ability of IGF-1 to stimulate MCF-7 cell growth (Fig. 8C
). These findings suggest that BRCA1 inhibits E2-stimulated, but not IGF-I-stimulated, proliferation of MCF-7 cells.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 8. Effects of E2 and IGF-I on MCF-7 cell proliferation. MCF-7 cells were seeded into six-well dishes in DMEM containing 2% fetal calf serum (d 1), postincubated for 24 h, transfected overnight using Lipofectamine with wtBRCA1 or empty pcDNA3 vector (2.5 µg plasmid DNA/well in six-well dishes; d 0), and postincubated in DMEM plus 2% fetal calf serum to allow the cells to recover. For each transfection condition, the following were added to the culture medium: 10 (A) or 100 (B) nM E2 or 100 nM IGF-I (C; d 1). The cells were counted each day in duplicate using a Coulter counter. Cell counts are expressed relative to the values obtained on d 0. The data shown are representative of three independent experiments, which showed similar results.
|
|
BRCA1-regulated gene expression in MCF-7 cells
Although it was not the primary purpose of this study, we made several additional comparisons (wtBRCA1 vs. pcDNA3; wtBRCA1 plus E2 vs. pcDNA3 plus E2) to identify genes regulated by exogenous BRCA1 in MCF-7 cells in the absence or presence of E2. The numbers of genes up- and down-regulated in these comparisons (using the same filtering criteria and excluding ESTs as before) are provided in Table 8
. Interestingly, more than 4 times as many genes were induced by wtBRCA1 in the presence of E2 (n = 315) as were induced by wtBRCA1 in the absence of E2 (n = 70). This difference might simply be due to random factors related to the microarray methodology. However, we considered an additional possibility. The comparison of wtBRCA1/pcDNA3 (no E2) reflects BRCA1-regulated gene expression, but the comparison (wtBRCA1 plus E2/pcDNA3 plus E2) may not only reflect BRCA1-regulated gene expression but also, in part, E2-regulated gene expression for the following reason. Under the wtBRCA1 plus E2 condition, E2-induced gene expression is inhibited due to BRCA1 overexpression, whereas it is not inhibited under the pcDNA3 plus E2 condition. Thus, some of the genes up-regulated in the wtBRCA1 plus E2 vs. pcDNA3 plus E2 comparison could reflect genes down-regulated by E2 and vice versa. In comparing these gene lists, we found 18 genes up-regulated by wtBRCA1 plus E2 (relative to pcDNA3 plus E2), but down-regulated by E2 (Tables 4
and 6
) and nine genes down-regulated by wtBRCA1 plus E2, but up-regulated by E2 (Tables 3
and 5
).
 |
Discussion
|
|---|
We found that E2 caused a large number of alterations (both up- and down-regulation) in gene expression in E2-responsive MCF-7 breast cancer cells. A number of these alterations have been reported previously in cells or tissues exposed to E2, although most of the changes have not been described. In contrast, in the presence of an exogenous wtBRCA1 gene, very few changes in gene expression (
11% of the number of gene expression changes found in the absence of wtBRCA1) were observed. These findings suggest that wtBRCA1 blocks a broad spectrum of E2-induced gene expression changes, not a few selected ERE-containing genes.
One caveat, however, is that because we used a single time point of 24-h exposure to E2 for the microarray assays, the inhibition of some gene expression changes that occur later during the time course may have been secondary to a smaller number of changes that occurred at early time points (e.g. the induction of transcription factors by E2). In this regard, it was noted that wtBRCA1 inhibited the E2-induced expression of three genes (GRO2, APR, and GCLM) previously reported to be induced very rapidly (40 min) by E2 in a manner dependent upon phosphatidylinositol-3'-kinase (34).
We confirmed a number of the E2-induced gene expression changes and the ability of BRCA1 to block these changes by semiquantitative RT-PCR assays; for three genes (VHL, MT1F, and CHL1), we confirmed these patterns of E2-induced gene expression and its inhibition by BRCA1, using qRT-PCR. Similar results were obtained based on densitometric quantitation of semiquantitative RT-PCR assays and qRT-PCR. Among the E2-inducible genes studied, E2-induced mRNA expression was observed at the earliest time point (3 h), and mRNA levels remained high at the latest time (24 h). Prior transfection with wtBRCA1 did not prevent the initial spike of gene expression, but caused a time-dependent reduction of mRNA levels between 36 h and 24 h. This finding may have at least two explanations: 1) BRCA1 does not prevent the initial round(s) of E2-induced gene transcription, but blocks the ability to sustain increased transcription; and/or 2) the ability of BRCA1 to inhibit E2-induced gene expression is dose dependent for BRCA1. Although BRCA1 protein levels were increased by the time E2 was added (0 h; by
3-fold), they continued to rise for the next 18 h. Thus, time-dependent increases in BRCA1 protein levels might have contributed to the initial spike and subsequent decline in the mRNA levels of E2-induced genes. It is also possible that the BRCA1-mediated inhibition of E2-inducible gene expression may require high enough BRCA1 protein levels (>3-fold) to exert an effect over a sufficient period of time (>6 h; i.e. the effects of BRCA1 are both dose and time dependent).
This pattern may have relevance to the in vivo regulation of E2 action by BRCA1. Thus, in the absence of E2, resting (quiescent) mammary epithelial cells show very low levels of BRCA1 (43). When the cells are stimulated by E2 to enter the cell cycle and proliferate, BRCA1 levels are increased at least in part due to cell cycle-dependent up-regulation of BRCA1 due to entry into S phase (43, 44, 45). In this study, there is a significant delay in the up-regulation of BRCA1 expression during which E2-stimulated gene expression is presumably unopposed. The subsequent induction of BRCA1 may serve to restrain the action of E2 by preventing the persistent activation of ER
. The actually dynamics of BRCA1 expression are probably more complex than simple regulation by the cell cycle, because both in vitro and in vivo studies suggest a very strong up-regulation of BRCA1 expression during mammary cell differentiation, e.g. during puberty and pregnancy (43, 46, 47). In vitro, the induction of differentiation by a hormonal cocktail caused a very marked increase in BRCA1 levels (43, 48). Thus, the sustained high levels of BRCA1 (analogous to exposure to exogenous wtBRCA1) may contribute to mammary differentiation at least in part by blocking the mitogenic effects of E2 by rendering the cells refractory to E2-induced gene expression. Nevertheless, our findings do not rule out the possibility that a small percentage of genes (
10% or so) are still induced by E2, even in the face of high levels of BRCA1.
Whereas wtBRCA1 blocked the sustained induction of expression of VHL, MT1F, and CHL1 by E2, a breast cancer-associated mutant BRCA1 protein, T300G (or 61Cys
Gly), which harbors an inactivating point mutation of the amino-terminal RING finger domain (1, 49, 50), failed to inhibit the E2-stimulated expression of these three genes. Previously, we showed that the exogenous T300G mutant BRCA1 protein, although well expressed, failed to 1) inhibit E2-stimulated activation of an E2-responsive reporter (ERE-TK-Luc), 2) repress expression of the coactivator p300, 3) mediate DNA damage responses like wtBRCA1, and 4) inhibit telomerase activity like wtBRCA1 (10, 11, 17, 51). The inability of the T300G mutant to block E2-stimulated expression of CHL1, VHL, and MT1F is consistent with our previous findings and suggests that the wtBRCA1 inhibition of these responses is not a nonspecific action.
Although much research has focused on the liganded ER
to stimulate gene transcription through the ERE and through mechanisms that do not involve a classic ERE, E2 can also enhance gene expression by increasing mRNA stability (i.e. increasing the half-life) of E2-inducible transcripts (52, 53, 54, 55). Thus, theoretically, BRCA1 could inhibit E2-inducible gene expression in part by inhibiting an E2-induced increase in mRNA half-life. In this study, measurements of mRNA half-life in E2-treated MCF-7 cells using qRT-PCR failed to disclose significant differences in the half-lives of VHL, MT1F, or CHL1 in wtBRCA1 vs. pcDNA3-transfected cells. These findings indicate that BRCA1 does not significantly alter the mRNA stability of these three E2-induced transcripts, and they suggest that the primary effect of BRCA1 is to inhibit E2-stimulated transcription of these genes. However, our findings do not rule out the possibility that wtBRCA1 alters the half-lives of a subset of E2-inducible genes on the list of genes whose induction by E2 was inhibited by wtBRCA1 in this study.
Previously, we reported that exogenous wtBRCA1 has a relatively small effect on the in vitro proliferation rates of human cancer cell lines (17, 19). Thus, clones of DU-145 human prostate cancer cells stably expressing wtBRCA1 showed only a small increase in doubling time compared with empty vector (Neo) control clones or untransfected parental cells [doubling time, 22 h (wtBRCA1) vs. 20 h (control cells)]. DU-145 cells containing wtBRCA1 under control of a tetracycline-regulated promoter system showed similar long-term growth characteristics in the presence (wtBRCA1 gene off) vs. absence (wtBRCA1 gene on) of tetracycline (51). These findings suggest that in standard growth medium (containing 5% fetal calf serum), BRCA1 overexpression does not have a large effect on cell proliferation. Consistent with the ability of BRCA1 to inhibit E2-stimulated gene expression, we found that in low serum (2%) medium, wtBRCA1 inhibited E2-stimulated cell proliferation, but had little or no effect on the basal rate of cell proliferation. Although wtBRCA1 blocked most of the E2 (10 or 100 nM)-stimulated cell growth, it was not 100% efficient in blocking E2-stimulable growth. The latter may reflect some or all of the following factors: 1) a residual effect of E2 not countered by BRCA1, 2) inability of BRCA1 to block the initial effects of E2 (consistent with the gene expression studies), and/or 3) lowering of BRCA1 protein levels over the 5-d course of the experiment. In contrast to E2, wtBRCA1 had little or no effect on the proliferative response to IGF-I, a well established mitogen for MCF-7 cells (40, 41, 42). These findings suggest that overexpression of BRCA1 may selectively inhibit certain mitogenic pathways and not others.
In summary, our findings suggest that BRCA1 globally represses ER
activity, including its ability to stimulate gene expression through the ERE and other transcriptional mechanisms. BRCA1 may also inhibit the very rapid induction of gene expression by E2 mediated through phosphatidylinositol-3-kinase and other mechanisms, although this remains to be proven.
 |
Footnotes
|
|---|
This work was supported in part by United States Public Health Service Grants R01-CA-80000, R01-CA-82599, and R01-ES-09169; grants from the Susan G. Komen Breast Cancer Foundation (BASIC99-003255 and BCTR0201295); and a grant from the U.S. Army Breast Cancer Research Program (DAMD17-99-1-9254).
First Published Online January 6, 2005
Abbreviations: AMD, Actinomycin D; CHL1, CHL1-like helicase; CON, control; E2, estrogen, 17ß-estradiol; ER, estrogen receptor; ERE, estrogen response element; EST, established sequence tag; MT1F, metallothionein-1F; qRT-PCR, quantitative real-time RT-PCR; VHL, von Hippel-Lindau syndrome; wt, wild-type.
Received March 30, 2004.
Accepted for publication December 30, 2004.
 |
References
|
|---|
- Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q, Cichran C, Bennett LM, Ding W, Bell R, Rosenthal J, Hussey C, Tran T, McClure M, Frye C, Hattier T, Phelps R, Haugen-Strano A, Katcher H, Yakumo K, Gholami Z, Shaffer D, Stone S, Bayer S, Wray C, Bogden R, Dayananth P, Ward J, Tonin P, Narod S, Bristow PK, Norris FH, Helvering L, Morrison P, Rosteck P, Lai M, Barrett JC, Lewis C, Neahausen S, Cannon-Albright L, Goldgar D, Wiseman R, Kamb A, Skolnick MH 1994 A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266:6671[Abstract/Free Full Text]
- Thompson D, Easton DF, Breast Cancer Linkage Consortium 2002 Cancer incidence in BRCA1 mutation carriers. J Natl Cancer Inst 94:13581365[Abstract/Free Full Text]
- Rosen EM, Fan S, Pestell RG, Goldberg ID 2003 BRCA1 in hormone-responsive cancers. Trends Endocrinol Metab 14:378385[CrossRef][Medline]
- Huber LJ, Yang TW, Sarkisian CJ, Master SR, Deng CX, Chodosh LA 2001 Impaired DNA damage response in cells expressing an exon 11-deleted murine Brca1 variant that localizes to nuclear foci. Mol Cell Biol 21:40054015[Abstract/Free Full Text]
- Xu B, Kim St, Kastan MB 2001 Involvement of Brca1 in S-phase and G2-phase checkpoints after ionizing irradiation. Mol Cell Biol 21:34453450[Abstract/Free Full Text]
- Deming PB, Cistulli CA, Zhao H, Graves PR, Piwnica-Worms H, Paules RS, Downes CS, Kaufmann WK 2001 The human decatenation checkpoint. Proc Natl Acad Sci USA 98:1204412049[Abstract/Free Full Text]
- Rosen EM, Fan S, Pestell RG, Goldberg ID 2003 The BRCA1 gene in breast cancer. J Cell Physiol 196:1941[CrossRef][Medline]
- Kauff ND, Satagopan JM, Robson ME, Scheuer L, Hensley M, Hudis CA, Ellis NA, Boyd J, Borgen PI, Barakat RR, Norton L, Castiel M, Nafa K, Offit K 2002 Risk-reducing salpingo-oophorectomy in women with a BRCA1 or BRCA2 mutation. N Engl J Med 346:16091615[Abstract/Free Full Text]
- Fan S, Wang J-A, Meng Q, Yuan R-Q, Ma YX, Erdos MR, Pestell RG, Yuan F, Auborn KJ, Goldberg ID, Rosen EM 1999 BRCA1 inhibits estrogen receptor signaling in transfected cells. Science 284:13541356[Abstract/Free Full Text]
- Fan S, Wang J-A, Ma YX, Yuan R-Q, Meng Q, Erdos MR, Pestell RG, Goldberg ID, Rosen EM 2001 Role of direct interaction in BRCA1 inhibition of estrogen receptor activity. Oncogene 20:7787[CrossRef][Medline]
- Fan S, Ma YX, Wang C, Yuan RQ, Meng Q, Wang JA, Erdos M, Goldberg ID, Webb P, Kushner PJ, Pestell RG, Rosen EM 2002 p300 Modulates the BRCA1 inhibition of estrogen receptor activity. Cancer Res 62:141151[Abstract/Free Full Text]
- Kawai H, Li H, Chun P, Avraham S, Avraham HK 2002 Direct interaction between BRCA1 and the estrogen receptor regulates vascular endothelial growth factor (VEGF) transcription and secretion in breast cancer cells. Oncogene 21:77307739[CrossRef][Medline]
- Zheng L, Annab LA, Afshari CA, Lee WH, Boyer TG 2001 BRCA1 mediates ligand-independent transcriptional repression of the estrogen receptor. Proc Natl Acad Sci USA 98:95879592[Abstract/Free Full Text]
- Hyder SM, Chiappetta C, Stancel GM 1999 Interaction of human estrogen receptors
and ß with the same naturally occurring estrogen response elements. Biochem Pharmacol 57:597601[CrossRef][Medline]
- Kushner PJ, Agard D, Feng WJ, Lopez G, Schiau A, Uht R, Webb P, Greene G 2000 Oestrogen receptor function at classical and alternative response elements. Novartis Found Symp 230:2040[Medline]
- Kelly MJ, Levin ER 2001 Rapid actions of plasma membrane estrogen receptors. Trends Endocrinol Metab 12:152156[CrossRef][Medline]
- Fan S, Yuan R-Q, MA Y-X, Meng Q, Goldberg ID, Rosen EM 2001 Mutant BRCA1 genes antagonize phenotype of wild-type BRCA1. Oncogene 20:82158235[CrossRef][Medline]
- Yuan R, Fan S, Achary M, Stewart DM, Goldberg ID, Rosen EM 2001 Altered gene expression pattern in cultured human breast cancer cells treated with hepatocyte growth 2factor/scatter factor in the setting of DNA damage. Cancer Res 61:80228031[Abstract/Free Full Text]
- Fan S, Wang J-A, Yuan R-Q, Ma YX, Meng Q, Goldberg ID, Rosen EM 1998 BRCA1 as a human prostate tumor suppressor: modulation of proliferation, damage responses, and expression of regulatory proteins. Oncogene 16:30693083[CrossRef][Medline]
- Watanabe H, Suzuki A, Kobayashi M, Lubahn DB, Handa H, Iguchi T 2003 Similarities and differences in uterine gene expression patterns caused by treatment with physiological and non-physiological estrogens. J Mol Endocrinol 31:487497[Abstract]
- Wang DY, Fulthorpe R, Liss SN, Edwards EA 2004 Identification of estrogen responsive genes by cDNA microarray and characterization of a novel early estrogen-induced gene: EEIG1. Mol Endocrinol 18:402411[Abstract/Free Full Text]
- Rodrigo MC, Martin DS, Eyster KM 2003 Vascular ECE-1 mRNA expression decreases in response to estrogens. Life Sci 73:29732983[CrossRef][Medline]
- Monroe DG, Getz BJ, Johnsen SA, Riggs BL, Khosla S, Spelsberg TC 2003 Estrogen receptor isoform-specific regulation of endogenous gene expression in human osteoblastic cell lines expressing either ER
or ERß. J Cell Biochem 90:315326[CrossRef][Medline]
- Frasor J, Danes JM, Komm B, Chang KC, Lyttle CR, Katzenellenbogen BS 2003 Profiling of estrogen up- and down-regulated gene expression in human breast cancer cells: insights into gene networks and pathways underlying estrogenic control of proliferation and cell phenotype. Endocrinology 144:45624574[Abstract/Free Full Text]
- Hewitt SC, Deroo BJ, Hansen K, Collins J, Grissom S, Afshari CA, Korach KS 2003 Estrogen receptor-dependent genomic responses in the uterus mirror the biphasic physiological response to estrogen. Mol Endocrinol 17:20702083[Abstract/Free Full Text]
- Watanabe H, Suzuki A, Kobayashi M, Takahashi E, Itamoto M, Lubahn DB, Handa H, Iguchi T 2003 Analysis of temporal changes in the expression of estrogen-regulated genes in the uterus. J Mol Endocrinol 30:347358[Abstract]
- Lindberg MK, Moverare S, Eriksson AL, Skrtic S, Gao H, Dahlman-Wright K, Gustafsson JA, Ohlsson C 2002 Identification of estrogen-regulated genes of potential importance for the regulation of trabecular bone mineral density. J Bone Miner Res 17:21832195[CrossRef][Medline]
- Bouras T, Southey MC, Chang AC, Reddel RR, Willhite D, Glynne R, Henderson MA, Armes JE, Venter DJ 2002 Stanniocalcin 2 is an estrogen-responsive gene coexpressed with the estrogen receptor in human breast cancer. Cancer Res 62:12891295[Abstract/Free Full Text]
- Gruvberger S, Ringner M, Chen Y, Panavally S, Saal LH, Borg A, Ferno M, Peterson C, Meltzer PS 2001 Estrogen receptor status in breast cancer is associated with remarkably distinct gene expression patterns. Cancer Res 61:59795984[Abstract/Free Full Text]
- West M, Blanchette C, Dressman H, Huang E, Ishida S, Spang R, Zuzan H, Olson Jr JA, Marks JR, Nevins JR 2001 Predicting the clinical status of human breast cancer by using gene expression profiles. Proc Natl Acad Sci USA 98:1146211467[Abstract/Free Full Text]
- Inadera H, Hashimoto S, Dong HY, Suzuki T, Nagai S, Yamashita T, Toyoda N, Matsushima K 2000 WISP-2 as a novel estrogen-responsive gene in human breast cancer cells. Biochem Biophys Res Commun 275:108114[CrossRef][Medline]
- Seth P, Krop I, Porter D, Polyak K 2002 Novel estrogen and tamoxifen induced genes identified by SAGE (serial analysis of gene expression). Oncogene 21:836843[CrossRef][Medline]
- Charpentier AH, Bednarek AK, Daniel RL, Hawkins KA, Laflin KJ, Gaddis S, MacLeod MC, Aldaz CM 2000 Effects of estrogen on global gene expression: identification of novel +targets of estrogen action. Cancer Res 60:59775783[Abstract/Free Full Text]
- Pedram A, Razandi M, Aitkenhead M, Hughes CC, Levin ER 2002 Integration of the non-genomic and genomic actions of estrogen. Membrane-initiated signaling by steroid to transcription and cell biology. J Biol Chem 277:5076850775[Abstract/Free Full Text]
- Pentecost BT 1998 Expression and estrogen regulation of the HEM45 mRNA in human tumor lines and in the rat uterus. J Steroid Biochem Mol Biol 64:2533[CrossRef][Medline]
- Musso R, Maggi A, Eva C 2000 17ß-Estradiol stimulates mouse neuropeptide Y-Y1 receptor gene transcription by binding to estrogen receptor
in neuroblastoma cells. Neuroendocrinology 72:360367[CrossRef][Medline]
- Grosjean S, Devaux Y, Seguin C, Meistelman C, Zannad F, Mertes PM, Kelly RA, Ungureanu-Longrois D 2001 Retinoic acid attenuates inducible nitric oxide synthase (NOS2) activation in cultured rat cardiac myocytes and microvascular endothelial cells. J Mol Cell Cardiol 33:933945[CrossRef][Medline]
- Chambers SK, Kacinski BM 1994 Messenger RNA decay of macrophage colony-stimulating factor in human ovarian carcinomas in vitro. J Soc Gynecol Invest 1:310316[Medline]
- Pasleau F, Grooteclaes M, Gol-Winkler R 1993 Expression of the c-erbB2 gene in the BT474 human mammary tumor cell line: measurement of c-erbB2 mRNA half-life. Oncogene 8:849854[Medline]
- Cossette LJ, Gaumond I, Martinoli MG 2002 Combined effect of xenoestrogens and growth factors in two estrogen-responsive cell lines. Endocrinology 18:303308
- Varma H, Conrad SE 2002 Antiestrogen ICI 182,780 decreases proliferation of insulin-like growth factor I (IGF-I)-treated MCF-7 cells without inhibiting IGF-I signaling. Cancer Res 62:39853991[Abstract/Free Full Text]
- Dupont J, Karas M, LeRoith D 2003 The cyclin-dependent kinase inhibitor p21CIP/WAF is a positive regulator of insulin-like growth factor I-induced cell proliferation in MCF-7 human breast cancer cells. J Biol Chem 278:3725637264[Abstract/Free Full Text]
- Rajan JV, Wang M, Marquis ST, Chodosh LA 1996 Brca2 is coordinately regulated with Brca1 during proliferation and differentiation in mammary epithelial cells. Proc Natl Acad Sci USA 93:1307813083[Abstract/Free Full Text]
- Marks JR, Huper G, Vaughn JP, Davis PL, Norris J, McDonnell DP, Wiseman RW, Futreal PA, Iglehart JD 1997 BRCA1 expression is not directly responsive to estrogen. Oncogene 14:115121[CrossRef][Medline]
- Gudas JM, Li T, Nguyen H, Jensen D, Rauscher III FJ, Cowan KH 1996 Cell cycle regulation of BRCA1 messenger RNA in human breast epithelial cells. Cell Growth Differ 7:717723[Abstract]
- Lane TF, Deng C, Elson A, Lyu MS, Kozak CA, Leder P 1995 Expression of Brca1 is associated with terminal differentiation of ectodermally and mesodermally derived tissues in mice. Genes Dev 9:27122722[Abstract/Free Full Text]
- Rajan JV, Marquis ST, Gardner HP, Chodosh LA 1997 Developmental expression of Brca2 colocalizes with Brca1 and is associated with proliferation and differentiation in multiple tissues. Dev Biol 184:385401[CrossRef][Medline]
- Kubista M, Rosner M, Kubista E, Bernaschek G, Hengstschlager M 2002 Brca1 regulates in vitro differentiation of mammary epithelial cells. Oncogene 21:47474756[CrossRef][Medline]
- Skasko E, Paszko Z, Niwinska A, Kwiatkowska E, Kruczek A, Pienkowski T 2004 The presence of hereditary BRCA1 gene mutations in women with familial breast or ovarian cancer and the frequency of occurrence of these tumours in their relatives. Eur J Gynaecol Oncol 25:470474[Medline]
- Brzovic PS, Meza J, King MC, Klevit RE 1998 The cancer-predisposing mutation C61G disrupts homodimer formation in the NH2-terminal BRCA1 RING finger domain. J Biol Chem 273:77957799[Abstract/Free Full Text]
- Xiong J, Fan S, Meng Q, Schramm L, Wang C, Bouzahza B, Zhou J, Zafonte B, Goldberg ID, Haddad BR, Pestell RG, Rosen EM 2003 BRCA1 inhibition of telomerase activity in cultured cells. Mol Cell Biol 23:86688690[Abstract/Free Full Text]
- Qulali M, Crabb DW 1992 Estradiol regulates class I alcohol dehydrogenase gene expression in renal medulla of male rats by a post-transcriptional mechanism. Arch Biochem Biophys 297:277284[CrossRef][Medline]
- Gudas JM, Klein RC, Oka M, Cowan KH 1995 Posttranscriptional regulation of the c-myb proto-oncogene in estrogen receptor-positive breast cancer cells. Clin Cancer Res 1:235243[Abstract]
- Arao Y, Yamamoto E, Miyatake N, Ninomiya Y, Umehara T, Kawashima H, Masushige S, Hasegawa T, Kato S 1996 A synthetic oestrogen antagonist, tamoxifen, inhibits oestrogen-induced transcriptional, but not post-transcriptional, regulation of gene expression. Biochem J 313:269274
- Arao Y, Kikuchi A, Ikeda K, Nomoto S, Horiguchi H, Kayama F 2002 A+U-rich-element RNA-binding factor 1/heterogeneous nuclear ribonucleoprotein D gene expression is regulated by oestrogenin the rat uterus. Biochem J 361:125132[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
K. A. Thasni, S. Rakesh, G. Rojini, T. Ratheeshkumar, G. Srinivas, and S. Priya
Estrogen-dependent cell signaling and apoptosis in BRCA1-blocked BG1 ovarian cancer cells in response to plumbagin and other chemotherapeutic agents
Ann. Onc.,
April 1, 2008;
19(4):
696 - 705.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ma, C. Hu, A. T. Riegel, S. Fan, and E. M. Rosen
Growth Factor Signaling Pathways Modulate BRCA1 Repression of Estrogen Receptor-{alpha} Activity
Mol. Endocrinol.,
August 1, 2007;
21(8):
1905 - 1923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Silva and M. A. Shupnik
Integration of Steroid and Growth Factor Pathways in Breast Cancer: Focus on Signal Transducers and Activators of Transcription and Their Potential Role in Resistance
Mol. Endocrinol.,
July 1, 2007;
21(7):
1499 - 1512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lu, A. Amleh, J. Sun, X. Jin, S. D. McCullough, R. Baer, D. Ren, R. Li, and Y. Hu
Ubiquitination and Proteasome-Mediated Degradation of BRCA1 and BARD1 during Steroidogenesis in Human Ovarian Granulosa Cells
Mol. Endocrinol.,
March 1, 2007;
21(3):
651 - 663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C L Wilson, A H Sims, A Howell, C J Miller, and R B Clarke
Effects of oestrogen on gene expression in epithelium and stroma of normal human breast tissue.
Endocr. Relat. Cancer,
June 1, 2006;
13(2):
617 - 628.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. J. Kang, H. J. Kim, J.-K. Rih, T. L. Mattson, K. W. Kim, C.-H. Cho, J. S. Isaacs, and I. Bae
BRCA1 Plays a Role in the Hypoxic Response by Regulating HIF-1{alpha} Stability and by Modulating Vascular Endothelial Growth Factor Expression
J. Biol. Chem.,
May 12, 2006;
281(19):
13047 - 13056.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ma, P. Katiyar, L. P. Jones, S. Fan, Y. Zhang, P. A. Furth, and E. M. Rosen
The Breast Cancer Susceptibility Gene BRCA1 Regulates Progesterone Receptor Signaling in Mammary Epithelial Cells
Mol. Endocrinol.,
January 1, 2006;
20(1):
14 - 34.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, S. Fan, Q. Meng, Y. Ma, P. Katiyar, R. Schlegel, and E. M. Rosen
BRCA1 Interaction with Human Papillomavirus Oncoproteins
J. Biol. Chem.,
September 30, 2005;
280(39):
33165 - 33177.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Wang, S. Fan, Z. Li, M. Fu, M. Rao, Y. Ma, M. P. Lisanti, C. Albanese, B. S. Katzenellenbogen, P. J. Kushner, et al.
Cyclin D1 Antagonizes BRCA1 Repression of Estrogen Receptor {alpha} Activity
Cancer Res.,
August 1, 2005;
65(15):
6557 - 6567.
[Abstract]
[Full Text]
[PDF]
|
 |
|