help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0077
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
146/5/2239    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Provost, P. R.
Right arrow Articles by Tremblay, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Provost, P. R.
Right arrow Articles by Tremblay, Y.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Steroids
Endocrinology Vol. 146, No. 5 2239-2245
Copyright © 2005 by The Endocrine Society

Genes Involved in the Adrenal Pathway of Glucocorticoid Synthesis Are Transiently Expressed in the Developing Lung

Pierre R. Provost and Yves Tremblay

Laboratory of Ontogeny and Reproduction, Centre Hospitalier de l’Université Québec, Centre Hospitalier de l’Université Laval (P.R.P., Y.T.); Department of Obstetrics and Gynecology (P.R.P., Y.T.); and Centre de Recherche en Biologie de la Reproduction (Y.T.), Faculty of Medicine, Laval University, Québec, Canada

Address all correspondence and requests for reprints to: Dr. Yves Tremblay, Ontogeny and Reproduction, Room T-1-58, Centre Hospitalier Universitaire de Québec, Pavillon Centre Hospitalier Universitaire de Laval, 2705 Laurier boulevard, Québec, Québec, Canada G1V 4G2. E-mail: yves.tremblay{at}crchul.ulaval.ca.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have studied the expression of genes involved in glucocorticoid synthesis in the developing lungs of male and female mouse fetuses on gestation days (GD) 15–18 (surge of surfactant, GD 17; term, GD 19). High levels of steroidogenic acute regulatory protein, cytochrome P450 cholesterol side chain cleavage, 3ß-hydroxysteroid dehydrogenase type 1, 21- hydroxylase, and 11ß-hydroxylase mRNAs were observed in three of the six litters studied on GD 15 and in none of the 14 litters analyzed between GD 16 and 18. Of these three litters, two showed high expression levels for these five genes in lung tissues from female fetuses only, whereas in the remaining litter, only tissues from male fetuses presented high expression of these genes. In contrast, 11ß-hydroxysteroid dehydrogenase type 1 mRNA level was very low on GD 15 and presented a gradual increase between GD 15 and 18 with no sex difference. Our data indicate that, like the mature adrenal, the fetal lung expresses all genes required in glucocorticoid synthesis from cholesterol. In addition, our results demonstrate that transient expression of these genes on GD 15 in the fetal lung occurs for both male and female fetuses, 2 d before the surge of surfactant synthesis, which is stimulated by glucocorticoids.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ANTENATAL GLUCOCORTICOIDS (GCs) are administered to mothers about to deliver prematurely to stimulate lung maturation and reduce the risk of respiratory distress in the newborn (1, 2). It is now well recognized that GCs play an essential role in fetal lung development (3, 4). Their actions result in thinning of alveolar septa, an increase in the number of type I pneumonocytes, a decrease in pneumonocyte cell division, and a stimulation of secretion of fibroblast paracrine factors that play a role in type II pneumonocyte (PTII) maturation (5), the latter leading to surfactant synthesis. The CRH knockout (KO) mouse model revealed that CRH KO homozygous fetuses from CRH KO homozygous mothers are delivered normally at term, but all die on the first day of life with an overall failure of lung maturation (3, 6). However, when GC was administered to these pregnant mice, the offspring showed normal lung maturation and viability. These results demonstrate that GCs are absolutely required for normal lung development.

Two enzymes are known to play a role in peripheral GC metabolism: 11ß-hydroxysteroid dehydrogenase type 2 (11ß-HSD-2), which catalyzes GC inactivation (Fig. 1Go), and 11ß-HSD type 1, which catalyzes the opposite reaction. Type 2 11ß-HSD is expressed in aldosterone-selective target cells, where it prevents illicit occupation of mineralocorticoid receptors by GCs (7, 8). In contrast, 11ß-HSD type 1 is highly expressed in cells expressing GC receptors, but not in mineralocorticoid receptors, where it positively regulates the action of GCs (9). 11ß-HSD type 1 is expressed in many tissues, including the lung (10). In adrenals, GCs are produced from cholesterol through the expression of steroidogenic acute regulatory protein (StAR; this protein plays a crucial role in the intramitochondrial movement of cholesterol) (11) and classical steroidogenic enzymes, namely, cytochrome P450 side chain cleavage enzyme (P450scc), 3ß-HSD, 21-hydroxylase, and 11ß-hydroxylase (Fig. 1Go).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1. GC and mineralocorticoid synthesis and metabolism in rodents. Classical adrenal synthesis of corticosterone and aldosterone from cholesterol in the rodent is presented. P450c17 is expressed in the rodent gonads and placenta, whereas 11ß-HSD-1 and 11ß-HSD-2 are expressed in peripheral tissues. 11-DHC, 11-Dehydrocorticosterone (4-pregnen-21-ol-3,11,20-trione); P450scc, CYP11A1; 3ß-HSD, 3ß-HSD/{Delta}5-{Delta}4 isomerase; 21-hydroxylase, cytochrome P450 21-hydroxylase (CYP21); 11ß-hydroxylase, cytochrome P450 11ß-hydroxylase (CYP11B1); aldosterone synthase, cytochrome P450 aldosterone synthase (CYP11B2); P450c17, cytochrome P450c17, 17{alpha}-hydroxylase/17,20-lyase (CYP17).

 
In the present study we examine the expression of genes involved in GC synthesis from cholesterol in the lungs of male and female mouse fetuses isolated on gestation days (GD) 15–18 (term 19). The expression of both 11ß-HSD type 1 and type 2 genes is also studied. We found strong expression of all genes involved in GC synthesis from cholesterol in the developing lung on GD 15, 2 d before the surge of surfactant synthesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Protocols were approved by the animal care and use committee and the institutional review board of the Centre de Recherche du Centre Hospitalier Universitaire de Québec (protocol 2002-080). BALB/c mice were mated during the night. The day that a copulatory plug was present was considered d 0.5 of gestation (GD 0.5). Pregnant females were killed by exposure to a CO2 atmosphere on GD 15.5, 16.5, 17.5, and 18.5. Fetal sex was identified by examination of the genital tract using a dissecting microscope at a magnification of x15. Fetal lungs were collected, and one pool of tissues was prepared for each sex and each pregnant animal (Table 1Go). Except for litters 150 and 151, all litters used in this study correspond to those used by Provost et al. (12) and have the same identification numbers. Real-time PCR performed on cDNA samples prepared from these pools of lung tissues showed a strong increase in surfactant protein C mRNA on GD 17.5 (12). Surfactant protein C mRNA is a reliable marker of mature PTII cells (13, 14).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Pregnant mice and fetuses

 
RNA extraction, cDNA synthesis, and real-time quantitative PCR
Total RNA extracts were prepared from each pool of tissues, then purified on CsCl gradients. An aliquot of 4 µg total RNA was treated with deoxyribonuclease I (0.25 U /µg total RNA) and reverse transcribed (SuperScript II, Invitrogen Life Technologies, Inc., Carlsbad, CA) according to the protocol of the manufacturer, using hexameric random primer (pd(N)6, Invitrogen Life Technologies, Inc.) in a final volume of 20 µl. The use of hexameric random primer gives results independent of the distance between the region to amplify and the polyadenylation site and allows study of the 18S rRNA from the same cDNA preparations. The same cDNA preparations were used for all analyzed genes. LightCycler-FastStart DNA Master SYBR Green I kits (Roche, Indianapolis, IN) were used for real-time PCR. Reactions were performed according to the protocol of the manufacturer with 0.5 µM of each primer (final concentration), 3 mM MgCl2, and an amount of cDNA samples corresponding to 100 ng of the total RNA input (200 pg for 18S oligonucleotides) in a final volume of 20 µl. After enzyme activation (10 min, 95 C), 35–45 PCR cycles were performed: 0 sec at 95 C, 5 sec at the annealing temperature (see below), 20 sec at 72 C, and 5 sec at the temperature of fluorescence intensity reading (see below). At the end of each run, samples were heated to 95 C with a temperature transition rate of 0.2 C/sec to construct dissociation curves. For each gene, several PCRs were tested on a 2% agarose gel, and amplicons were subjected to DNA sequencing to confirm the specificity of the PCRs. Specific PCR products were obtained for each gene analyzed. For StAR, P450scc, 3ß-HSD type 1, 21-hydroxylase, aldosterone synthase, cytochrome P450 17{alpha}-hydroxylase (P450c17), and 11ß-HSD type 1 and type 2 genes, the selected primers encompass at least one intron. For some genes, a very low amount of nonspecific products (below the range of the standard curves) was amplified from samples showing no or very low specific PCR product. Mouse gene/GenBank accession number or reference/5' oligonucleotide/3' oligonucleotide/length of amplicon/annealing temperature/temperature of fluorescence intensity reading: StAR/NM_011485/GCAGAAGGCCTTGGGCATAC/TGGAACCTCTGCGCTTGGTAC/338 nucleotides (nt)/64 C/88 C; P450scc/NM_019779/ATCCGGGCTTCTTTCCCAATC/GGATGGGGTTCTCAGGCATC/249 nt/64 C/86 C; 3ß-HSD type 1/NM_008293/TGCCAGGGCATCTCTGTTGTC/TCTGTTCCTCGTGGCCATTCA/220 nt/64 C/84 C; 21-hydroxylase/NM_009995/TCACGACTGTGTCCAGGACTTG/TTCGTCTTTGCCATCCCTTTG/250 nt/67 C/84 C; 11ß-hydroxylase/(15)/CTGGGACAGTCCTCAATGTGA/ATCCGCACATCCTCTTTCTCTT/244 nt/62 C/87 C; aldosterone synthase/NM_009991/CTGGGACATTGGTCCTACTTT/ATCTGCACATCCTCTTGCCTCA/244 nt/64 C/87 C; 11ß-HSD type 1/NM_008288/GGCCAGCAAAGGGATTGGAAG/TTTTCCCAGCCAAGGAGGAGA/401 nt/66 C/85 C; 11ß-HSD type 2/NM_008289/TGGCTGACGTGGGACTGTCT/TTGGAGCAGCCAGGCTTGATA/277 nt/63 C/87 C; P450c17/NM_007809/GGATCCTGGCTTTCCTGGTG/TAGCCTTGTGTGGGATGAGCA/189 nt/64 C/83 C; glyceraldehyde-3-phosphate dehydrogenase (GAPDH)/M32599/GAAGACTGTGGATGGCCCCTC/ATTGAGAGCAATGCCAGCCCC/358 nt/58 C/87 C; Uty/Y09222/ACCCGCAGAGCTTACCTCCA/ACCGTGTGGACCCAGTTTGAA/194 nt/64 C/81 C; 18S/X00686/GTAACCCGTTGAACCCCATT/CCATCCAATCGGTAGTAGCG/151 nt/60 C/83 C. A standard curve for real-time PCR was prepared for each gene using specific amplicons previously obtained by PCR, sequenced, and calibrated by electrophoresis on an agarose gel. The program supplied by the manufacturer (LightCycler software, version 3.5) was used to import the standard curves and calculate the amount of PCR products (in nanograms of double-stranded cDNA). There was one pool of tissues for each sex and each litter. Therefore, when the data are presented for each litter separately (n = 1), both the mean and the SD were calculated from two real-time PCRs. The amount of mRNA molecules per 100 ng total RNA input was calculated from the amount of specific cDNA template (nanograms) obtained by real-time PCR and the molecular weight of each double-stranded specific cDNA sequence. The amounts of mRNA molecules presented in Table 2Go and in the text are not normalized for the efficiency of reverse transcriptase reactions.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Expression data and ratios for the indicated genes in fetal lungs of litters 71 and 151 on GD 15

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pregnant BALB/c mice were killed between GD 15.5 and GD 18.5. Male and female fetal lung tissues were, respectively, pooled for each litter, and mRNA samples prepared from these pools were used in quantitative real-time PCR analysis.

11ß-HSD types 1 and 2
Very low levels of 11ß-HSD type 1 expression were observed on GD 15 for both sexes, as shown in Fig. 2Go, B–D, which corresponds to approximately 450 mRNA molecules/100 ng total RNA input (data not shown). A 130-fold increase in 11ß-HSD type 1 mRNA was observed between GD 15 and GD 18 in fetal lungs, with no significant sex difference. In contrast, 11ß-HSD type 2 mRNA was expressed at low levels with no regulation for both sexes during the time window analyzed (Fig. 2DGo) with an average of approximately 900 mRNA molecules/100 ng total RNA input (data not shown).



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 2. Expression of 11ß-hydroxylase, 11ß-HSD-1, and 11ß-HSD-2 in the developing lung. Real-time PCRs were performed on cDNA samples prepared from fetal lungs at the indicated gestation time (days). One pool of tissues per sex was prepared for each of the 20 pregnant mothers before RNA extraction. All 40 cDNA samples were tested for 11ß-hydroxylase expression (A), whereas 36 cDNA samples were used to study 11ß-HSD-1 expression (B, a; not tested). The results are the mean of two PCRs (±SD). The mean ± SEM obtained from all litters for each sex and each gestation time are presented for 11ß-HSD-1 (C and D) and 11ß-HSD-2 (D). C, Values were calculated from the results presented in B, except that the results from litter 6 were excluded. D, Only litters 72, 77, 151, 79, 80, 8, 34, 14, and 60 were tested by real-time PCR for 11ß-HSD-2 expression.

 
11ß-Hydroxylase
We then considered that the genes involved in GC synthesis in the mature adrenal could be expressed in the developing lung. We first studied the 11ß-hydroxylase gene, which encodes for the enzyme catalyzing the last step in GC formation (Fig. 1Go). No significant expression of the 11ß-hydroxylase gene was found in any of the 28 lung mRNA samples isolated between GD 16 and GD 18 (Fig. 2AGo). In contrast, half the pregnant mothers killed on GD 15 (three of six) bore fetuses presenting a sex-specific significant amount of 11ß-hydroxylase mRNA in their lungs (Fig. 2AGo). However, the fetal sex in which high expression was observed varied from litter to litter. No pregnant animal was found with high pulmonary 11ß-hydroxylase expression at the same time in both fetal sex. Animal mating was performed with a time window of ±8 h; consequently, the precise gestation time (in hours) at which each pregnant mother was killed was not determined. The precise amount of 11ß-hydroxylase mRNA relative to GAPDH expression and the number of 11ß- hydroxylase mRNA molecules per 100 ng total RNA input in the fetal lung are presented in Table 2Go for male and female fetuses of pregnant females 71 and 151.

Other genes involved in GC synthesis from cholesterol
The expression of genes encoding for StAR, P450scc, 3ß-HSD type 1, and 21-hydroxylase was studied in fetal lung mRNA samples obtained on GD 15. As shown in Fig. 3AGo and Table 2Go, high expression of all these genes was observed only in the pool of female fetal lungs of pregnant mothers 70 and 151 and in the pool of male fetal lungs of litter 71, thus in the same samples where 11ß-hydroxylase expression was observed.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. Expression of StAR, P450scc, 3ß-HSD-1, 21-hydroxylase, and aldosterone synthase genes in the developing lung. Results from real-time PCR are presented for the indicated genes (A) and for the aldosterone synthase gene (B). Values are the mean ± SD from two PCRs. All pregnant females were killed on GD 15. M, Male; F, female. Inset a shows the results of PCRs for the Uty gene from the indicated cDNA preparations.

 
To confirm that all these genes are expressed in both male and female fetal lungs, and that the results did not arise from misidentification of the fetal sex and/or mislabeling of samples, PCRs were performed on cDNA samples of litters 71 and 151 to determine the presence of Uty mRNA. Uty gene (ubiquitously transcribed tetratricopeptide repeat gene on the Y-chromosome) plays a role in the rejection of male tissue grafts by genotypically identical female mice, and its expression was observed in all male tissues tested, including the lung (16, 17, 18). Our results confirm that the presence of Uty mRNA is restricted to male samples for the two litters (Fig 3Go, A, inset a). GAPDH mRNA levels were determined before and after the PCRs presented in Figs. 2–4GoGoGo in all cDNA samples. Similar results were obtained for all samples with no change in GAPDH mRNA levels between the two determinations (data not shown), thus showing that RNA or cDNA degradation cannot explain the observed difference in expression between the samples.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4. Expression of the P450c17 gene in the developing lung. The procedure was the same as that presented in previous figures. Results (mean ± SD) are from two PCRs.

 
Aldosterone synthase
Significant, but low, expression of the aldosterone synthase gene was found in the fetal lungs of female fetuses for litters 70 and 151 and of male fetuses for litter 71 (Fig. 3BGo and Table 2Go). The expression levels of each gene involved in the conversion of cholesterol to aldosterone were divided by the values of P450scc gene expression (Table 2Go). As evidenced from these ratios, the expression of these genes agrees with high GC and low mineralocorticoid synthesis.

P450c17
Two precursors of GCs can be converted into C19 steroids by P450c17 (Fig. 1Go). Because of the well-described effect of androgens on lung maturation, and because the 17ß-HSD type 5 gene catalyzing androgen synthesis is expressed in the developing lung (12, 19), expression of the P450c17 gene was studied. No sample showed high expression of this gene (Fig. 4Go). However, in three samples, P450c17 mRNA levels were 5- to 6-fold higher than in the other samples (female lungs of litters 70 and 151, and male lungs from mother 71; Fig. 4Go).

Fetal lungs vs. mature adrenals
To compare the expression levels of the genes between fetal lungs on GD 15 and mature adrenals, the female fetal lung sample of litter 151 was selected, because it showed the highest expression levels for each of the analyzed genes. For all genes involved in GC synthesis from cholesterol, levels of expression in mature adrenal do not exceed those in fetal lung by more than 26- to 100-fold (Table 3Go). The situation is very different for the aldosterone synthase gene, which is expressed at 4411-fold lower levels in fetal lungs than in mature adrenals, even if expression of the aldosterone synthase gene in adrenals is 10-fold lower than that of 11ß-hydroxylase (Table 3Go).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Gene expression in adult adrenals vs. fetal lung tissues

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We found high levels of expression of the complete set of genes involved in GC synthesis from cholesterol in the mouse developing lung on GD 15. Our data suggest that the peak of expression of these genes does not occur at the same developmental time point for male and female fetuses on GD 15, as evidenced by the fact that two and one of the six litters we examined showed high expression of the genes for female and male fetuses, respectively, and no litter presented high expression for both sexes (Fig. 5Go). Such a delay also exists in PTII cell maturation 2 d later, on GD 17, when the surge of surfactant in female lungs precedes that in male lungs (20, 21, 22, 23). Because GCs are positive regulators of PTII cell maturation, these observations are suggestive for a link between PTII cell maturation and the expression of StAR, P450scc, 3ß-HSD type 1, 21-hydroxylase, and 11ß-hydroxylase genes on GD 15. For example, a narrow peak of LH 3- to 4-fold over its basal level is required to induce ovulation 24–36 h later in mammals (24). We have shown recently that two genes involved in the androgen metabolism of the developing lung, namely, 17ß-HSD type 2 and type 5, also present maximal expression levels at different specific developmental time points on GD 17 for male and female mouse fetuses (12).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 5. Expression profile of the genes involved in GC synthesis from cholesterol in the developing lung. Our data presented in Figs. 2Go and 3Go suggest that StAR, P450scc, 3ß-HSD-1, 21-hydroxylase, and 11ß-hydroxylase genes could be expressed at different time points for male and female fetal lungs on GD 15 within a period of 16 h corresponding to the time of mating. No litter presented high expression levels of these genes in both fetal sexes. In the litters in which high expression was observed, only male or female lungs presented high mRNA levels. Therefore, these data cannot be explained by high expression in both sexes followed by a decrease in one sex, then a decrease in the other sex. Our data do not allow us to determine the sex in which gene expressions are delayed compared with the other sex. We suggest that expression of the five genes is delayed for males based on the delay in PTII cell maturation reported for males.

 
From GD 16, local GC synthesis in the lung should depend primarily on the conversion from 11-dehydrocorticosterone by 11ß-HSD type 1, because the five genes involved in GC synthesis from cholesterol are barely or not at all expressed after GD 15. A strong increase in 11ß-HSD type 1 mRNA was observed from GD 16, with levels on GD 18 reaching 130-fold those observed on GD 15. However, in contrast with the genes involved in GC synthesis from cholesterol, the 11ß-HSD type 1 gene showed no significant sex difference in any litter. Therefore, the 11ß-HSD type 1 gene does not seem to contribute to the reported sex difference in lung maturation (20, 21). An increase in 11ß-HSD type 1 mRNA was also observed by in situ hybridization in the mouse developing lung (25, 26, 27). This gene continues to be expressed after birth.

The presence of mRNA molecules from the genes involved in GC synthesis from cholesterol (except 3ß-HSD type 1) was also reported in human fetal lungs (28), but at very low levels. The level of 11ß-hydroxylase mRNA detected in fetal human lungs by Pezzi et al. (28) was lower than that in male fetuses of litter 151 in the present study (Table 2Go and Fig. 2AGo). For comparison, we report that the levels of 11ß-hydroxylase mRNA can increase up to 1138-fold over those observed in this male fetal lung sample (Table 2Go and Fig. 2AGo). We suggest that all five genes involved in GC synthesis could also be expressed at high levels in the human developing lung, but only at specific developmental time points, as in the mouse. Additional studies are required to validate this hypothesis.

To our knowledge, the only extraadrenal tissues where the expression of all genes involved in CG synthesis from cholesterol were found are the brain (29, 30) and thymic epithelial cells, which could secrete GCs as paracrine factors for GC-sensitive thymocytes (31). Both CRH and ACTH are expressed in the thymus (32, 33), and they should stimulate the expression of GC synthesis genes in this tissue. Are CRH and ACTH expressed in the developing lung?

In the fetal lung, GC could play paracrine and intracrine (action within GC-producing cells) roles. We have estimated that the number of 11ß-hydroxylase mRNA molecules produced by whole fetal lungs on GD 15 (litter 151, females) is close to the value obtained for whole adult adrenals when these values are normalized by fetal and adult body weights, respectively (data not shown). Therefore, we cannot assume that the effect of 11ß-hydroxylase expression in the fetal lung on GD 15 is restricted to the lung. However, because its expression occurs for only a short period in the lung, physiological effects could be limited to the lung.

Because of technical requirements, pools of lung tissues were studied instead of tissues from each individual fetus. Therefore, we cannot conclude that all fetuses of the same sex had similar levels of expression for each analyzed gene within each litter. However, if such is not the case, this would indicate that a few fetuses had much higher amounts of 11ß-hydroxylase mRNA molecules within their total lung tissues than those present within mature adrenals when normalized by body weight, which would be surprising.

From our results, P450c17 expression in fetal lungs is not a major source of C19 steroids considering the fetal circulating levels of androstenedione. The aldosterone synthase gene is also expressed at low levels on GD 15. To our knowledge, no role has yet been attributed to mineralocorticoids in lung development. 11ß-HSD type 2 is considered to be required in cells where specific occupation of mineralocorticoid receptors by mineralocorticoids is required. This gene is expressed at low levels during all gestation periods analyzed. It is possible that a few cells express the 11ß-HSD type 2 gene to control mineralocorticoid receptor occupancy, and that the expression of the aldosterone synthase gene occurs within these cells on GD 15.

We report for the first time the expression of the genes involved in GC synthesis from cholesterol in the developing lung. The expression of these genes can represent a key event in lung development, knowing that it occurs 2 d before PTII cell maturation, which is positively regulated by GC. Moreover, our data suggest that the expression of the genes involved in GC synthesis could peak at different time points on GD 15 for male and female fetuses, a characteristic similar to that of PTII cell maturation.


    Acknowledgments
 
We thank Dr. Manon Richard for critical reading of the manuscript.


    Footnotes
 
This work was supported by grants from the Natural Sciences and Engineering Research Council of Canada, Centre Hospitalier Universitaire de Québec Foundation, and Canadian Institutes of Health Research (to Y.T.).

First Published Online January 27, 2005

Abbreviations: GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; GC, glucocorticoid; GD, gestation day; 11ß-HSD-2, 11ß-hydroxysteroid dehydrogenase type 2; KO, knockout; nt, nucleotide; P450c17, cytochrome P450 17{alpha}-hydroxylase; P450scc, cytochrome P450 side chain cleavage enzyme; PTII, type II pneumonocyte; StAR, steroidogenic acute regulatory protein.

Received January 18, 2005.

Accepted for publication January 21, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. NIH 1995 Consensus development panel on the effects of corticosteroids for fetal lung maturation on perinatal outcomes. J Am Med Assoc 273:413–418[Abstract]
  2. Crowley P 2001 Prophylactic corticosteroids for preterm birth (Cochrane Review). In: The Cochrane Library, Issue 4. Oxford: Update Software
  3. Venihaki M, Majzoub J 1999 Animal models of CRH deficiency. Front Neuroendocrinol 20:122–145[CrossRef][Medline]
  4. Bolt RJ, van Weissenbruch MM, Lafeber HN, Delemarre-van de Wall HA 2001 Glucocorticoids and lung development in the fetus and preterm infant. Pediatr Pulmonol 32:76–91[CrossRef][Medline]
  5. Wang J, Kuliszewski M, Yee W, Sedlackova L, Xu J, Tseu I, Post M 1995 Cloning and expression of glucocorticoid-induced genes in fetal rat lung fibroblasts. J Biol Chem 270:2722–2728[Abstract/Free Full Text]
  6. Muglia L, Jacobson L, Dikkes P, Majzoub JA 1995 Corticotropin-releasing hormone deficiency reveals major fetal but not adult glucocorticoid need. Nature 373:427–432[CrossRef][Medline]
  7. Albiston AL, Obeyesekere VR, Smith RE, Krozowski ZS 1994 Cloning and tissue distribution of the human 11ß-hydroxysteroid dehydrogenase type 2 enzyme. Mol Cell Endocrinol 105:R11–R17
  8. Brown RW, Chapman KE, Kotelevtsev Y, Yau JL, Lindsay RS, Brett L, Leckie C, Murad P, Lyons V, Mullins JJ, Edwards CRW, Seckl JR 1996 Cloning and production of antisera to human placental 11ß-hydroxysteroid dehydrogenase type 2. Biochem J 313:1007–1017
  9. Kotelevtsev Y, Holmes MC, Burchell A, Houston PM,Schmoll D, Jamieson P, Best R, Brown R, Edwards CRW, Seckl JR 1997 11ß-Hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci USA 94:14924–14929[Abstract/Free Full Text]
  10. Seckl JR, Walker BR 2001 Minireview: 11ß-hydroxysteroid dehydrogenase type 1: a tissue-specific amplifier of glucocorticoid action. J Clin Endocrinol Metab 142:1371–1376
  11. Stocco DM, Clark BJ 1996 Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev 17:221–244[CrossRef][Medline]
  12. Provost PR, Simard M, Tremblay Y 2004 A link between lung androgen metabolism and the emergence of mature epithelial type II cells. Am J Respir Crit Care Med 170:296–305[Abstract/Free Full Text]
  13. Hawgood S, Clements JA 1990 Pulmonary surfactant and its apoproteins. J Clin Invest 86:1–6
  14. Horowitz S, Watkins RH, Auten RJ, Mercier CE, Cheng ER 1991 Differential accumulation surfactant protein A, B, and C mRNA in two epithelial cell types of hypoxic lung. Am J Respir Cell Mol Biol 5:511–515
  15. Domalik LJ, Chaplin DD, Kirkman MS, Wu RC, Liu WW, Howard TA, Seldin MF, Parker KL 1991 Different isozymes of mouse 11ß-hydroxylase produce mineralocorticoids and glucocorticoids. Mol Endocrinol 5:1853–1861[CrossRef][Medline]
  16. Greenfield A, Scott D, Pennisi D, Ehrmann I, Ellis P, Cooper L, Simpson E, Koopman P 1996 An H-YDb epitope is encoded by a novel mouse Y chromosome gene. Nat Genet 14:474–478[CrossRef][Medline]
  17. Vogt MHJ, Goulmy E, Kloosterboer FM, Blokland E, de Paus RA, Willimze R, Falkenburg JHF 2000 UTY gene codes for an HLA-B60-restricted human male-specific minor histocompatibility antigen involved in stem cell graft rejection: characterization of the critical polymorphic amino acid residues for T-cell recognition. Blood 96:3126–3132[Abstract/Free Full Text]
  18. Warren EH, Gavin MA, Simpson E, Chandler P, Page DC, Disteche C, Stankey KA, Greenberg PD, Riddell SR 2000 The human UTY gene encodes a novel HLA-B8-restricted H-Y antigen. J Immunol 164:2807–2814[Abstract/Free Full Text]
  19. Provost PR, Blomquist CH, Godin C, Huang X-F, Flamand N, Luu-The V, Nadeau D, Tremblay Y 2000 Androgen formation and metabolism in the pulmonary epithelial cell line A-549: expression of 17ß-hydroxysteroid dehydrogenase type 5 and 3{alpha}-hydroxysteroid dehydrogenase type 3. Endocrinology 141:2786–2794[Abstract/Free Full Text]
  20. Nielsen HC 1985 Androgen receptors influence the production of pulmonary surfactant in the testicular feminization mouse fetus. J Clin Invest 76:177–181
  21. Torday JS, Nielsen HC 1987 The sex difference in fetal lung surfactant production. Exp Lung Res 12:1–19[Medline]
  22. Torday JS, Dow KE 1984 Synergistic effect of triiodothyronine and dexamethasone on male and female rat lung. Dev Pharmacol Ther 7:133–139[Medline]
  23. Nielsen HC, Torday JS 1981 Sex differences in fetal rabbit pulmonary surfactant. Pediatr Res 15:1245–1247[Medline]
  24. Kerin J 1982 Ovulation detection in the human. Clin Reprod Fertil 1:27–54[Medline]
  25. Brown RW, Diaz R, Robson AC, Kotelevtsev YV, Mullins JJ, Kaufman MH, Seckl JR 1996 The ontogeny of 11ß-hydroxysteroid dehydrogenase type 2 and mineralocorticoid receptor gene expression reveal intricate control of glucocorticoid action in development. Endocrinology 137:794–797[Abstract]
  26. Thompson A, Han VK, Yang K 2004 Differential expression of 11ß-hydroxysteroid dehydrogenase types 1 and 2 mRNA and glucocorticoid receptor protein during mouse embryonic development. J Steroid Biochem Mol Biol 88:367–375[CrossRef][Medline]
  27. Speirs HJL, Seckl JR, brown RW 2004 Ontogeny of glucocorticoid receptor and 11ß-Hydroxysteroid dehydrogenase type-1 gene expression identifies potential critical periods of glucocorticoid susceptibility during development. J Endocrinol 181:105–116[Abstract]
  28. Pezzi V, Mathis JM, Rainey WE, Carr BR 2003 Profiling transcript levels for steroidogenic enzymes in fetal tissues. J Steroid Biochem Mol Biol 87:181–189[CrossRef][Medline]
  29. Guennoun R, Fiddes RJ, Gouezou M, Lombes M, Baulieu EE 1995 A key enzyme in the biosynthesis of neurosteroids, 3ß-hydroxysteroid dehydrogenase/{Delta}5-{Delta}4-isomerase (3ß-HSD), is expressed in rat brain. Brain Res Mol Brain Res 30:287–300[Medline]
  30. Stromstedt M, Waterman MR 1995 Messenger RNAs encoding steroidogenic enzymes are expressed in rodent brain. Brain Res Mol Brain Res 34:75–88[Medline]
  31. Pazirandeh A, Xue Y, Rafter I, Sjövall J, Jondal M, Okret S 1999 Paracrine glucocorticoid activity produced by mouse thymic epithelial cells. FASEB J 13:893–901[Abstract/Free Full Text]
  32. Batanero E, de Leeuw FE, Jansen GH, van Wichen DF, Huber J, Schuurman HJ 1992 The neural and neuro-endocrine component of the human thymus. II. Hormone immunoreactivity. Brain Behav Immun 6:249–264[CrossRef][Medline]
  33. Aird F, Clevenger CV, Prystowsky MB, Redei E 1993 Corticotropin-releasing factor mRNA in rat thymus and spleen. Proc Natl Acad Sci USA 90:7104–7108[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. L. Schmidt and K. K. Soma
Cortisol and corticosterone in the songbird immune and nervous systems: local vs. systemic levels during development
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2008; 295(1): R103 - R110.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
146/5/2239    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Provost, P. R.
Right arrow Articles by Tremblay, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Provost, P. R.
Right arrow Articles by Tremblay, Y.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Steroids


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals