| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Medical Research Council Human Reproductive Sciences Unit (K.A.L.T., M.W., R.M.S., P.T.K.S.), Centre for Reproductive Biology, University of Edinburgh, Edinburgh EH16 4SB, Scotland, United Kingdom; Department of Developmental Biology (K.D.G., E.D., G.V.), Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, B-3000 Leuven, Belgium; and Institute of Experimental Morphology and Anthropology (N.A.), Bulgarian Academy of Science, 1113 Sofia, Bulgaria
Address all correspondence and requests for reprints to: Professor G. Verhoeven; Laboratory for Experimental Medicine and Endocrinology, Onderwijs en Navorsing, Gasthuisberg, Herestraat 49 bus 902, B-3000 Leuven, Belgium. E-mail: guido.verhoeven{at}med.kuleuven.ac.be.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
There are various lines of evidence that point to a role for androgens in the SC maturation process, although this is largely circumstantial (4, 6). Such a role for androgens seems intrinsically logical when considering that maturation and acquisition of full androgen responsiveness are prerequisites for SCs to support full spermatogenesis in adulthood, and notable in this regard is that the onset of androgen receptor (AR) expression in SCs precedes onset of SC maturation (4, 6). In contrast, until recently, it was generally believed that (in rodents) androgens played little if any role in SC proliferation, primarily because the AR is not normally expressed in SCs for the majority of the periods during which they proliferate (4, 6, 9). However, recent data from mice lacking a functional AR (10), microarray analysis of androgen-regulated transcripts in neonatal mice (11), and studies involving manipulation of androgen production/action in neonatal rats (12) demonstrate that androgens probably play a physiological role in promoting SC proliferation in fetal and early postnatal life in rodents. There is similar evidence for a role for androgens in postnatal SC proliferation in nonhuman primates (13, 14). These new findings raise a conundrum, namely how do androgens exert such a positive effect on SC proliferation in the absence of AR immunoexpression in fetal and early neonatal life? One obvious explanation is that androgens act via peritubular myoid cells to modify SC proliferation because there is clear in vitro evidence that the function of SCs can be modified by such interactions (15, 16). Alternatively, the proliferative effects of androgens on SCs might be mediated via membrane ARs or other nongenomic pathways because there is growing evidence from cell lines for a role for such systems, including effects on cell proliferation (17, 18). Indeed, it is apparent from a number of studies that such systems are present in SCs (19), and a recent study has identified one pathway via which nongenomic actions of androgens on SCs could play a role in spermatogenesis (20). Such developments might explain the inability of researchers to identify clear pathways via which genomic actions of androgens on SCs support spermatogenesis (4).
One approach to gaining insight into the above issues is to assess SC development and adult function in the absence of a functional (genomic) AR in AR0/Y mice (10, 21). However, this suffers from several potential problems. First, it is impossible in such animals to establish whether any observed effects result specifically from lack of androgen action on SCs, as opposed to effects on other testicular cells such as peritubular myoid cells. Second, because testes in such animals do not descend into the scrotum (which fails to form), there is the complication in adulthood of the confounding effects of elevated testicular temperature (10). The recent generation by ourselves (22) and others (23, 24) of mice with SC-selective knockout of the AR (SCARKO mice) has opened up new possibilities for elucidating the role that androgens play in regulating SC proliferation, maturation, and function. Moreover, by comparing these processes in SCARKO and complete AR knockout (AR0/Y; ARKO) mice, it is possible to gain key insights into the relative importance of direct (SC) and indirect (non-SC-mediated) effects of androgens on SCs. We used such an approach in the present studies and show that neither the effects of androgens on SC number nor the maturation-dependent change in expression of four SC markers require AR expression in SCs. In contrast, the ability of the SCs to support complete spermatogenesis, as well as expression of a number of SC genes, does require AR expression in SCs.
| Materials and Methods |
|---|
|
|
|---|
Antibodies for immunohistochemistry and their dilutions
Immunolocalization of AR used a rabbit polyclonal antibody (N20) raised against a peptide within the N-terminal domain of the human AR (sc-816; Santa Cruz Biotechnology, Santa Cruz, CA), which was diluted at 1:200. Mouse monoclonal antibody raised against p27kip1 (NCL-p27; Novocastra, Newcastle Upon Tyne, UK) was used at 1:40. GATA-1 (sc-0266; Santa Cruz Biotechnology) rat monoclonal IgG2a antibody was diluted 1:500 for use and goat polyclonal antibody (sc-6886; Santa Cruz Biotechnology) specific for AMH was used at 1:1000. Rabbit anti-sulfated glycoprotein (SGP)-2 polyclonal antibody, used at 1:100, was a gift from Dr. S. R. Sylvester (Department of Biochemistry and Biophysics, Washington State University, Pullman, WA). Pem antibody, used at 1:500, was kindly donated by Professor M. F. Wilkinson (Department of Immunology, University of Texas M. D. Anderson Cancer Center, Houston, TX).
Immunohistochemistry
Urogenital systems from wild-type (WT), ARflox, AMH-Cre, ARKO, and SCARKO males at ages d 2, 8, 12, 20, 50, and/or 140 were removed, weighed, and fixed in Bouins fluid for 46 h before transferring into 70% (vol/vol) ethanol. Testes and epididymides were dissected and processed into paraffin wax using standard methods. Immunohistochemistry was performed on dewaxed 5-µm sections in conjunction with heat-induced antigen retrieval for 5 min in 0.01 M citrate buffer (pH 6.0) (Sigma-Aldrich, Dorset, UK) using a pressure cooker (for AR, GATA-1, p27kip1, and Pem) or no retrieval (for AMH and SGP-2). This was followed by endogenous peroxidase blocking in 3% (vol/vol) H2O2 in methanol for 30 min at room temperature. All washes between antibody or reagent incubations comprised 2 x 5 min at room temperature in Tris-buffered saline [TBS, 0.05 M Tris (pH 7.4), 0.85% (vol/vol) saline]. Tissue sections were first blocked in the appropriate serum elaborated as follows for the different primary antibodies. Rabbit polyclonal primary antibodies were diluted in TBS containing normal swine serum (1:4; Diagnostics Scotland, Carluke, Lanarkshire, UK) and 5% (wt/vol) BSA (Sigma-Aldrich), whereas goat polyclonal and mouse and rat monoclonal antibodies were diluted in TBS containing normal rabbit serum (1:4; Diagnostics Scotland) and 5% (wt/vol) BSA. A swine antirabbit biotinylated second antibody (E0353; Dako, Cambridge, UK) was used in conjunction with rabbit polyclonal antibodies, whereas a rabbit antimouse biotinylated second antibody (E0464; Dako) was used to detect p27kip1 antibody. Biotinylated rabbit antirat secondary antibody (BA-4000; Vector Laboratories, Peterborough, UK) and rabbit antigoat antibody (BA-5000; Vector Laboratories) were used in combination with GATA-1 and AMH antibodies, respectively. All biotinylated secondary antibodies were diluted 1:500 in the appropriate blocking serum in TBS/BSA and incubated at room temperature for 30 min.
Bound antibodies were visualized by incubating the sections with avidin biotin complex-horseradish peroxidase reagent (K0355; Dako) for 30 min followed by color development using 3,3'-diaminobenzidine tetra-hydrochloride chromogenic substrate (K3468, liquid DAB+ kit; Dako), monitored microscopically. Sections were counterstained with hematoxylin, dehydrated, and mounted with Pertex. Images were captured using a Provis microscope (Olympus Optical Co., London, UK) equipped with a DCS330 camera (Eastman Kodak Co., Rochester, NY). Captured images were stored on a Macintosh computer and compiled using Photoshop 7.0 (Adobe, Mountain View, CA).
To enable comparative evaluation of the immunostaining, sections of tissues from control and knockout animals were processed in parallel on at least three occasions to ensure reproducibility of results; on each occasion tissue sections from four to six animals in each group were run. To ensure direct comparability of staining intensities, one section each from control, ARKO, and SCARKO mice were mounted on the same slide.
Determination of SC nuclear volume/number per testis and germ cell nuclear volume per unit SC
Standard stereological methods were used to determine cell nuclear volumes and/or number per testis in groups of five WT, ARflox, AMH-Cre, ARKO, and SCARKO mice (d 2, 50, and 140), using methods detailed elsewhere (12, 25, 26). In brief, cross-sections of testes were examined under oil immersion using a Leitz 63 x plan apo objective fitted to a Leitz laborlux microscope and a 121-point eyepiece graticule. Using a systematic clock-face sampling pattern from a random starting point, 16 fields were counted. Points falling over the nuclei of SC or germ cell nuclei were scored and expressed as a percentage of the total points counted. For each animal, the values for percentage nuclear volume were converted to absolute nuclear volumes per testis by reference to testis volume (weight) because shrinkage was minimal. SC nuclear volumes per testis equate to SC numbers per testis, assuming no change in average nuclear size. However, because the individual nuclear volume of SCs might be influenced by reduced germ cell complement in adult ARKO and SCARKO males, average SC nuclear volume was also determined in four to five animals per group at d 140, using methods similar to those described previously (26, 27). Briefly, images were captured from an Olympus BH2 microscope using a video camera (HV-C20; Hitachi, Tokyo, Japan) and were analyzed with Image Pro Plus software with a Stereology 5.0 plug-in (Media Cybernetics, Berkshire, UK). An area of interest was created by drawing around the SC nucleus, within which the computer program then determined the average length of several diameters measured at two-degree intervals, which passed through the center of the nucleus. This was measured for a minimum of 100 SC nuclei per testis and mean nuclear volume then determined. Data for SC nuclear volume per testis was then converted to absolute numbers of SC per testis by dividing by the average SC nuclear volume.
RNA analysis
Tissue samples were removed and snap frozen in liquid nitrogen. RNA of WT, AMH-Cre, ARflox, and SCARKO testes was prepared using the RNeasy midi kit (QIAGEN, Chatsworth, CA). Due to the small size, RNA from ARKO testes and its appropriate control, PGK-Cre testes, was extracted using the RNeasy mini kit (QIAGEN). Synthesis of cDNA from DNase I-treated total RNA (RNase-free DNase I set; QIAGEN) used Superscript II RNaseH reverse transcriptase and random hexamer primers (Invitrogen, Carlsbad, CA). To allow specific mRNA levels to be expressed per testis and control for the efficiency of RNA extraction, RNA degradation and the reverse transcription step, an external standard was used (10). The external standard was luciferase mRNA (Promega, Madison, WI), and 10 ng were added to each testis at the start of the RNA extraction procedure. For quantification of gene expression, the ABI Prism 7700 PCR detection system (Applied Biosystems, Foster City, CA) was used with a two-step RT-quantitative-PCR protocol. Components for real-time PCR were obtained from Applied Biosystems, apart from primers and probes (Eurogentec, Sar-Tilman, Belgium) and Sybrgreen (Sigma, St. Louis, MO). Each 25-µl real-time PCR contained 1x buffer A, 5 mM MgCl2, 400 µM deoxynucleotide triphosphates, 200 nM of each primer, 0.4x Sybrgreen, and 0.025 U/µl Amplitaq Gold enzyme. Amplified samples were electrophoresed on polyacrylamide gels to ensure that only a single band was amplified in each PCR. Primer sequences were for androgen binding protein (ABP): forward, GGAACAAATTCTTCTTGGCTTAACA, reverse, CTTAGGTTCTGCCTCGGAAGAC; transferrin: forward, GGACGCCATGACTTTGGATG, reverse, GCCATGACAGGCACTAGACCA; or as described elsewhere [AMH, claudin-11, luciferase, FSH receptor, and platelet-derived growth factor (PDGF)-A (10); cystatin-related gene highly expressed in testis and epididymis (cystatin-TE) and fatty acid binding protein (FABP) (28)]. For Pem, a probe was used to ensure specificity [primers and probe (22)], and 100 nM of each primer and 400 nM probe were added to the reaction. The quantity of measured mRNA was expressed relative to the luciferase standard in the same sample. All samples and standard curves were run in triplicate.
Statistical analysis
With the exception of the real-time PCR data whereby a two-sample t test was employed, statistical analysis was performed by using one-way ANOVA, supplemented with a Fisher multiple comparison test by using NCSS 2000 software (NCSS Statistical Analysis and Data Analysis Software, Kaysville, UT).
| Results |
|---|
|
|
|---|
SC nuclear volume/number per testis in ARKO and SCARKO males
At d 2, SC nuclear volume per testis was already reduced significantly by 32% in ARKO males, compared with controls. This decrement increased to 57% on d 50 and to more than 70% on d 140 (Fig. 1
). In contrast, in SCARKO males SC nuclear volume per testis was comparable with controls at d 2 and 50, whereas a small (16%) decrement was evident at d 140 (Fig. 1
). Determination of SC number at d 140 in the same animals revealed changes in ARKO and SCARKO animals almost identical with that shown for SC nuclear volume in Fig. 1
(control AMH-Cre 3.14 ± 0.12 x 106 SC per testis; ARKO 0.56 ± 0.10 x 106; SCARKO 2.66 ± 0.18 x 106; means ± SEM, n = 45 per group). The SC number in ARKOs was significantly different (P < 0.001) from the controls, but the difference in SCARKOs only approached statistical significance (0.05 < P < 0.1).
|
In controls, AMH expression in SC cytoplasm was intense at d 2, had declined but was still evident at d 12, and was nondetectable at d 20 and 50. SCARKO and ARKO males showed an identical age-related change in AMH immunoexpression (Fig. 2
). The absence of any difference in AMH expression between male controls and SCARKOs was confirmed by quantitative PCR (d 50) (see below) and Western blotting (d 250) (data not shown).
|
SGP-2 is one of the major SC-secreted proteins (30), although its function remains unclear. In controls, SGP-2 immunoexpression was weak in SC cytoplasm at d 2 and increased progressively in intensity between d 12 and 50, during which period the intensity of its immunoexpression became increasingly stage dependent; a similar age-dependent increase in SGP-2 immunoexpression was evident in SCARKO and ARKO animals (see supplemental data, published on The Endocrine Societys Journals Online web site at http://endo.endojournals.org).
GATA-1 is a zinc finger transcription factor that is first expressed in SCs during their maturation and development in the first wave of spermatogenesis (31). GATA-1 immunoexpression in controls was nondetectable at d 2 but was prominent in SC nuclei at d 12 and thereafter, and a similar age-dependent increase in GATA-1 immunoexpression was evident in SCARKO and ARKO animals (supplemental data).
AR immunoexpression showed an identical age-dependent pattern of expression in SCs in all controls (AMH-Cre, PGK-Cre, ARflox, and WT). Nuclear immunostaining was not detectable in SCs at d 2 but was observed from d 8 onward and was notably stage dependent in adulthood (Fig. 3
). In all controls, there was uniform nuclear AR immunoexpression in Leydig and peritubular myoid cells at all ages (Fig. 3
). In ARKO and SCARKO males, no AR immunoexpression in SCs was evident at any age, but in SCARKO animals normal AR immunoexpression was observed in Leydig and peritubular myoid cells, comparable with that in controls (Fig. 3
).
|
Functional capacity of SCs to support germ cells in ARKO and SCARKO males and testis weight
SCs in SCARKO males supported a normal volume of spermatogonia at d 2, 50, and 140, although there was a downward trend at d 140. In contrast, total germ cell volume supported per unit SC volume in SCARKOs was decreased by 69 and 76% at d 50 and d 140, respectively (Fig. 4
). At d 2, ARKO SCs supported significantly more (126%) spermatogonia than in controls, but at d 50 and 140, they supported a significantly lower volume of spermatogonia, with approximately a 60% reduction relative to controls or SCARKOs (Fig. 4
). This impaired function of ARKO SCs was manifested more dramatically with total germ cell volume per unit SCs, which was reduced by approximately 95% at d 50 and 140 relative to controls (Fig. 4
). The age-dependent changes in germ cell volume per SC in ARKO and SCARKO males was matched by changes in overall testis weight (Table 1
).
|
|
|
|
In SCARKO testes no overexpression of AMH mRNA was observed (Fig. 5
), in contrast with a previous report (23). Similarly, ABP and the FSH receptor mRNA were expressed at levels comparable with the control, whereas transferrin expression was slightly reduced (29%), and reductions of 3660% were noted for FABP, PDGF-A, cystatin-TE, and claudin-11 (Fig. 5
); the latter changes were still evident after correction for SC nuclear volume per testis (Fig. 5
).
| Discussion |
|---|
|
|
|---|
A role for androgens in regulating SC proliferation/final number in rodents had not been seriously considered in the past, perhaps because SCs do not normally express the AR for much of the period in which proliferation takes place (5, 9). This perspective has changed recently due to a study (10) that has shown that testicular feminized mice (tfm) exhibit an approximately 50% deficit in SC numbers at birth and a 75% deficit in adulthood and another study (12) showing that, in the neonatal rat, endogenous androgens play a physiological role in increasing SC number. Our present findings in ARKO males, which are analogous phenotypically to tfm mice, confirm the observations of Johnston et al. (10) by showing reductions in SC nuclear volume/number per testis of 31, 58, and 7182% at d 2, 50, and 140, respectively, in ARKO, compared with control males. However, what the present findings in SCARKOs demonstrate is that AR expression in SCs is not required for attainment of normal SC number, indicating that AR expression in another testicular cell type must be important for increasing SC proliferation perinatally in mice. Although the present findings do not allow unambiguous identification of this cell type(s), it seems highly likely that it is the peritubular myoid cell (PTMC). These cells express AR intensely throughout fetal and postnatal life, and there is abundant evidence in the literature, based mainly on coculture of isolated PTMCs and SCs, to show that secretions from the PTMCs can modify various aspects of SC function (15, 16), including the production of transferrin (16, 39, 40). It is also well established that PTMCs and SCs cooperate to lay down the basal lamina of the seminiferous cords (41, 42) to which the SCs adhere, and this could be a factor that limits SC proliferation via processes such as contact inhibition (43). Moreover, there is evidence that activin A produced by PTMCs may stimulate SC proliferation (44). Whether the production of activin A or other growth factors by PTMCs is androgen controlled remains to be shown. If proliferation of SCs is regulated indirectly via androgen action on neighboring PTMCs, it would provide an intriguing parallel with the rest of the developing male reproductive tract in which proliferation and differentiation of epithelial cells is regulated indirectly via androgen action on neighboring mesenchymal/stromal cells (45).
SC maturation, or terminal differentiation, is the process via which SCs lose their proliferative ability and acquire functions that will enable them to support spermatogenesis (6). Among other changes this involves marked down-regulation of AMH expression (6) and the switching on of p27kip1 (29) and GATA-1 (31) as well as the progressive up-regulation of SGP-2 (6, 46). We selected these markers on the basis of their SC specificity in the testis and because of their differing patterns and locations of expression (two nuclear vs. two cytoplasmic). To our surprise, the maturation-dependent changes in expression of all four proteins occurred normally in both ARKO and SCARKO males, demonstrating that at least some key aspects of SC functional maturation do not require either direct or indirect androgen action via the AR. In this regard, our finding that AMH expression is down-regulated normally in SCARKO testes at the same age as in controls, contrasts with the report of another group that also generated SC-selective AR knockouts (23). These authors did not study AMH expression throughout development as we have done, nor did they examine expression of other SC markers modulated during SC maturation. Our finding of normal maturation-dependent reduction in AMH expression in ARKOs (despite increased mRNA levels when expressed per SC in adulthood) is consistent with earlier data reported for tfm mice (10, 47).
The present findings confirm and extend previous findings by ourselves (22) and others (10, 23, 47) in AR-deficient mice, in showing that SCs in adulthood are incapable of supporting meiotic and postmeiotic germ cell development in the absence of androgen action via the AR. In this regard, ARKO males were considerably more deficient than were SCARKOs in adulthood because not only did their SC support fewer germ cells per SC, but also even SC support of spermatogonia was severely compromised. In contrast, SCs in SCARKOs supported normal numbers of spermatogonia and showed deficits only in postmeiotic germ cell support. The extent to which this difference reflects the abdominal vs. scrotal position of testes in ARKO and SCARKO adults, respectively, is unclear, but it is notable that before the time of normal testis descent (d 2), SCs in ARKO clearly supported normal/supranormal numbers of spermatogonia.
Data on gene expression in adult ARKO and SCARKO mice cover seven genes representative for diverse SC functions that have been analyzed previously in normal and tfm mice (10). Two genes encoding lipid-binding proteins (ABP, FABP), a tissue remodeling factor (cystatin-TE), a component of the tight junction complex (claudin-11), and three proteins related to endocrine or paracrine functions (PDGF-A, AMH, and FSH receptor). In addition, we included Pem as a control for direct androgen action on SCs and transferrin as a SC product, the secretion of which is known to be modulated by PTMCs. Gene expression data should be interpreted with caution because aberrant expression may be related to not only the absence of AR (ubiquitous or SC specific) but also indirect effects caused by absence of postmeiotic germ cells, changes in FSH secretion, and (in ARKOs) abnormal location of the testis. Data on AMH gene expression have been discussed above.
In confirmation of our previous studies, Pem expression was virtually absent in both ARKOs and SCARKOs. Immunostaining studies confirmed these differences at the protein level and indicated SC localization compatible with the proposed direct regulation by androgens (36). The expression of PDGF-A and FABP was also clearly reduced in SCARKOs and even more so in ARKOs (even after correction for the reduction in SC nuclear volume per testis). Whereas the data of Johnston et al. (10) in tfm mice suggest that the decrease in these parameters may be due to cryptorchidism, our data in SCARKOs, which unlike ARKOs have normally descended testes, indicate that this may not be the correct interpretation. One explanation could be that impaired expression of these genes is due to the decreased germ cell complement. In the adult testis, PDGF-A is expressed primarily in SCs, although weak expression in occasional interstitial cells may also occur (48); expression in the SCs occurs in a stage-dependent manner (48), a phenomenon frequently associated with germ cell modulation of SC function (49). Because PDGF-A has been shown to play an essential role in adult Leydig cell development (48), the marked reduction in expression of PDGF-A in testes of both ARKOs and SCARKOs could suggest that Leydig cell development is altered in these animals, and this is currently under investigation.
The limited reduction in the expression of the transferrin gene in SCARKOs and the severe reduction in ARKOs are of interest because earlier studies have indicated that PTMCs and their secretion products positively modulate transferrin production by SCs with some evidence of this being androgen regulated (16, 39, 40). The present findings are compatible with this hypothesis, but the slight reduction in transferrin mRNA in SCARKOs suggests that there may be additional control mechanisms involving either direct effects of androgens on SCs or indirect effects caused by the reduced germ cell complement (50, 51).
Surprisingly, cystatin-TE and claudin-11 expression levels were approximately normal in ARKOs after correction for SC number but were significantly reduced in SCARKOs. The normal expression levels of cystatin-TE and claudin-11 in ARKOs confirms a previous study in tfm animals (10), but the partial suppression of mRNA for these genes in SCARKOs is intriguing. It seems unlikely that this decrease could be explained by absence of particular germ cell types because ARKO animals lacked all of the same germ cell types as did SCARKOs but did not exhibit significant down-regulation of cystatin-TE and claudin-11 after correction for SC nuclear volume per testis. An alternative explanation might be that the higher FSH levels observed in ARKOs, compared with SCARKOs (22), could have led to increased expression of the mRNA for cystatin-TE and claudin-11 in the former. Claudin-11 has recently been demonstrated to be regulated at least in part by FSH (38).
Finally, when corrected for SC nuclear volume per testis, mRNA levels for ABP were normal in SCARKOs and ARKOs. A similar absence of androgen regulation of ABP expression has previously been observed in irradiated rats treated with GnRH analogs and antiandrogens (52). In SCARKOs and ARKOs, expression of the FSH receptor gene was slightly elevated after correction for SC nuclear volume per testis, and in the case of ARKOs, this was statistically significant. Whether this change is also related to altered FSH levels in these two lines (22) or is due to lack of androgen action on the SCs is a matter for speculation. Taken together, the described gene expression data show that, despite a normal pattern of change in expression of four proteins associated with SC maturation, significant changes occur in the expression of several SC genes in ARKOs and SCARKOs. Comparison of the gene expression pattern in these two lines, after correction for change in SC nuclear volume/number, provides a starting point for dissecting which genes might be regulated directly by androgen action on SCs. In this regard, the change in expression of Pem was dramatic (but expected), but the reduced expression of FABP and PDGF-A was also intriguing. Although it remains possible that expression of either or both of these genes by SCs could be secondary to altered signaling to the SCs from the reduced germ cell complement in ARKOs and SCARKOs, the alternative explanation that they might to some extent be directly androgen regulated merits further study.
In conclusion, the present studies show that complete ablation of androgen action in ARKO males results in major deficits in SC numbers, although at least some aspects of the SC maturation process appear to occur normally in these animals. In the selective absence of androgen action on SCs (SCARKO), these cells develop normally with respect to both their numbers and the expression of four selected maturational markers, but they are clearly unable to support late meiotic and postmeiotic germ cells; this is associated with changes in expression of a number of SC-expressed genes, in particular Pem, FABP, and PDGF-A. Given their normal testicular descent and the normality of expression of at least some indicators of SC functional maturation, SCARKO males will hopefully provide the means via which the SC functions necessary for survival of late meiotic and postmeiotic germ cells can be identified.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online March 10, 2005
1 K.A.L.T. and K.D.G. contributed equally to the work described. ![]()
Abbreviations: ABP, Androgen binding protein; AMH, anti-Müllerian hormone; AR, androgen receptor; ARKO, complete androgen receptor knockout; cystatin-TE, cystatin-related gene highly expressed in testis and epididymis; FABP, fatty acid binding protein; PDGF-A, platelet-derived growth factor-A; PGK, phosphoglycerate kinase-1; PTMC, peritubular myoid cell; SC, Sertoli cell; SCARKO, SC-selective androgen receptor knockout; SGP-2, sulfated glycoprotein-2; TBS, Tris-buffered saline; tfm, testicular feminized mice; WT, wild type.
Received December 17, 2004.
Accepted for publication February 28, 2005.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. Lim, M. Robson, J. Spaliviero, K. J. McTavish, M. Jimenez, J. D. Zajac, D. J. Handelsman, and C. M. Allan Sertoli Cell Androgen Receptor DNA Binding Domain Is Essential for the Completion of Spermatogenesis Endocrinology, October 1, 2009; 150(10): 4755 - 4765. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Ford and T. H. Wise Sertoli cell differentiation in pubertal boars J Anim Sci, August 1, 2009; 87(8): 2536 - 2543. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-S. Wang, S. Yeh, C.-R. Tzeng, and C. Chang Androgen Receptor Roles in Spermatogenesis and Fertility: Lessons from Testicular Cell-Specific Androgen Receptor Knockout Mice Endocr. Rev., April 1, 2009; 30(2): 119 - 132. [Abstract] [Full Text] [PDF] |
||||
![]() |
R P Hooley, M Paterson, P Brown, K Kerr, and P T K Saunders Intra-testicular injection of adenoviral constructs results in Sertoli cell-specific gene expression and disruption of the seminiferous epithelium Reproduction, February 1, 2009; 137(2): 361 - 370. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Kerkhofs, S Denayer, A Haelens, and F Claessens Androgen receptor knockout and knock-in mouse models J. Mol. Endocrinol., January 1, 2009; 42(1): 11 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. S. Brokken, A. Adamsson, J. Paranko, and J. Toppari Antiandrogen Exposure in Utero Disrupts Expression of Desert Hedgehog and Insulin-Like Factor 3 in the Developing Fetal Rat Testis Endocrinology, January 1, 2009; 150(1): 445 - 451. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Tahtamouni, N. H. Mustafa, A. A. Alfaouri, I. M Hassan, M. Y. Abdalla, and S. R. Yasin Prevalence and risk factors for anabolic-androgenic steroid abuse among Jordanian collegiate students and athletes Eur J Public Health, December 1, 2008; 18(6): 661 - 665. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. Chemes, R. A. Rey, M. Nistal, J. Regadera, M. Musse, P. Gonzalez-Peramato, and A. Serrano Physiological Androgen Insensitivity of the Fetal, Neonatal, and Early Infantile Testis Is Explained by the Ontogeny of the Androgen Receptor Expression in Sertoli Cells J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4408 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. MacLean, W. S. M. Chiu, C. Ma, J. F. McManus, R. A. Davey, R. Cameron, A. J. Notini, and J. D. Zajac A floxed allele of the androgen receptor gene causes hyperandrogenization in male mice Physiol Genomics, October 8, 2008; 33(1): 133 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chen, H. Cai, J.-L. Yang, C.-L. Lu, T. Liu, W. Yang, J. Guo, X.-Q. Hu, C.-H. Fan, Z.-Y. Hu, et al. Effect of Heat Stress on Expression of Junction-Associated Molecules and Upstream Factors Androgen Receptor and Wilms' Tumor 1 in Monkey Sertoli Cells Endocrinology, October 1, 2008; 149(10): 4871 - 4882. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Scott, G. R. Hutchison, M. S. Jobling, C. McKinnell, A. J. Drake, and R. M. Sharpe Relationship between Androgen Action in the "Male Programming Window," Fetal Sertoli Cell Number, and Adult Testis Size in the Rat Endocrinology, October 1, 2008; 149(10): 5280 - 5287. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Johnson, S. M. McCahan, X. Si, L. Campion, R. Herrmann, and J. S. Barthold The orl Rat with Inherited Cryptorchidism Has Increased Susceptibility to the Testicular Effects of In Utero Dibutyl Phthalate Exposure Toxicol. Sci., October 1, 2008; 105(2): 360 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Abel, P. J. Baker, H. M. Charlton, A. Monteiro, G. Verhoeven, K. De Gendt, F. Guillou, and P. J. O'Shaughnessy Spermatogenesis and Sertoli Cell Activity in Mice Lacking Sertoli Cell Receptors for Follicle-Stimulating Hormone and Androgen Endocrinology, July 1, 2008; 149(7): 3279 - 3285. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A Tarulli, S. J Meachem, S. Schlatt, and P. G Stanton Regulation of testicular tight junctions by gonadotrophins in the adult Djungarian hamster in vivo Reproduction, June 1, 2008; 135(6): 867 - 877. [Abstract] [Full Text] [PDF] |
||||
![]() |
P J O'Shaughnessy, L Hu, and P J Baker Effect of germ cell depletion on levels of specific mRNA transcripts in mouse Sertoli cells and Leydig cells Reproduction, June 1, 2008; 135(6): 839 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R Hutchison, H. M Scott, M. Walker, C. McKinnell, D. Ferrara, I. K. Mahood, and R. M Sharpe Sertoli Cell Development and Function in an Animal Model of Testicular Dysgenesis Syndrome Biol Reprod, February 1, 2008; 78(2): 352 - 360. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Benbrahim-Tallaa, B. Siddeek, A. Bozec, V. Tronchon, A. Florin, C. Friry, E. Tabone, C. Mauduit, and M. Benahmed Alterations of Sertoli cell activity in the long-term testicular germ cell death process induced by fetal androgen disruption J. Endocrinol., January 1, 2008; 196(1): 21 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. E Chausiaux, M. H Abel, F. O Baxter, W. T Khaled, P. J.I Ellis, H. M Charlton, and N. A Affara Hypogonadal Mouse, a Model to Study the Effects of the Endogenous Lack of Gonadotropins on Apoptosis Biol Reprod, January 1, 2008; 78(1): 77 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Periyasamy, M. Warrier, M. P. M. Tillekeratne, W. Shou, and E. R. Sanchez The Immunophilin Ligands Cyclosporin A and FK506 Suppress Prostate Cancer Cell Growth by Androgen Receptor-Dependent and -Independent Mechanisms Endocrinology, October 1, 2007; 148(10): 4716 - 4726. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J Kaitu'u-Lino, P. Sluka, C. F H Foo, and P. G Stanton Claudin-11 expression and localisation is regulated by androgens in rat Sertoli cells in vitro Reproduction, June 1, 2007; 133(6): 1169 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Scott, G. R. Hutchison, I. K. Mahood, N. Hallmark, M. Welsh, K. De Gendt, G. Verhoeven, P. O'Shaughnessy, and R. M. Sharpe Role of Androgens in Fetal Testis Development and Dysgenesis Endocrinology, May 1, 2007; 148(5): 2027 - 2036. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schauwaers, K. De Gendt, P. T. K. Saunders, N. Atanassova, A. Haelens, L. Callewaert, U. Moehren, J. V. Swinnen, G. Verhoeven, G. Verrijdt, et al. Loss of androgen receptor binding to selective androgen response elements causes a reproductive phenotype in a knockin mouse model PNAS, March 20, 2007; 104(12): 4961 - 4966. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xia, D. D. Mruk, and C. Y. Cheng C-type natriuretic peptide regulates blood-testis barrier dynamics in adult rat testes PNAS, March 6, 2007; 104(10): 3841 - 3846. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Merlet, C. Racine, E. Moreau, S. G. Moreno, and R. Habert Male fetal germ cells are targets for androgens that physiologically inhibit their proliferation PNAS, February 27, 2007; 104(9): 3615 - 3620. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Yong, Z. Yang, S. Periyasamy, H. Chen, S. Yucel, W. Li, L. Y. Lin, I. M. Wolf, M. J. Cohn, L. S. Baskin, et al. Essential Role for Co-chaperone Fkbp52 but Not Fkbp51 in Androgen Receptor-mediated Signaling and Physiology J. Biol. Chem., February 16, 2007; 282(7): 5026 - 5036. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Domanskyi, F.-P. Zhang, M. Nurmio, J. J. Palvimo, J. Toppari, and O. A. Janne Expression and localization of androgen receptor-interacting protein-4 in the testis Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E513 - E522. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Raivio, A. M Wikstrom, and L. Dunkel Treatment of gonadotropin-deficient boys with recombinant human FSH: long-term observation and outcome Eur. J. Endocrinol., January 1, 2007; 156(1): 105 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-S. Wang, S. Yeh, L.-M. Chen, H.-Y. Lin, C. Zhang, J. Ni, C.-C. Wu, P. A. di Sant'Agnese, K. L. deMesy-Bentley, C.-R. Tzeng, et al. Androgen Receptor in Sertoli Cell Is Essential for Germ Cell Nursery and Junctional Complex Formation in Mouse Testes Endocrinology, December 1, 2006; 147(12): 5624 - 5633. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Soriano-Guillen, V. Mitchell, J.-C. Carel, P. Barbet, M. Roger, and N. Lahlou Activating Mutations in the Luteinizing Hormone Receptor Gene: A Human Model of Non-Follicle-Stimulating Hormone-Dependent Inhibin Production and Germ Cell Maturation J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3041 - 3047. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Sharpe Perinatal Determinants of Adult Testis Size and Function. J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2503 - 2505. [Full Text] [PDF] |
||||
![]() |
G. A. Tarulli, P. G. Stanton, A. Lerchl, and S. J. Meachem Adult Sertoli Cells Are Not Terminally Differentiated in the Djungarian Hamster: Effect of FSH on Proliferation and Junction Protein Organization Biol Reprod, May 1, 2006; 74(5): 798 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Veldhuis, J. N. Roemmich, E. J. Richmond, and C. Y. Bowers Somatotropic and Gonadotropic Axes Linkages in Infancy, Childhood, and the Puberty-Adult Transition Endocr. Rev., April 1, 2006; 27(2): 101 - 140. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wistuba, C. M. Luetjens, R. Wesselmann, E. Nieschlag, M. Simoni, and S. Schlatt Meiosis in Autologous Ectopic Transplants of Immature Testicular Tissue Grafted to Callithrix jacchus Biol Reprod, April 1, 2006; 74(4): 706 - 713. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Denolet, K. De Gendt, J. Allemeersch, K. Engelen, K. Marchal, P. Van Hummelen, K. A. L. Tan, R. M. Sharpe, P. T. K. Saunders, J. V. Swinnen, et al. The Effect of a Sertoli Cell-Selective Knockout of the Androgen Receptor on Testicular Gene Expression in Prepubertal Mice Mol. Endocrinol., February 1, 2006; 20(2): 321 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Sneddon, N. Walther, and P. T. K. Saunders Expression of Androgen and Estrogen Receptors in Sertoli Cells: Studies Using the Mouse SK11 Cell Line Endocrinology, December 1, 2005; 146(12): 5304 - 5312. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. El Chami, F. Ikhlef, K. Kaszas, S. Yakoub, E. Tabone, B. Siddeek, S. Cunha, C. Beaudoin, L. Morel, M. Benahmed, et al. Androgen-dependent apoptosis in male germ cells is regulated through the proto-oncoprotein Cbl J. Cell Biol., November 21, 2005; 171(4): 651 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. De Gendt, N. Atanassova, K. A. L. Tan, L. R. de Franca, G. G. Parreira, C. McKinnell, R. M. Sharpe, P. T. K. Saunders, J. I. Mason, S. Hartung, et al. Development and Function of the Adult Generation of Leydig Cells in Mice with Sertoli Cell-Selective or Total Ablation of the Androgen Receptor Endocrinology, September 1, 2005; 146(9): 4117 - 4126. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |