help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2004-1413
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robertson, K. M.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robertson, K. M.
Right arrow Articles by Gustafsson, J.-A.
Endocrinology Vol. 146, No. 6 2519-2530
Copyright © 2005 by The Endocrine Society

The Liver X Receptor-ß Is Essential for Maintaining Cholesterol Homeostasis in the Testis

Kirsten M. Robertson, Gertrud U. Schuster, Knut R. Steffensen, Outi Hovatta, Steve Meaney, Kjell Hultenby, Lisen C. Johansson, Konstantin Svechnikov, Olle Söder and Jan-Åke Gustafsson

Departments of Biosciences at Novum (K.M.R., G.U.S., K.R.S., L.C.J., J.-Å.G.) and Obstetrics and Gynecology (O.H.), Department of Medicine and Molecular Nutrition Unit at Novum (L.C.J.), Division of Clinical Chemistry (S.M.), Karolinska Institutet, Department of Clinical Research Center (K.H.), Huddinge University Hospital, Huddinge 14157, Sweden; and Pediatric Endocrinology Unit (K.S., O.S.) and Department of Women and Child Health, Karolinska Institutet and Hospital, Stockholm 17176, Sweden

Address all correspondence and requests for reprints to: Kirsten Robertson, Ph.D., Karolinska Institutet, Department of Biosciences at Novum, Huddinge 14157, Sweden. E-mail: kirsten.robertson{at}biosci.ki.se.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The liver X receptor (LXR){alpha} and -ß has been found to play a central role in maintaining cellular cholesterol homeostasis. In this study we comprehensively investigated the effect of deleting LXR{alpha} and -ß on testicular morphology and function. In the absence of LXRß, excessive cholesterol accumulated in the Sertoli cells from 2.5 months, resulting in severe cellular disruption and dysregulation of spermatogenesis by 10 months of age. This correlated with gene expression analyses that clearly indicated that LXRß was the dominant transcript in the testis Although the LXR{alpha}–/– testis was normal, the LXR{alpha}–/–ß–/– testis presented with a more severe phenotype than the LXRß–/– mice, and males were infertile by 4 months of age, indicating LXR{alpha} may partially rescue the testicular phenotype. Although Leydig cells did not accumulate excessive cholesterol, declining serum and intratesticular androgen levels with age suggested that these cells were in fact less functional. Treatment of a Sertoli cell line with the LXR agonist T0901317 led to increased expression of known LXR target genes like ATP binding cassette-G1 and sterol regulatory binding protein-1c; similar results were observed in wild-type testis after in vivo administration, suggesting the LXR is functioning in the same way as in other tissues. Ordinarily increased levels of cholesterol activate intracellular sensors to decrease these levels; however, the increasing amount of cholesterol in the Sertoli cells indicates improper control of cholesterol metabolism when LXRß is absent. Although the precise molecular mechanism at this time remains unclear, our study highlights the crucial role for LXRß in retaining cholesterol homeostasis in Sertoli cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CELLULAR AND SERUM cholesterol levels are tightly controlled to prevent excessive cholesterol accumulation in tissues. Specific feedback mechanisms exist in mammalian cells to sense and regulate intracellular cholesterol levels through membrane bound sterol regulatory binding proteins (SREBPs) (1). Under high cholesterol conditions, SREBPs are bound to the SREBP cleavage-activating protein (SCAP), with this complex retained in the endoplasmic reticulum by one of two retention proteins, Insig-1 and -2 (2). However, when cholesterol levels are low, the SREBP/SCAP complex exits the endoplasmic reticulum, the SREBPs are cleaved and are now able to transcriptionally activate cholesterol biosynthetic, and lipoprotein receptor genes to increase intracellular cholesterol levels by de novo synthesis and uptake from circulating lipoproteins (for reviews see Refs. 3 and 4).

To quantitatively reduce excessive cholesterol levels in peripheral tissues, free cholesterol is effluxed to lipid-poor extracellular apolipoprotein acceptors (Apo-A1) and then delivered to the liver in high-density lipoproteins (HDL) for conversion to bile acids and biliary excretion (5, 6, 7, 8, 9). This removal of cellular cholesterol is called reverse cholesterol transport, with evidence from many laboratories indicating that the liver X receptor (LXR{alpha} and -ß) plays an important role in this process (10, 11). The two LXR isoforms differ in their tissue distribution, with LXRß ubiquitously expressed, whereas LXR{alpha} is highly expressed in the liver, kidney, intestine, spleen, adipose tissue, and skeletal muscle (12, 13, 14). The endogenous ligands for the LXRs are certain oxidized derivatives of cholesterol, the oxysterols; however, specific synthetic ligands also exist: T0901317 and GW3965. Upon activation by oxysterols, the LXRs form obligate heterodimers with retinoid X receptors (RXR{alpha}, -ß, -{gamma}) and become competent to activate the transcription of genes involved in cholesterol efflux. Known LXR target genes include the ATP binding cassette (ABC) transporters, ABCA1, ABCG1, ABCG5, and ABCG8 (15, 16, 17, 18), Apo-lipoprotein E or A1 (19, 20) and scavenger receptor (SR)-B1 (21). Inactivation of both LXR{alpha} and -ß results in cholesterol accumulation in the liver, spleen, and lung, even when mice are maintained on a normal chow diet (22).

The Sertoli cell represents one of the three major cell types in the testis (23). These cells reside on a basement membrane comprised of an extracellular matrix that inhibits the passage of large substances, such as low-density lipoprotein (LDL), into the cell (24, 25). However, the Sertoli cells appear to be able to take up cholesteryl esters via internalization of cholesterol from a subgroup of HDL mainly binding ApoE (HDL-ApoE) (25, 26). ApoE has a high affinity for members of the LDL receptor superfamily, which includes the LDL receptor (LDLR), the very low-density lipoprotein receptor (VLDLR) and the LDL-related protein-1 (27, 28). Sertoli cells can also acquire HDL-cholesterol via an SR-B1 mediated pathway (29, 30). However, the importance of the LXRs in regulating cholesterol homeostasis within the reproductive cells of the male is still poorly understood.

We therefore comprehensively investigated the effect of deleting LXR{alpha} and -ß on the development, morphology, and function of the testis and thus on male reproductive potential. Although a detailed study, completed on the LXR{alpha}, LXRß, and LXR{alpha}ß knockout testes at different ages, we showed accumulation of cholesterol in the Sertoli cells of the LXRß–/– mice from as early as 2.5 months. At 10 months the droplets were large and numerous, with the absence of mature germ cells. By 20 months the accumulation of lipid was extreme and few cell types remained. We also found a possible additional role for the LXR{alpha}, with the LXR{alpha}–/–ß–/– mouse presenting with a different, more severe phenotype at an earlier age. Our study clearly highlights the importance of the LXRß in sensing and regulating intracellular cholesterol homeostasis in the testis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
LXR{alpha}–/–, LXRß–/–, and LXR{alpha}–/–ß–/– mice were generated by targeted disruption in our laboratory as previously described (22, 31). All mice were backcrossed from a 129/Sv to a C57BL/6 background for approximately seven generations. Animals were housed under a 12-h light, 12-h dark cycle in the specific pathogen-free facility and were fed a standard mouse chow (R36 Lactamin, Vadstena, Sweden) ad libitum. All experiments were approved by the local Animal Experimentation Ethics Committee for animal experimentation.

Tissue collection
Mice were obtained from the same colony. Blood was collected by cardiac puncture from animals lightly anesthetized with methoxyflurane, whereupon animals were killed by cervical dislocation. The serum was separated by centrifugation and stored at –20 C. Dissected testes were immersion fixed overnight in 4% paraformaldehyde, placed in 70% ethanol, and processed for paraffin embedding or in 30% sucrose for cryosections; immersion fixed in 2% paraformaldehyde and 2.5% glutaraldehyde [in 0.1 M PBS (pH 7.4)] and embedded in LX-112 for electron microscopy; or frozen in liquid nitrogen for RNA, cholesterol, or steroid extraction.

Histopathology
The initial morphology of the testis was examined after hematoxylin staining of 10 µm paraffin sections. Lipids were identified through Oil Red O staining of 10-µm cryosections as previously described (32). Immunohistochemical localization of cytochrome P450 side chain cleavage enzyme (P450scc; Chemicon International, Temecula, CA) was performed on 10-µm frozen sections. Sections were subjected to microwave antigen retrieval in 0.01 M citric acid (pH 6.0) for 90 sec and then left undisturbed for 30 min. After this, the sections were incubated shaking in 0.5% hydrogen peroxide for 30 min and then blocked with 0.5% Triton X-100 in 10% goat serum for 1 h at room temperature. The P450scc antibody was diluted 1:3000 in 3% BSA and 0.3% Triton X-100 and incubated overnight at 4 C. Sections were then washed consecutively in PBS, 0.05% Tween 20 for 15 min, and PBS for 15 min, followed by incubation with a biotinylated goat antirabbit secondary antibody (1:200) in 0.3% Triton X-100 and 2% mouse serum for 1 h. After this, sections were incubated in the streptavidin-horseradish peroxidase ABC complex (Vectastain Elite; Vector Laboratories, Burlingame, CA) for 1 h, counterstained with Mayer hematoxylin (Sigma, St. Louis, MO) before dehydration through ethanol and histosol, and mounted in DPX (dibutyl phthalate xylene) (BDH, Poole, UK).

Testes fixed for electron microscopy were rinsed in 0.1 M imidazole buffer (pH 7.3), postfixed in 2% osmium tetroxide in 0.1 M imidazole buffer at 4 C for 2 h (33), and then dehydrated in ethanol followed by acetone and embedded in LX-112 (Ladd, Burlington, VT). Semithin sections were cut and stained with toluidine blue and used for light microscopic analysis. Ultrathin sections (approximately 40–50 nm) were then cut with a diamond knife using a Reichert Ultracut ultramicrotome and contrasted with uranyl acetate followed by lead citrate and examined in a Tecnai 10 at 80 kV.

Analysis of tissue sterols
Sterols were extracted from frozen testes using the chloroform/methanol (Folch solution; 2:1) extraction procedure. Briefly, the testes were weighed and then homogenized in the Folch solution. After centrifugation (10 min, 3500 rpm), the supernatant was removed and added to 0.8ml 50 nM NaCl and then centrifuged again for 10 min at 3500 rpm. One hundred microliters of the lower phase were removed and added to 100 µl 75 mg/ml Triton X-100 in Folch solution for each determination (total cholesterol, triglycerides, control and oxysterols). The tubes were then dried at 70 C for 2 h.

Twenty microliters water plus either 1 ml cholesterol or triglyceride reagent (Roche, Stockholm, Sweden) were added to each sample. The samples were measured against a standard (Abtrol, Konelab, Thermo Electron Corp., San Jose, CA) and read at 500 nm.

The oxysterols were further analyzed using an isotope-dilution mass spectrometry essentially as previously described (34). Briefly, a mixture of deuterium-labeled oxysterols (200 ng of each) was used as an internal standard, with 10 µl of butylhydroxytoluene (5 µg/ml) and 20 µl of 10 mg/ml EDTA. Sterols were extracted with chloroform after saponification and neutralization, and oxysterols were separated from cholesterol by a solid-phase extraction using a 100-mg Isolute silica cartridge (IST, Mid Glamorgan UK). After washing and elution of cholesterol, oxysterols were eluted with 30% 2-propanol in hexane (vol/vol) and the solvent evaporated under a gentle stream of argon at room temperature.

Trimethylsilylation of the oxysterols was carried out using 0.1 ml of pyridine/hexamethyldisilazane/trimethylchlorosilane (3:2:1, vol/vol/vol) for 30 min at 60 C. The samples were dried under a stream of argon at room temperature before being redissolved in 125 µl of hexane for gas chromatography/mass spectrometry (GC-MS) analysis. Combined GC-MS analysis for the quantification of 7{alpha}-hydroxycholesterol (7{alpha}-OH), 7ß-hydroxycholesterol (7ß-OH), 7-oxocholesterol (7-Oxo), 24S-hydroxycholesterol (24S-OH), and 27-hydroxycholesterol (27-OH) was performed on a HP5890 Series II plus gas-chromatograph equipped with an HP-5MS capillary column (30 m x 0.25 mm, 0.25 µm phase thickness; Hewlett-Packard, Portland, OR) connected to an HP 5972 mass selective detector and an HP 7673A automatic sample injector. The mass spectrometer was operated in the selected-ion monitoring mode, and between two and four ions were detected simultaneously. The m/z values of the ions used for analysis were as follows: [2H6]-7{alpha}-OH, 462.4, 7{alpha}-OH, 456.4, [2H6]-7ß-OH, 462.4, 7ß-OH, 456.4, [2H6]-7-Oxo, 478.4, 7-Oxo, 472.4, [2H3]-24S-OH, 416.4, 24S-OH, 413.4, [2H6]-27-OH, 462.4, and 27-OH, 456.4. Concentrations were determined using standard curves generated with the appropriate oxysterol.

Cell culture
The mouse Sertoli cell (MSC-1) line was grown in DMEM containing 4.5 g/liter glucose with 10% bovine calf serum at 37 C. The origin and properties this cell line have been described previously (35). For treatment with the LXR agonist, MSC-1 cells were grown for 24 h in the presence of DMEM as above and then incubated for 24 h with 1 µM T0901317 in serum-free media.

Real-time PCR
Total RNA was extracted from frozen testis using the TRIzol (Gibco BRL, Gaithersburg, MD) RNA isolation reagent and cells using the RNeasy minikit (QIAGEN, Valencia, CA) according to the manufacturer’s instructions. RNA from LXR agonist (T0901317) fed wild-type (WT) mice was from the study conducted by Stulnig et al. (36). One microgram of RNA was treated with DNase I (DNA-free; Ambion, Inc., Austin, TX) and then reverse transcribed with 100 ng random hexamer primer using the Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Specific primers were designed using the Primer Express software (PE Biosystems, Foster City, CA) for the following genes. All genes were analyzed with the SYBR green detection method using the Applied Biosystems 7500 real-time PCR machine.

Genes included: Niemann Pick-1 (NPC1), forward, AACCGTACCCCGCAGGA, reverse, AACCTGGTGCAGAATCTCTTTGTT; He1 (Homo sapiens epididymal secretory protein) forward, GTTCAGATCACAAGCTAGGCTCC, reverse, CACTCCGTCCATGGCCTC; VLDLR forward, TGCGAGAGCCTGCCTCC, reverse, TCGCCCCAGTCTGACCA; SR-B1 forward, TGATGATGACCTTGGCGCT, reverse, TCACCAACTGTGCGGTTCA; ACAT1 (acyl-coenzyme A:cholesterol acyltransferase) forward, GCCAGCACTGTCCTCTGAAGA, reverse, CACGTACCGACAAGTCCAGGT; and FSH-R forward, GCCCTTTGTCGCAGCTGT, reverse, ACAGATGACCACAAAGGCCAG.

The following forward and reverse primer sequences were obtained from published studies: SREBP-2, SREBP-1c, SCAP, 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, HMG CoA synthase, LDLR, ABCA1, LXR{alpha}, and LXRß (37, 38, 39). Each PCR was run in duplicate using two different cDNA templates.

Steroid hormone levels
Serum LH and FSH were measured by RIA as previously described (40, 41). All samples were diluted 1:5 for FSH, with no dilution for LH. Samples were measured in duplicates in cases in which the within-assay coefficients of variation were higher than 10%. Serum testosterone was determined by the Coat-a-Count RIA kit (Diagnostics Products Corp., Los Angeles, CA) according to the manufacturer’s instructions. Intra testicular steroid concentrations were assayed as described earlier (42). Briefly, testicular tissue obtained from individual mice was homogenized by sonication (2 x 20 sec) in a sodium phosphate buffer and then the homogenates centrifuged at 10,000 x g for 10 min. Progesterone, androstenedione, and testosterone concentrations in the supernatant were determined employing the Coat-a-Count RIA kit (Diagnostic Products Corp.), according to the manufacturer’s instructions.

Statistics
Differences between groups (age and genotype) were performed using a two-way ANOVA followed by post hoc comparison according to least significant differences test. Data (see Table 4Go) were log transformed to correct for normality. Table 3Go was analyzed using a Mann-Whitney U test between treated and untreated. All analyses were performed using the Statistica software (Stat Soft, Tulsa, OK). Data were considered statistically significant when P < 0.05 was achieved. All data are expressed as mean ± SEM.


View this table:
[in this window]
[in a new window]
 
TABLE 4. The expression of genes from whole testis

 

View this table:
[in this window]
[in a new window]
 
TABLE 3. Testicular genes regulated by the synthetic LXR agonist Tularik (T0901317) in WT mice (10 month) and MSC-1 cells

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The LXRs are required for fertility
In breeding LXR null mice, fertility records revealed that pairs consisting of LXR{alpha}–/–ß–/– males and LXR{alpha}–/–ß–/– females ceased producing litters when they were just over 4 months of age, i.e. at a significantly lower age than WT mice (Table 1Go). These pairs also produced significantly fewer litters during the 4 months when they were fertile. Further investigations with animals bred with WT partners indicated that this problem appeared to originate from both male and female LXR knockout mice (our unpublished observations). In comparison, there was no difference in fertility among WT, LXR{alpha}–/–, and LXRß–/– pairs. All mice were bred for 11–13 months.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Fertility data from breeding conducted with male and female mice of the same genotype

 
LXRß–/–mice present with a severe accumulation of lipids within the seminiferous epithelium
All testis sections were stained with standard hematoxylin for histological analysis. In addition to this, Oil Red O was used to more clearly highlight any lipid droplets. The LXR{alpha}–/– testes appeared normal at age 2.5 months (LXR{alpha}–/–; Fig. 1Go, A and E). However, small intracellular lipid vesicles were beginning to appear within the basal compartment of the Sertoli cells in LXRß–/– mice (Fig. 1Go, A and E; LXRß–/–). These vesicles were also observed in the LXR{alpha}–/–ß/ testes, where, however, they appeared to be larger and also present in the adluminal compartment. The testes remained structurally intact in all animals and spermatogenesis was progressing normally.



View larger version (104K):
[in this window]
[in a new window]
 
FIG. 1. Histological analysis of WT, LXR{alpha}–/–, LXRß–/–, and LXR{alpha}–/–ß–/– mouse testes at 2.5, 6, 10, and 20 months of age. Each panel shows a representative seminiferous tubule from either a paraffin section stained with standard hematoxylin (A–D) or frozen testes stained with Oil Red O and hematoxylin. Oil Red O stains lipids red (although does not distinguish between triglycerides and cholesterol) and therefore is used here to more clearly highlight lipid droplets within the seminiferous tubules and surrounding interstitium (E–H). Bar, 50 µm.

 
As the mice aged (6 months), larger lipid droplets were clearly present within the adluminal compartment of the LXRß–/– testes; however, structurally, the testes remained undisrupted, and the cauda epididymides (not shown) were filled with maturing spermatozoa, suggesting that these animals were fertile (Fig. 1Go, B and F; LXRß–/–). In the LXR{alpha}–/–ß–/– mice, the droplets did not appear to differ in size from those observed in the LXRß–/– testes; however, spermatogenesis was now disrupted in half of the mice analyzed with only immature germ cells still present or with complete loss of all sperm types (Fig. 1Go, B and F; LXR{alpha}–/–ß–/–). The luminal space was also very dilated with a flattened surrounding epithelium, suggesting a different phenotype from the LXRß–/– testes. The epididymides were completely devoid of maturing sperm (not shown), suggesting that these mice were infertile at age 6 months, correlating with the initial breeding observations. Histological characterization of the LXR{alpha}–/– testes at this age continued to show no evidence of lipid accumulation within the seminiferous epithelium (Fig. 1Go, B and F; LXR{alpha}–/–).

At 10 months of age, prominent lipid droplets were clearly visible in the LXRß–/– mouse, and spermatogenesis was now disrupted with most tubules having no mature germ cells (Fig. 1Go, C and G, LXRß–/–). However, the phenotype displayed in the LXRß–/– testis was different and less severe than that observed in age-matched LXR{alpha}–/–ß–/– testis. In the LXRß–/– mice, the structural Sertoli cells were still present, whereas in the double-knockout mice, most tubules had been totally consumed with lipid droplets, and most testicular cell types were gone (Fig. 1Go, C and G, LXR{alpha}–/–ß–/–). The LXR{alpha}–/–ß–/– testes were also significantly smaller than in WT colony mates (Table 2Go). Histological characterization of the LXR{alpha}–/– mouse testes at this age did not show any evidence of lipid accumulation (Fig. 1Go, C and G, LXR{alpha}–/–).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Testis weights (mg) of WT and LXR–/– mice

 
In 20-month-old mice, the level of testicular disruption in the LXRß–/– mice was quite heterogeneous; ranging from tubules with lipid droplets surrounding immature germ cells, to tubules with such extreme lipid accumulation that the germ cells had disappeared (Fig. 1Go, D and H, LXRß–/–). However, there still appeared to be some structural cells remaining. The testes were smaller than in WT mice, and the surrounding capsule appeared to have a smoother appearance (Fig. 2Go and Table 2Go). In comparison, the LXR{alpha}–/–ß–/– testes were highly degenerated, and only remnants of the tubules were observed. Spermatogenesis had ceased and cholesterol clefts were clearly visible (Fig. 1Go, D and H, LXR{alpha}–/–ß–/–). These clefts are commonly observed in atherosclerotic plaques and are the slits that remain behind after cholesterol crystals are dissolved during tissue processing. The testicular destruction in these older mice was clearly observed with the naked eye because the testes were severely reduced in size and were flattened, some with a hard-calcified consistency, others with a softened capsule (Fig. 2Go and Table 2Go). The LXR{alpha}–/– testis continued to have no obvious phenotype (Fig. 1Go, D and H, LXR{alpha}–/–).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 2. Representative photograph comparing testes dissected from WT (A), LXR{alpha}–/– (B), LXRß–/– (C), and LXR{alpha}–/–ß–/– (D) mice at age 18 months. The surrounding epididymis has been removed.

 
The lipid droplets are localized to the Sertoli cells
In view of the dual role of LXRs in the regulation of both cholesterol and fatty acid metabolism (43), total testicular cholesterol and triglycerides were assayed. Testicular cholesterol levels increased significantly with age in the LXRß–/– testes, from 27 µg/mg at 11 months to 91 µg/mg at 18 months, whereas WT testes contained approximately 8 µg/mg at all ages (Fig. 3AGo). Cholesterol was also present in the LXR{alpha}–/–ß–/– testes with levels significantly higher already at 8 months and increasing then from 28 to 60 µg/mg at 18 months. Triglyceride levels were variable among groups because the animals were not fasted before tissue was taken. However, the LXR{alpha}–/–ß–/– testes contained significantly increased amounts of triglycerides at 8 months, 18 µg/mg vs. WT 6 µg/mg, and at 18 months, 40 µg/mg vs. WT 3 µg/mg (Fig. 3BGo), highlighting another difference between the two mouse genotypes.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 3. Quantification of sterol levels from WT and LXR–/– testes extracts. The first graph (A) shows total cholesterol levels (micrograms per milligram tissue) and the second (B) triglyceride levels (microgams per milligram tissue) from 2.5, 8, 11, and 18 months of age. The data are expressed as mean ± SEM, LXR–/– vs. WT. *, P < 0.05; **, P < 0.001. C, GC-MS was used to further determine the concentration of oxysterols (7{alpha}-OH, 7ß-OH, 7-Oxo, 24S-OH, and 27-OH) at 18 months of age. The data are expressed as mean level of oxysterol/cholesterol (nanograms per microgram) ± SEM, LXR–/– vs. WT. *, P < 0.01.

 
To further investigate the localization of the lipid droplets, WT and LXR{alpha}–/–ß–/– testes were examined by electron microscopy. At 10 months of age, large droplets were visible in the adluminal compartment within the cytoplasm of the Sertoli cells, with smaller droplets close to the basement membranes (Fig. 4Go, A, B). No droplets were present within the cells of the developing germ cells. Further examination of the seminiferous epithelium showed that the basement membrane of the Sertoli cells was intact at this age, with no evidence of macrophages infiltrating into the epithelium from the interstitium. The lipid was clearly contained within membrane vesicles.



View larger version (178K):
[in this window]
[in a new window]
 
FIG. 4. Electron micrographs of WT and LXR{alpha}–/–ß–/– testes at 10 months of age. Electron microscopy was used to more fully investigate the localization and amount of lipid droplets (LD) in the testis. The top panel (A and B) is a representative seminiferous epithelium showing the basement membrane (BM), the basal part of the Sertoli cell (SC), and germ cell nuclei (GC). Also highlighted is an artifact produced during the processing (*). The bottom panel (C and D) is a representative interstitium showing a Leydig cell (LN) full of lipid droplets and an attached macrophage (M). Bar, 5 µm.

 
The level of certain oxysterols are reduced in LXR–/– testes at 18 months
We further analyzed the content of the lipid droplets in 18-month-old testes using a sensitive isotope dilution mass spectrometry technique and determined that the cholesterol-related levels of 7-oxygenated oxysterols; 7{alpha}-OH, 7ß-OH, and 7-Oxo were unaffected by genotype (Fig. 3CGo). Because these oxysterols may be found as autooxidation products in biological systems, the levels reported here most likely represent an overestimation of the in vivo situation. However, cholesterol-related levels of the side-chain oxidized oxysterols 24S-OH and 27-OH that are not formed by autooxidation were found to be significantly decreased (P < 0.01) in both the LXRß–/– and LXR{alpha}–/–ß–/– groups (Fig. 3CGo). Due to technical limitations, accurate quantitation of 25-hydroxycholesterol levels was not possible. However, based on limited data from this sample group, the levels of this oxysterol were at a similar level to that of the other side-chain oxidized oxysterols (results not shown).

The Leydig cells do not accumulate excess lipid droplets
To more closely examine the steroidogenic Leydig cells, testis sections were immunohistochemically stained for the P450scc enzyme. This enzyme is responsible for the rate-limiting conversion of cholesterol to pregnenolone and is localized only within Leydig cells. Histological analysis showed no gross abnormalities in the structure of these cells and no noticeable accumulation of large lipid droplets. It is possible that they became hyperplastic at around 10 months of age in the LXR{alpha}–/–ß–/– testis (Fig. 5OGo) and at around 20 months of age in the LXRß–/– testis (Fig. 5LGo); however, this was not quantified and may be a result of tubular shrinkage. By 20 months there were no Leydig cells remaining in the LXR{alpha}–/–ß–/– testis, only cell remnants (Fig. 5PGo).



View larger version (137K):
[in this window]
[in a new window]
 
FIG. 5. Histological analyses of the Leydig cells. Because Leydig cells can be difficult to visualize with normal histological stains, frozen testis sections from WT (A–D), LXR{alpha}–/– (E–H), LXRß–/– (I–L), and LXR{alpha}–/–ß–/– (M–P) mice at four different age groups were immunostained with the P450scc enzyme. This enzyme is part of the steroidogenic pathway and is found only in these cells. Each micrograph shows a representative seminiferous tubule with the surrounding Leydig cells stained brown. Bar, 50 µm.

 
Ultrastructural electron microscopic analysis of the LXR{alpha}–/–ß–/– Leydig cells at 10 months of age indicated that they had similar quantities of lipid droplets as WT mice (Fig. 4Go, C and D). Further analyses revealed that the structure of the interstitial macrophages also appeared to be normal with no evidence of lipid and/or foam cell accumulation.

Serum and intratesticular steroid levels are abnormal when LXRs are disrupted
Serum testosterone and LH were measured to investigate the function of the Leydig cells in the LXR{alpha}–/–ß–/– mice. Although the levels were variable and significance not reached, there was a trend for testosterone to be reduced at 10 and 21 months of age (Fig. 6AGo) and LH to have increased at 10 months (Fig. 6BGo). FSH was also measured, and levels were significantly increased in the LXR{alpha}–/–ß–/– mice at 10 months of age (Fig. 6CGo).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 6. Serum hormone levels. The top graph (A) shows serum testosterone levels from WT and LXR{alpha}–/–ß–/– mice at 2.5 and 10 months of age. The middle graph (B) shows serum LH levels from mice at 2.5 and 10 months of age. And the lower graph (C) shows FSH levels from WT and LXR{alpha}–/–ß–/– mice at 2.5 and 10 months of age. The data are expressed as mean (milligrams per milliliter) ± SEM, LXR–/– vs. WT at each age. *, P < 0.05.

 
To more accurately measure steroid hormone synthesis within the Leydig cells, intratesticular concentrations of testosterone, progesterone, and androstenedione were also measured (Fig. 7Go). Steroid concentrations in the LXR–/– testis at 8 months were 5-fold lower than WT. However, WT levels dramatically declined to knockout levels by 21 months of age. In contrast, LXR{alpha}–/– levels tended to increase with age.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 7. Intratesticular steroid concentrations in WT and LXR–/– frozen testes at 8, 10, and 21 months of age. The data are expressed as mean (nanograms per gram) ± SEM of the sum of concentrations of progesterone, androstenedione, and testosterone. WT 8 months vs. WT 21 months, {dagger}{dagger}, P < 0.01; WT 8 months vs. LXR–/– 8 months, **, P < 0.001.

 
LXRß is the dominant isoform within the mouse testis
Because removing a functional LXR had such a profound effect on the testis, it was important to determine whether this effect was a direct consequence of inactivating LXR. Real-time PCR with total RNA extracted from whole testes revealed that LXRß was the dominant LXR in the testes, with LXRß mRNA 7-fold higher than LXR{alpha} mRNA in WT mice (fold change, LXR{alpha} 1 ± 0.3; LXRß 6.9 ± 1.0).

LXR regulates the same target genes in the testis as in other cells
To investigate whether LXR functions in a similar way in the testis as has been shown in other cells, expression of known LXR target genes were analyzed by real-time PCR after administration of the LXR synthetic agonist T0901317 (Table 3Go). In whole testis, expression of two known LXR target genes, SREBP1c and ABCG1, increased significantly when compared with untreated mice. Expression of these same two genes as well as ABCA1 was also elevated significantly in the Sertoli cell line treated with T0901317. Interestingly, in whole testis, expression of HMG CoA reductase decreased after treatment with T0901317.

Analysis of genes involved in cholesterol pathways reveals differences between WT and LXRß–/– mice
To investigate the mechanism behind the accumulation of cholesterol in the LXRß–/– testis, a selection of genes involved in cholesterol homeostasis were analyzed in WT and LXRß–/– whole testes (Table 4Go). There was no change in the levels of any of the genes at 2.5 months of age (data not shown; see Table 4Go for genes).

By 6 months of age, the expression of cytochrome P450 CYP51, responsible for forming the intermediate testis meiosis-activating sterol in the cholesterol pathway, had increased (Table 4Go), whereas the expression of HMG CoA reductase and HMG CoA synthase, the rate-limiting enzymes in cholesterol biosynthesis, were unchanged. There was no change in ABCA1 or ABCG1. There was also no change in the levels of the lipoprotein receptors.

By 10 months of age, CYP51 was no longer up-regulated but had significantly declined in expression back to WT levels. There was a significant up-regulation of the NPC1 gene, suggesting lysosomal trafficking was being activated. Finally, the expression level of the cholesterol sensor SREBP-2 was significantly decreased in the LXRß–/– whole testes, as was the level of the FSH receptor (FSH-R).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is well established in metabolically active tissues such as liver and intestine that the LXR is crucial in the regulation of cholesterol homeostasis; however, its function in organs such as the testis has previously not been explored in any depth. In this respect, our detailed findings showing that LXRß is highly important in testicular function and necessary for regulating lipid homeostasis in the Sertoli cells is of considerable significance in providing a more complete understanding of LXR function.

Morphological characterization of the LXRß–/– testes highlighted small cholesterol droplets within the basal compartment of the Sertoli cells from as early as at 2.5 months; however, because spermatogenesis continued to progress normally in these young animals and they were still able to sire litters, it is likely that the droplets were not severely impairing Sertoli cell function. However, as the droplets became more numerous and larger, by 10 months of age, we observed an absence of mature germ cells, although spermatogonia and spermatocytes were still present and the structure of Sertoli cells remained somewhat intact. To correlate with this, LXRß–/– breeding pairs ceased to sire litters at around the same age, therefore suggesting that these two events are related. Gene expression data from whole testis clearly indicated that the LXRß was the dominant transcript within the testis. Furthermore, a detailed expression study performed by Annicotte et al. (44) showed that LXRß is expressed in the seminiferous tubules as early as 16.5 d post conception and specifically in the Sertoli cells in the adult. This correlates with our morphological observations and highlights the importance of the LXRß in these cells. In contrast, LXR{alpha} was undetectable with in situ hybridization (44), and because the LXR{alpha}–/– mice showed no lipid accumulation and had normal spermatogenesis, it indicates that the presence of only the ß-subtype is enough to maintain homeostasis of cholesterol in the testis.

However, it is pertinent to note that when both isoforms were nonfunctional, as in the LXR{alpha}–/–ß–/– mouse, the testicular phenotype seemed to be different and more destructive from that seen in the LXRß–/– mouse. This was observed when initially breeding the mice, with males lacking both LXR subtypes only siring litters until approximately 4 months of age. The morphology of the testis also differed with the LXR{alpha}–/–ß–/– mice having not only more cholesterol within the seminiferous epithelium at 6 months of age, compared with the LXRß–/– testes, but also extremely dilated lumina with a thinner epithelium and the absence of all mature spermatids. By 18 months of age, LXR{alpha}–/–ß–/– testes are severely atrophic and contain a different cellular population from that present in the LXRß/ testis. In this respect, it is very difficult to compare the testes of the two mouse genotypes with each other at this age, other than to conclude that they both contain significantly higher amounts of cholesterol than WT controls.

A recent study has localized both LXR{alpha} and -ß to the proximal region of the caput, a region of the epididymis that has crucial secretory and reabsorptive functions (45, 46). In the LXR{alpha}–/–ß–/– mice, the epithelial cells in this region were observed to accumulate lipid droplets with age. Thus, these cells would presumably have impaired reabsorptive functions preventing the reabsorption of the luminal fluid by the ductal epithelium, allowing it to form a backpressure that would impair developing sperm. This would most likely cause the observed diluted lumen in the LXR{alpha}–/–ß–/– testes. The authors found this did not occur in the single knockout testes; therefore, unlike in the Sertoli cells in which LXRß is the prominent isoform, both isoforms are able compensate for each other to regulate cholesterol homeostasis in the cauda epididymis. However, it cannot be excluded that the dilated lumina also results from excess fluid secretion by the Sertoli cells (47) and that the LXRs also play an important function in regulating the movement of fluid from the interstitial space to the lumen.

The accumulation of cholesterol droplets in the LXR–/– testes impairs Sertoli cell function with age, observed by the elevation in serum FSH levels by 10 months of age in the LXR{alpha}–/–ß–/– mice, presumably resulting from a decline in inhibin-B secretion from Sertoli cells (48). FSH is crucial for Sertoli cell proliferation in the prepubertal testis, and thus sperm output in adulthood (49), with mice lacking a functional FSH-R knockout presenting with undeveloped testes and reduced fertility (50, 51). However, FSH also plays a role in the mature rodent, not only in the secretion of proteins such as inhibin-B from Sertoli cells, which act at the pituitary to negatively regulate FSH, but also in the maturation of early germ cells (52). Our results showing a significant down-regulation of the FSH-R at 10 months of age in the LXRß–/– mouse testis further suggests that FSH levels, although elevated, would be unable to promote normal Sertoli cell function. It also indicates that Sertoli cell number was significantly reduced and/or that the cells were less functional. Because the Sertoli cells and developing germ cells have a unique communicatory network (53), it is not surprising that we also observed a loss in developing germ cells in the LXRß–/– mouse testis.

It has been reported that RXRß null mice have an almost identical testicular phenotype to the LXR null mice with excessive Sertoli cell lipid accumulation (54). Although initial experiments indicated that the lipid droplets contained triglycerides, a recent study has found that these droplets mainly contain cholesterol esters (55). Because the RXRß is a known heterodimeric partner of the LXR (56), it is reasonable to assume that these effects are LXR related. Recent studies have also highlighted the importance of the steroid receptor coactivator (SRC) family of coactivators in Sertoli cell lipid homeostasis because the transcription intermediary factor (TIF)-2-null mice present with lipid droplets within the Sertoli cells (57) with this phenotype exacerbated when transcription intermediary factor-2 and either or both steroid receptor coactivator-1 alleles are knocked out (58).

To exclude the possibility that the observed morphological and biochemical phenotype was due to accumulation of oxysterols rather than the cholesterol accumulation per se, the levels of oxysterols were measured in lipid extracts from 18-month-old mice of each genotype. Because the lipid accumulation at this time point represents the most extreme situation with respect to intragenotype differences, we hypothesized that analysis of these samples would be the most revealing in the context of oxysterol toxicity. The cytotoxic effects of oxysterols have been widely reported in the literature, in which they are taken as representative of the biological role of oxysterols (see Ref. 59 for a comprehensive survey of these experiments). However, because virtually all of these investigations of toxicity have been performed in the presence of supraphysiological levels of purified oxysterols, the in vivo relevance of these studies is difficult to address. Additionally, it has been demonstrated that oxysterol cytotoxicity may be quenched by cholesterol (60) and that a mixture of oxysterols is significantly less toxic than an individual oxysterol, even at concentrations vastly exceeding those found in vivo (61). In our study, no significant effect of genotype was observed on the cholesterol-related levels of 7-oxygenated oxysterols in the most extreme case of testicular lipid accumulation, indicating that these sterols are unlikely to contribute to the observed changes. Furthermore, because 24S- and 27-OH are relatively nontoxic, the decreased levels in LXRß-deficient animals are unlikely to contribute to the observed phenotype.

Unlike the Sertoli cells, the Leydig cells in the LXR{alpha}–/–ß–/– mouse have similar amounts of lipid droplets as WT mice at 10 months of age. Because Leydig cells compromise only 3–5% of the cell population in the rodent testis, it should be noted that the total cholesterol content measured in this study is not reflective of the amount stored within these cells. Rodent Leydig cells differ from other steroidogenic cells in that they preferentially use both de novo synthesis and stored cholesterol esters for the consistent, high levels of cholesterol substrate they require for steroidogenesis (62, 63). We therefore suggest that the Leydig cells do not require a functional LXRß for cholesterol homeostasis and may have alternative cell specific strategies for sensing high levels of cholesterol.

Further investigation into the function of the Leydig cells showed that serum testosterone had a strong tendency to decrease with age in LXR{alpha}–/–ß–/– mice, indicating that these cells are in fact less functional. However, because the Sertoli cells and Leydig cells also have a unique communicatory network, this is perhaps not surprising (53). By 20 months of age, all adult Leydig cells appear to have been destroyed in the LXR{alpha}–/–ß–/– mouse, although peripheral testosterone was still detected at this age. It is likely that the Leydig cell precursor cells, remaining in the interstitium, and the adrenals are the source of testosterone in the old LXR knockout mice, particularly because the assay employed to measure serum testosterone levels is highly sensitive. A further indication that these cells are not functioning appropriately is the elevated serum LH levels in old LXR{alpha}–/–ß–/– mice.

However, because serum testosterone values are not a sensitive measurement of Leydig cell function (64), we further investigated this by measuring intratesticular steroid concentrations. We show that steroid levels in the testis of LXR{alpha}–/–, ß–/–, and {alpha}–/–ß–/– mice at 8 months of age were about 5 times lower than in WT mice at the same age, suggesting low hormone biosynthetic activity of the Leydig cells in these mice. However, WT mice showed a significant age-dependent suppression of steroid levels, with a dramatic decrease (20-fold, compared with 8 month old mice) at 21 months. Interestingly, the steroid content in the testis of LXR{alpha}–/– mice tended to increase at 21 months, suggesting that the steroidogenic machinery in these mice is not affected with aging but in fact is functioning more effectively than in WT mice. One possible explanation for this age-associated decrease in testosterone levels in WT mice is the finding that LH levels tend to decline in aged rodents (65), resulting in chronic understimulation of Leydig cells by LH. The reduced testosterone production by aged rat Leydig cells is accompanied by reduced intracellular processing and metabolism of cholesteryl esters, resulting in less available free cholesterol for steroidogenesis (66).

We have clearly shown that the LXRs play a crucial role in regulating cholesterol homeostasis in the testis. It was previously unknown whether these receptors were functioning the same way in the testis as in other tissues. We further demonstrate that WT animals fed a diet containing the synthetic LXR agonist T0901317 for 7 d have an up-regulation of the known LXR target genes SREBP-1c and ABCG1 in their testes (17, 67). This was further demonstrated in MSC-1 cells treated with T0901317 for 24 h; in addition, ABCA1 was up-regulated in these cells (15). Thus, the LXR appeared to function similarly in the testis as in several other tissues.

Ordinarily, extreme levels of cholesterol activate specific intracellular sensors, i.e. the SREBP/SCAP complex, that in turn transcriptionally regulates genes to reduce these levels (1, 68). However, it is clear that, in the absence of LXR, these regulatory systems fail to function properly in the Sertoli cells. Although our gene expression analyses show a decrease in the expression of SREBP-2 in the older LXRß–/– mice, which may be expected in the case of high intracellular cholesterol, it is well established that it is the inhibition of SREBP-2 protein activity that is important in the SREBP/SCAP regulatory system. Therefore this feedback mechanism may not be functioning appropriately. We also observed an increase in the expression of testicular CYP51. This enzyme is responsible for producing testis meiosis-activating sterol, an intermediate in the postlanosterol pathway that is normally rapidly converted to cholesterol but in the testis levels are normally high (69). Interestingly, CYP51 is up-regulated primarily by a cAMP response element modulator, not by SREBPs, and therefore sterol levels may be sensed independently of SREBP in Sertoli cells. It was suggested that some of the meiosis-activating sterol compounds were in fact ligands of LXR (70, 71); one group (72), however, has questioned this finding because there is no correlation between activation of LXR{alpha} and stimulation of meiosis.

Normally, Sertoli cells acquire cholesteryl esters via HDL-ApoE binding to the LDLR and VLDLR (27, 28). Although we did not see an up-regulation of these receptors, which might have indicated that excess cholesterol is entering via this pathway, we did see a significant up-regulation of the NPC1 mRNA at 10 months. Because the NPC1 is responsible for shuttling free cholesterol into the plasma membrane, mitochondria, endoplasmic reticulum, and Golgi apparatus (73), this might suggest that there is increased movement of cholesterol within the Sertoli cell. The Sertoli cells do not appear to acquire this excess cholesterol through de novo synthesis because there is no increase in the expression of HMG CoA reductase or HMG CoA synthase. It is pertinent to point out here that by 10 months of age, the destruction within the LXRß–/– testis is clearly underway, with mature germ cells missing in most tubules. Although we chose this age because we felt it still retained the majority of the cell population, the absence of some cells may influence the results obtained from this part of our study.

Excess cholesterol is normally effluxed from a cell to circulating ApoA1-HDL when levels are high, LXR being responsible for up-regulating the ABC family of transporters (15, 17, 18). Because one group (74) recently found high expression of ABCA1 in MSCs and another (74) reported excessive lipid deposition in the Sertoli cells with age in the ABCA1 null mouse, an attractive mechanism for the testis phenotype would be a failure of ABCA1 to be up-regulated and a subsequent trapping of cholesterol within the Sertoli cells. However, we consistently do not see a down-regulation of ABCA1 expression in our knockout mice. This differs from the findings of another group, reporting a 30% decline in expression of ABCA1 in the LXRß–/– testis (55). It should be pointed out here that there are significant differences between our mouse strain and theirs, our mice having been backcrossed for seven generations to an almost pure Black 6 strain.

We have clearly shown that in the absence of LXRß, the regulatory systems that maintain cholesterol homeostasis in Sertoli cells fail to function correctly; thus, cholesterol accumulates to such extreme levels as to lead to complete testicular cellular destruction. LXR{alpha}, on the other hand, does not have the same role and is unable to compensate for the loss of LXRß, although the absence of both isoforms produces a phenotype that is more destructive. Interestingly, the importance of LXRß in the testis appears to be specific for the Sertoli cells with the steroidogenic Leydig cells not appearing to require these receptors for cholesterol homeostasis. Through gene expression analyses, we show that whereas the precise molecular mechanism of LXRß in regulating cholesterol homeostasis at this time remains unclear, it is likely to involve multiple components. In conclusion, this study has highlighted an important connection between cholesterol homeostasis and regulation of male fertility. This illustrates the diverse functions of the LXRs, and our findings may have important implications for patients with LXR-dependent disturbances in cholesterol metabolism.


    Acknowledgments
 
The authors thank Sandra Andersson, Dr. Ling Wang, and Dr. Margaret Warner for very helpful discussions and Dr. Paolo Parini for critical reading of the manuscript and statistical assistance.


    Footnotes
 
This work was supported by grants from the Swedish Cancer Fund, KaroBio AB, the Swedish Children’s Cancer Fund, the Wenner-Gren Foundation, the Swedish Medical Research Council, and the Swedish Brain Foundation.

First Published Online March 10, 2005

Abbreviations: ABC, ATP binding cassette; Apo, apolipoprotein acceptor; FSH-R, FSH receptor; GC-MS, gas chromatography/mass spectrometry; HDL, high-density lipoprotein; HMG CoA, 3-hydroxy-3-methylglutaryl coenzyme A; LDL, low-density lipoprotein; LDLR, LDL receptor; LXR, liver X receptor; MSC, mouse Sertoli cell; NPC1, Niemann Pick-1; 7{alpha}-OH, 7{alpha}-hydroxycholesterol; 7ß-OH, 7ß-hydroxycholesterol; 24S-OH, 24S-hydroxycholesterol; 27-OH, 27-hydroxycholesterol; 7-Oxo, 7-oxocholesterol; P450scc, P450 side chain cleavage enzyme; RXR, retinoid X receptor; SCAP, SREBP cleavage-activating protein; SR, scavenger receptor; SREBP, sterol regulatory binding protein; VLDLR, very low-density lipoprotein receptor; WT, wild type.

Received October 27, 2004.

Accepted for publication March 3, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Brown MS, Goldstein JL 1999 A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc Natl Acad Sci USA 96:11041–11048[Abstract/Free Full Text]
  2. Dobrosotskaya IY, Goldstein JL, Brown MS, Rawson RB 2003 Reconstitution of sterol-regulated endoplasmic reticulum-to-Golgi transport of SREBP-2 in insect cells by coexpression of mammalian SCAP and Insigs. J Biol Chem 278:35837–35843[Abstract/Free Full Text]
  3. Rawson RB 2003 Control of lipid metabolism by regulated intramembrane proteolysis of sterol regulatory element binding proteins (SREBPs). Biochem Soc Symp 221–231
  4. Shimano H 2001 Sterol regulatory element-binding proteins (SREBPs): transcriptional regulators of lipid synthetic genes. Prog Lipid Res 40:439–452[CrossRef][Medline]
  5. Ginsberg HN 1998 Lipoprotein physiology. Endocrinol Metab Clin North Am 27:503–519[CrossRef][Medline]
  6. Trigatti B, Rigotti A, Krieger M 2000 The role of the high-density lipoprotein receptor SR-BI in cholesterol metabolism. Curr Opin Lipidol 11:123–131[CrossRef][Medline]
  7. Chiang JY 2002 Bile acid regulation of gene expression: roles of nuclear hormone receptors. Endocr Rev 23:443–463[Abstract/Free Full Text]
  8. Toth PP 2003 Reverse cholesterol transport: high-density lipoprotein’s magnificent mile. Curr Atheroscler Rep 5:386–393[Medline]
  9. Oram JF, Yokoyama S 1996 Apolipoprotein-mediated removal of cellular cholesterol and phospholipids. J Lipid Res 37:2473–2491[Abstract]
  10. Millatt LJ, Bocher V, Fruchart JC, Staels B 2003 Liver X receptors and the control of cholesterol homeostasis: potential therapeutic targets for the treatment of atherosclerosis. Biochim Biophys Acta 1631:107–118[Medline]
  11. Redinger RN 2003 The role of the enterohepatic circulation of bile salts and nuclear hormone receptors in the regulation of cholesterol homeostasis: bile salts as ligands for nuclear hormone receptors. Can J Gastroenterol 17:265–271[Medline]
  12. Seol W, Choi HS, Moore DD 1995 Isolation of proteins that interact specifically with the retinoid X receptor: two novel orphan receptors. Mol Endocrinol 9:72–85[Abstract/Free Full Text]
  13. Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA, Mangelsdorf DJ 1995 LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes Dev 9:1033–1045[Abstract/Free Full Text]
  14. Muscat GE, Wagner BL, Hou J, Tangirala RK, Bischoff ED, Rohde P, Petrowski M, Li J, Shao G, Macondray G, Schulman IG 2002 Regulation of cholesterol homeostasis and lipid metabolism in skeletal muscle by liver X receptors. J Biol Chem 277:40722–40728[Abstract/Free Full Text]
  15. Costet P, Luo Y, Wang N, Tall AR 2000 Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J Biol Chem 275:28240–28245[Abstract/Free Full Text]
  16. Repa JJ, Turley SD, Lobaccaro JA, Medina J, Li L, Lustig K, Shan B, Heyman RA, Dietschy JM, Mangelsdorf DJ 2000 Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science 289:1524–1529[Abstract/Free Full Text]
  17. Kennedy MA, Venkateswaran A, Tarr PT, Xenarios I, Kudoh J, Shimizu N, Edwards PA 2001 Characterization of the human ABCG1 gene: liver X receptor activates an internal promoter that produces a novel transcript encoding an alternative form of the protein. J Biol Chem 276:39438–39447[Abstract/Free Full Text]
  18. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ 2002 Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors {alpha} and ß. J Biol Chem 277:18793–18800[Abstract/Free Full Text]
  19. Fayard E, Schoonjans K, Auwerx J 2001 Xol INXS: role of the liver X and the farnesol X receptors. Curr Opin Lipidol 12:113–120[CrossRef][Medline]
  20. Oram JF, Vaughan AM 2000 ABCA1-mediated transport of cellular cholesterol and phospholipids to HDL apolipoproteins. Curr Opin Lipidol 11:253–260[CrossRef][Medline]
  21. Malerod L, Juvet LK, Hanssen-Bauer A, Eskild W, Berg T 2002 Oxysterol-activated LXR{alpha}/RXR induces hSR-BI-promoter activity in hepatoma cells and preadipocytes. Biochem Biophys Res Commun 299:916–923[CrossRef][Medline]
  22. Schuster GU, Parini P, Wang L, Alberti S, Steffensen KR, Hansson GK, Angelin B, Gustafsson JA 2002 Accumulation of foam cells in liver X receptor-deficient mice. Circulation 106:1147–1153[Abstract/Free Full Text]
  23. Russell LD, Griswold MD 1993 The Sertoli cell. 1st ed. Clearwater, FL: Cache River Press
  24. Yurchenco PD, Schittny JC 1990 Molecular architecture of basement membranes. FASEB J 4:1577–1590[Abstract]
  25. Maboundou JC, Fofana M, Fresnel J, Bocquet J, Le Goff D 1995 Effect of lipoproteins on cholesterol synthesis in rat Sertoli cells. Biochem Cell Biol 73:67–72[Medline]
  26. Fofana M, Travert C, Carreau S, Le Goff D 2000 Evaluation of cholesteryl ester transfer in the seminiferous tubule cells of immature rats in vivo and in vitro. J Reprod Fertil 118:79–83
  27. Li Y, Cam J, Bu G 2001 Low-density lipoprotein receptor family: endocytosis and signal transduction. Mol Neurobiol 23:53–67[CrossRef][Medline]
  28. Shimano H, Fukazawa C, Shibasaki Y, Mori N, Gotoda T, Harada K, Shimada M, Yamada N, Yazaki Y, Takaku F 1991 The effect of apo E secretion on lipoprotein uptake in transfected cells. Biochim Biophys Acta 1086:245–254[Medline]
  29. Shiratsuchi A, Kawasaki Y, Ikemoto M, Arai H, Nakanishi Y 1999 Role of class B scavenger receptor type I in phagocytosis of apoptotic rat spermatogenic cells by Sertoli cells. J Biol Chem 274:5901–5908[Abstract/Free Full Text]
  30. Temel RE, Trigatti B, DeMattos RB, Azhar S, Krieger M, Williams DL 1997 Scavenger receptor class B, type I (SR-BI) is the major route for the delivery of high density lipoprotein cholesterol to the steroidogenic pathway in cultured mouse adrenocortical cells. Proc Natl Acad Sci USA 94:13600–13605[Abstract/Free Full Text]
  31. Alberti S, Schuster G, Parini P, Feltkamp D, Diczfalusy U, Rudling M, Angelin B, Bjorkhem I, Pettersson S, Gustafsson JA 2001 Hepatic cholesterol metabolism and resistance to dietary cholesterol in LXRß-deficient mice. J Clin Invest 107:565–573[Medline]
  32. Nicoletti A, Kaveri S, Caligiuri G, Bariety J, Hansson GK 1998 Immunoglobulin treatment reduces atherosclerosis in apo E knockout mice. J Clin Invest 102:910–918[Medline]
  33. Angermuller S, Fahimi HD 1982 Imidazole-buffered osmium tetroxide: an excellent stain for visualization of lipids in transmission electron microscopy. Histochem J 14:823–835[CrossRef][Medline]
  34. Dzeletovic S, Breuer O, Lund E, Diczfalusy U 1995 Determination of cholesterol oxidation products in human plasma by isotope dilution-mass spectrometry. Anal Biochem 225:73–80[CrossRef][Medline]
  35. McGuinness MP, Linder CC, Morales CR, Heckert LL, Pikus J, Griswold MD 1994 Relationship of a mouse Sertoli cell line (MSC-1) to normal Sertoli cells. Biol Reprod 51:116–124[Abstract]
  36. Stulnig TM, Steffensen KR, Gao H, Reimers M, Dahlman-Wright K, Schuster GU, Gustafsson JA 2002 Novel roles of liver X receptors exposed by gene expression profiling in liver and adipose tissue. Mol Pharmacol 62:1299–1305[Abstract/Free Full Text]
  37. Yang J, Goldstein JL, Hammer RE, Moon YA, Brown MS, Horton JD 2001 Decreased lipid synthesis in livers of mice with disrupted Site-1 protease gene. Proc Natl Acad Sci USA 98:13607–13612[Abstract/Free Full Text]
  38. Liang G, Yang J, Horton JD, Hammer RE, Goldstein JL, Brown MS 2002 Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c. J Biol Chem 277:9520–9528[Abstract/Free Full Text]
  39. Steffensen KR, Nilsson M, Schuster GU, Stulnig TM, Dahlman-Wright K, Gustafsson JA 2003 Gene expression profiling in adipose tissue indicates different transcriptional mechanisms of liver X receptors {alpha} and ß, respectively. Biochem Biophys Res Commun 310:589–593[CrossRef][Medline]
  40. Haavisto AM, Pettersson K, Bergendahl M, Perheentupa A, Roser JF, Huhtaniemi I 1993 A supersensitive immunofluorometric assay for rat luteinizing hormone. Endocrinology 132:1687–1691[Abstract/Free Full Text]
  41. van Casteren JI, Schoonen WG, Kloosterboer HJ 2000 Development of time-resolved immunofluorometric assays for rat follicle-stimulating hormone and luteinizing hormone and application on sera of cycling rats. Biol Reprod 62:886–894[Abstract/Free Full Text]
  42. Nnane IP, Njar VC, Liu Y, Lu Q, Brodie AM 1999 Effects of novel 17-azolyl compounds on androgen synthesis in vitro and in vivo. J Steroid Biochem Mol Biol 71:145–152[CrossRef][Medline]
  43. Joseph SB, Tontonoz P 2003 LXRs: new therapeutic targets in atherosclerosis? Curr Opin Pharmacol 3:192–197[CrossRef][Medline]
  44. Annicotte JS, Schoonjans K, Auwerx J 2004 Expression of the liver X receptor {alpha} and ß in embryonic and adult mice. Anat Rec 277A:312–316
  45. Ilio KY, Hess RA 1994 Structure and function of the ductuli efferentes: a review. Microsc Res Tech 29:432–467[CrossRef][Medline]
  46. Frenoux JM, Vernet P, Volle DH, Britan A, Saez F, Kocer A, Henry-Berger J, Mangelsdorf DJ, Lobaccaro JM, Drevet JR 2004 Nuclear oxysterol receptors, LXRs, are involved in the maintenance of mouse caput epididymis structure and functions. J Mol Endocrinol 33:361–375[Abstract/Free Full Text]
  47. Hinton BT, Setchell BP 1993 Fluid secretion and movement. In: Russell LD, Griswold MD, eds. The Sertoli cell. Clearwater, FL: Cache River Press; 249–268
  48. Meachem SJ, Nieschlag E, Simoni M 2001 Inhibin B in male reproduction: pathophysiology and clinical relevance. Eur J Endocrinol 145:561–571[Abstract]
  49. Simoni M, Weinbauer GF, Gromoll J, Nieschlag E 1999 Role of FSH in male gonadal function. Ann Endocrinol (Paris) 60:102–106[Medline]
  50. Dierich A, Sairam MR, Monaco L, Fimia GM, Gansmuller A, LeMeur M, Sassone-Corsi P 1998 Impairing follicle-stimulating hormone (FSH) signaling in vivo: targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc Natl Acad Sci USA 95:13612–13617[Abstract/Free Full Text]
  51. Krishnamurthy H, Danilovich N, Morales CR, Sairam MR 2000 Qualitative and quantitative decline in spermatogenesis of the follicle-stimulating hormone receptor knockout (FORKO) mouse. Biol Reprod 62:1146–1159[Abstract/Free Full Text]
  52. Meachem SJ, Wreford NG, Stanton PG, Robertson DM, McLachlan RI 1998 Follicle-stimulating hormone is required for the initial phase of spermatogenic restoration in adult rats following gonadotropin suppression. J Androl 19:725–735[Abstract/Free Full Text]
  53. Jegou B 1993 The Sertoli-germ cell communication network in mammals. Int Rev Cytol 147:25–96[Medline]
  54. Kastner P, Mark M, Leid M, Gansmuller A, Chin W, Grondona JM, Decimo D, Krezel W, Dierich A, Chambon P 1996 Abnormal spermatogenesis in RXR ß mutant mice. Genes Dev 10:80–92[Abstract/Free Full Text]
  55. Mascrez B, Ghyselinck NB, Watanabe M, Annicotte JS, Chambon P, Auwerx J, Mark M 2004 Ligand-dependent contribution of RXRß to cholesterol homeostasis in Sertoli cells. EMBO Rep 5:285–290[CrossRef][Medline]
  56. Boulogne B, Levacher C, Durand P, Habert R 1999 Retinoic acid receptors and retinoid X receptors in the rat testis during fetal and postnatal development: immunolocalization and implication in the control of the number of gonocytes. Biol Reprod 61:1548–1557[Abstract/Free Full Text]
  57. Gehin M, Mark M, Dennefeld C, Dierich A, Gronemeyer H, Chambon P 2002 The function of TIF2/GRIP1 in mouse reproduction is distinct from those of SRC-1 and p/CIP. Mol Cell Biol 22:5923–5937[Abstract/Free Full Text]
  58. Mark M, Yoshida-Komiya H, Gehin M, Liao L, Tsai MJ, O’Malley BW, Chambon P, Xu J 2004 Partially redundant functions of SRC-1 and TIF2 in postnatal survival and male reproduction. Proc Natl Acad Sci USA 101:4453–4458[Abstract/Free Full Text]
  59. Schroepfer Jr GJ 2000 Oxysterols: modulators of cholesterol metabolism and other processes. Physiol Rev 80:361–554[Abstract/Free Full Text]
  60. Clare K, Hardwick SJ, Carpenter KL, Weeratunge N, Mitchinson MJ 1995 Toxicity of oxysterols to human monocyte-macrophages. Atherosclerosis 118:67–75[CrossRef][Medline]
  61. Biasi F, Leonarduzzi G, Vizio B, Zanetti D, Sevanian A, Sottero B, Verde V, Zingaro B, Chiarpotto E, Poli G 2004 Oxysterol mixtures prevent proapoptotic effects of 7-ketocholesterol in macrophages: implications for proatherogenic gene modulation. FASEB J 18:693–695[Abstract/Free Full Text]
  62. Reaven E, Zhan L, Nomoto A, Leers-Sucheta S, Azhar S 2000 Expression and microvillar localization of scavenger receptor class B, type I (SR-BI) and selective cholesteryl ester uptake in Leydig cells from rat testis. J Lipid Res 41:343–356[Abstract/Free Full Text]
  63. Freeman DA, Rommerts FF 1996 Regulation of Leydig cell cholesterol transport. In: Payne AH, Hardy MP, Russell DW, eds. The Leydig cell. Vienna, IL: Cache River Press; 232–239
  64. Steinberger E, Root A, Ficher M, Smith KD 1973 The role of androgens in the initiation of spermatogenesis in man. J Clin Endocrinol Metab 37:746–751[Abstract/Free Full Text]
  65. Gray GD 1978 Changes in the levels of luteinizing hormone and testosterone in the circulation of ageing male rats. J Endocrinol 76:551–552[Abstract/Free Full Text]
  66. Liao C, Reaven E, Azhar S 1993 Age-related decline in the steroidogenic capacity of isolated rat Leydig cells: a defect in cholesterol mobilization and processing. J Steroid Biochem Mol Biol 46:39–47[CrossRef][Medline]
  67. Repa JJ, Liang G, Ou J, et al 2000 Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXR{alpha} and LXRß. Genes Dev 14:2819–2830[Abstract/Free Full Text]
  68. Frolov A, Zielinski SE, Crowley JR, Dudley-Rucker N, Schaffer JE, Ory DS 2003 NPC1 and NPC2 regulate cellular cholesterol homeostasis through generation of LDL-derived oxysterols. J Biol Chem 278:25517–25525[Abstract/Free Full Text]
  69. Stromstedt M, Waterman MR, Haugen TB, Tasken K, Parvinen M, Rozman D 1998 Elevated expression of lanosterol 14{alpha}-demethylase (CYP51) and the synthesis of oocyte meiosis-activating sterols in postmeiotic germ cells of male rats. Endocrinology 139:2314–2321[Abstract/Free Full Text]
  70. Forman BM, Ruan B, Chen J, Schroepfer Jr GJ, Evans RM 1997 The orphan nuclear receptor LXR{alpha} is positively and negatively regulated by distinct products of mevalonate metabolism. Proc Natl Acad Sci USA 94:10588–10593[Abstract/Free Full Text]
  71. Ruan B, Watanabe S, Eppig JJ, Kwoh C, Dzidic N, Pang J, Wilson WK, Schroepfer Jr GJ 1998 Sterols affecting meiosis: novel chemical syntheses and the biological activity and spectral properties of the synthetic sterols. J Lipid Res 39:2005–2020[Abstract/Free Full Text]
  72. Grondahl C, Ottesen JL, Lessl M, Faarup P, Murray A, Gronvald FC, Hegele-Hartung C, Ahnfelt-Ronne I 1998 Meiosis-activating sterol promotes resumption of meiosis in mouse oocytes cultured in vitro in contrast to related oxysterols. Biol Reprod 58:1297–1302[Abstract/Free Full Text]
  73. Garver WS, Heidenreich RA 2002 The Niemann-Pick C proteins and trafficking of cholesterol through the late endosomal/lysosomal system. Curr Mol Med 2:485–505[CrossRef][Medline]
  74. Selva DM, Hirsch-Reinshagen V, Burgess B, Zhou S, Chan J, McIsaac S, Hayden MR, Hammond GL, Vogl AW, Wellington CL 2004 The ATP-binding cassette transporter ABCA1 mediates lipid efflux from Sertoli cells and influences male fertility. J Lipid Res 45:1040–1050[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Lipid Res.Home page
A. Ouvrier, R. Cadet, P. Vernet, B. Laillet, J.-M. Chardigny, J.-M. A. Lobaccaro, J. R. Drevet, and F. Saez
LXR and ABCA1 control cholesterol homeostasis in the proximal mouse epididymis in a cell-specific manner
J. Lipid Res., September 1, 2009; 50(9): 1766 - 1775.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Mouzat, F. Volat, S. Baron, G. Alves, A. J. C. Pommier, D. H. Volle, G. Marceau, A. DeHaze, P. Dechelotte, R. Duggavathi, et al.
Absence of Nuclear Receptors for Oxysterols Liver X Receptor Induces Ovarian Hyperstimulation Syndrome in Mice
Endocrinology, July 1, 2009; 150(7): 3369 - 3375.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Gabbi, M. Warner, and J.-A. Gustafsson
Minireview: Liver X Receptor {beta}: Emerging Roles in Physiology and Diseases
Mol. Endocrinol., February 1, 2009; 23(2): 129 - 136.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H.-J. Kim, L. C. Andersson, D. Bouton, M. Warner, and J.-A. Gustafsson
Stromal growth and epithelial cell proliferation in ventral prostates of liver X receptor knockout mice
PNAS, January 13, 2009; 106(2): 558 - 563.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. Fan, H.-J. Kim, D. Bouton, M. Warner, and J.-A. Gustafsson
Expression of liver X receptor {beta} is essential for formation of superficial cortical layers and migration of later-born neurons
PNAS, September 9, 2008; 105(36): 13445 - 13450.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H.-J. Kim, X. Fan, C. Gabbi, K. Yakimchuk, P. Parini, M. Warner, and J.-A. Gustafsson
Liver X receptor {beta} (LXR{beta}): A link between {beta}-sitosterol and amyotrophic lateral sclerosis-Parkinson's dementia
PNAS, February 12, 2008; 105(6): 2094 - 2099.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Gong, P. Guo, Y. Zhai, J. Zhou, H. Uppal, M. J. Jarzynka, W.-C. Song, S.-Y. Cheng, and W. Xie
Estrogen Deprivation and Inhibition of Breast Cancer Growth in Vivo through Activation of the Orphan Nuclear Receptor Liver X Receptor
Mol. Endocrinol., August 1, 2007; 21(8): 1781 - 1790.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
V. Drouineaud, P. Sagot, C. Garrido, E. Logette, V. Deckert, P. Gambert, C. Jimenez, B. Staels, L. Lagrost, and D. Masson
Inhibition of progesterone production in human luteinized granulosa cells treated with LXR agonists
Mol. Hum. Reprod., June 1, 2007; 13(6): 373 - 379.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. H. Volle, K. Mouzat, R. Duggavathi, B. Siddeek, P. Dechelotte, B. Sion, G. Veyssiere, M. Benahmed, and J.-M. A. Lobaccaro
Multiple Roles of the Nuclear Receptors for Oxysterols Liver X Receptor to Maintain Male Fertility
Mol. Endocrinol., May 1, 2007; 21(5): 1014 - 1027.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Mouzat, M. Prod'Homme, D. H. Volle, B. Sion, P. Dechelotte, K. Gauthier, J.-M. Vanacker, and J.-M. A. Lobaccaro
Oxysterol Nuclear Receptor LXRbeta Regulates Cholesterol Homeostasis and Contractile Function in Mouse Uterus
J. Biol. Chem., February 16, 2007; 282(7): 4693 - 4701.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
H. Wang, H. Wang, W. Xiong, Y. Chen, Q. Ma, J. Ma, Y. Ge, and D. Han
Evaluation on the phagocytosis of apoptotic spermatogenic cells by Sertoli cells in vitro through detecting lipid droplet formation by Oil Red O staining.
Reproduction, September 1, 2006; 132(3): 485 - 492.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Huyghe, H. Schmalbruch, K. De Gendt, G. Verhoeven, F. Guillou, P. P. Van Veldhoven, and M. Baes
Peroxisomal Multifunctional Protein 2 Is Essential for Lipid Homeostasis in Sertoli Cells and Male Fertility in Mice
Endocrinology, May 1, 2006; 147(5): 2228 - 2236.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. Papadopoulos
Cholesterol Homeostasis and Infertility: The Liver X Receptor Connection
Endocrinology, June 1, 2005; 146(6): 2517 - 2518.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robertson, K. M.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robertson, K. M.
Right arrow Articles by Gustafsson, J.-A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals